Great research starts with great data.

Learn More
More >
Patent Analysis of

Polypeptides with permease activity

Updated Time 12 June 2019

Patent Registration Data

Publication Number

US10000537

Application Number

US14/895742

Application Date

04 June 2014

Publication Date

19 June 2018

Current Assignee

DSM IP ASSETS B.V.

Original Assignee (Applicant)

DSM IP ASSETS B.V.

International Classification

C12P21/06,C07K14/395,C12P19/02,C07K1/00,C07H21/04

Cooperative Classification

C07K14/395,C12P19/02

Inventor

KLAASSEN, PAUL,DE WAAL, PAULUS PETRUS,DE JONG, RENE MARCEL,DRIESSEN, ARNOLD JACOB MATTIEU,NIJLAND, JEROEN GERBEN,SHIN, HYUN YONG

Patent Images

This patent contains figures and images illustrating the invention and its embodiment.

US10000537 Polypeptides permease activity 1 US10000537 Polypeptides permease activity 2 US10000537 Polypeptides permease activity 3
See all images <>

Abstract

The invention relates to a polypeptide having one or more substitution at a position corresponding to position 339 or 376 of SEQ ID NO: 59, wherein the polypeptide is a member of the Major Facilitator Superfamily (MFS). In an embodiment, the substitution is at position corresponding to 376 and wherein the amino acid at that position is replaced by an amino acid that has a van der Waals volume of 80 to 138 Å3 and a side chain hydrophobicity of 10 to 100 ΔtR.

Read more

Claims

1. A Saccharomyces cell transformed with a polynucleotide encoding a polypeptide having at least 90% sequence identity with SEQ ID NO:59, comprising: a) one or more substitution at a position corresponding to position 376 of SEQ ID NO:59, selected from the group consisting of N376M, N376T, N376C, N376L, N376I, N376F, and N376V; andb) one or more of the following amino acid motifs: i) G-R-x(3)-G-x(3)-G-x(11)-E-x(5)-[LIVM]-R-G-x(12)-[GA], corresponding to residues 179-221 of SEQ ID NO:59; ii) R-x(14)-G-x(2)-Y-x(2)-[YF]-[YF]-[GSAL], corresponding to residues 330-353 of SEQ ID NO:59; and iii) V-x(15)-[GNR]-[RH]-R-x(2)-[LM]-x(2)-[GA], corresponding to residues 375-399 of SEQ ID NO:59; wherein the polypeptide has sugar transporter activity.

2. The Saccharomyces cell according to claim 1, wherein the polypeptide encodes amino acid motifs i), ii), and iii).

3. The Saccharomyces cell according to claim 2, wherein the polypeptide is a mutant of a polypeptide that is native in an untransformed Saccharomyces cell, selected from the group consisting of Gal2, Hxt1, Hxt2, Hxt3, Hxt4, Hxt5, Hxt6, Hxt7, Hxt8, Hxt9, Hxt10, Hxt11, Hxt12, Hxt13, Hxt14, Hxt15, Hxt16, and Hxt17.

4. The Saccharomyces cell according to claim 1, wherein the polypeptide has reduced glucose transport activity compared to the polypeptide of SEQ ID NO:59.

5. The Saccharomyces cell according to claim 1, wherein the polypeptide has improved xylose transport activity compared to the polypeptide of SEQ ID NO:59.

6. The Saccharomyces cell according to claim 1, wherein the Saccharomyces cell has decreased glucose transport activity and improved xylose transport activity compared to a Saccharomyces cell expressing SEQ ID NO:59.

7. The Saccharomyces cell polypeptide according to claim 2, wherein the polypeptide is a mutant of a polypeptide that is native in an untransformed Saccharomyces cell, selected from the group consisting of SEQ ID NOs: 59 and 150 through 167.

8. A nucleic acid construct encoding a polypeptide having at least 90% sequence identity with SEQ ID NO:59, comprising: a) one or more substitution at a position corresponding to position 376 of SEQ ID NO:59, selected from the group consisting of N376M, N376T, N376C, N376L, N376I, N376F, and N376V; andb) one or more of the following amino acid motifs: i) G-R-x(3)-G-x(3)-G-x(11)-E-x(5)-[LIVM]-R-G-x(12)-[GA], corresponding to residues 179-221 of SEQ ID NO:59; ii) R-x(14)-G-x(2)-Y-x(2)-[YF]-[YF]-[GSAL], corresponding to residues 330-353 of SEQ ID NO:59; and iii) V-x(15)-[GNR]-[RH]-R-x(2)-[LM]-x(2)-[GA], corresponding to residues 375-399 of SEQ ID NO:59; wherein the polypeptide has sugar transporter activity.

9. The transformed Saccharomyces cell according to claim 1, which belongs to the species Saccharomyces cerevisiae.

10. The transformed Saccharomyces cell according to claim 1, wherein the polynucleotide encodes a polypeptide that is a mutant of a polypeptide that is native in an untransformed Saccharomyces cell.

11. The transformed Saccharomyces cell according to claim 10, wherein the polypeptide that is native in the untransformed Saccharomyces cell has sugar transporter activity.

12. The transformed Saccharomyces cell according to claim 10, wherein the polypeptide that is native in the untransformed Saccharomyces cell is a hexose transporter polypeptide.

13. The transformed Saccharomyces cell according to claim 11, wherein the polypeptide that is native in the untransformed Saccharomyces cell is a hexose transporter polypeptide.

14. The transformed Saccharomyces cell according to claim 13, wherein the polypeptide that is native in the untransformed host cell is a polypeptide selected from the group consisting of Gal2, Hxt1, Hxt2, Hxt3, Hxt4, Hxt5, Hxt6, Hxt7, Hxt8, Hxt9, Hxt10, Hxt11, Hxt12, Hxt13, Hxt14, Hxt15, Hxt16, and Hxt17.

15. The transformed Saccharomyces cell of claim 1 that, when subjected to the Glucose Transport Activity Counter Screen (GTAC) protocol, consumes xylose from a medium comprising xylose and glucose, while glucose is still present in the medium.

16. The transformed Saccharomyces cell according to claim 15 that, when subjected to the Glucose Transport Activity Counter Screen (GTAC) protocol, consumes xylose faster than said transformed Saccharomyces cell consumes glucose.

17. A polypeptide having at least 90% sequence identity with SEQ ID NO:59, comprising: a) a substitution corresponding to N376T of SEQ ID NO:59; andb) one or more of the following amino acid motifs: i) G-R-x(3)-G-x(3)-G-x(11)-E-x(5)-[LIVM]-R-G-x(12)-[GA], corresponding to residues 179-221 of SEQ ID NO:59; ii) R-x(14)-G-x(2)-Y-x(2)-[YF]-[YF]-[GSAL], corresponding to residues 330-353 of SEQ ID NO:59; and iii) V-x(15)-[GNR]-[RH]-R-x(2)-[LM]-x(2)-[GA], corresponding to residues 375-399 of SEQ ID NO:59; wherein the polypeptide has xylose transporter activity.

18. The polypeptide according to claim 17, wherein the polypeptide is expressed in an eukaryotic cell and the eukaryotic cell is used to ferment xylose in the presence of glucose.

19. A process for degradation of ligno-cellulosic or hemi-cellulosic material, wherein ligno-cellulosic or hemi-cellulosic material is contacted with an enzyme composition, wherein one or more sugar is produced, and wherein produced sugar is fermented to give ethanol as a fermentation product, wherein the fermentation is conducted with the transformed Saccharomyces cell of claim 1.

20. The process according to claim 19, wherein produced sugar comprises xylose and glucose and wherein the Saccharomyces cell co-ferments xylose and glucose.

21. A process for the degradation of ligno-cellulosic or hemi-cellulosic material, wherein ligno-cellulosic or hemi-cellulosic material is contacted with an enzyme composition, wherein one or more sugar is produced, and wherein the produced sugar is fermented to give ethanol as a fermentation product, wherein the fermentation is conducted with the transformed Saccharomyces cell of claim 1.

22. The Saccharomyces cell of claim 1, wherein the polynucleotide encodes a polypeptide having at least 95% sequence identity with SEQ ID NO:59.

23. The Saccharomyces cell of claim 1, wherein the polynucleotide encodes a polypeptide having at least 98% sequence identity with SEQ ID NO:59.

24. The Saccharomyces cell of claim 1, wherein the polynucleotide encodes a polypeptide having at least 99% sequence identity with SEQ ID NO:59.

25. The nucleic acid construct of claim 8, encoding a polypeptide having at least 95% sequence identity with SEQ ID NO:59.

26. The nucleic acid construct of claim 8, encoding a polypeptide having at least 98% sequence identity with SEQ ID NO:59.

27. The nucleic acid construct of claim 8, encoding a polypeptide having at least 99% sequence identity with SEQ ID NO:59.

28. The polypeptide of claim 17, having at least 95% sequence identity with SEQ ID NO:59.

29. The polypeptide of claim 17, having at least 98% sequence identity with SEQ ID NO:59.

30. The polypeptide of claim 17, having at least 99% sequence identity with SEQ ID NO:59.

Read more

Claim Tree

  • 1
    1. A Saccharomyces cell transformed with a polynucleotide encoding a polypeptide having
    • at least 90% sequence identity with SEQ ID NO:59, comprising: a) one or more substitution at a position corresponding to position 376 of SEQ ID NO:59, selected from the group consisting of N376M, N376T, N376C, N376L, N376I, N376F, and N376V
    • andb) one or more of the following amino acid motifs: i) G-R-x(3)-G-x(3)-G-x(11)-E-x(5)-[LIVM]-R-G-x(12)-[GA], corresponding to residues 179-221 of SEQ ID NO:59
    • ii) R-x(14)-G-x(2)-Y-x(2)-[YF]-[YF]-[GSAL], corresponding to residues 330-353 of SEQ ID NO:59
    • and iii) V-x(15)-[GNR]-[RH]-R-x(2)-[LM]-x(2)-[GA], corresponding to residues 375-399 of SEQ ID NO:59
    • wherein the polypeptide has sugar transporter activity.
    • 2. The Saccharomyces cell according to claim 1, wherein
      • the polypeptide encodes amino acid motifs i), ii), and iii).
    • 4. The Saccharomyces cell according to claim 1, wherein
      • the polypeptide has reduced glucose transport activity compared to the polypeptide of SEQ ID NO:59.
    • 5. The Saccharomyces cell according to claim 1, wherein
      • the polypeptide has improved xylose transport activity compared to the polypeptide of SEQ ID NO:59.
    • 6. The Saccharomyces cell according to claim 1, wherein
      • the Saccharomyces cell has decreased glucose transport activity and improved xylose transport activity compared to a Saccharomyces cell expressing SEQ ID NO:59.
    • 9. The transformed Saccharomyces cell according to claim 1, which belongs to the species Saccharomyces cerevisiae.
    • 10. The transformed Saccharomyces cell according to claim 1, wherein
      • the polynucleotide encodes a polypeptide that is a mutant of a polypeptide that is native in an untransformed Saccharomyces cell.
    • 15. The transformed Saccharomyces cell of claim 1 that, when subjected to the Glucose Transport Activity Counter Screen (GTAC) protocol, consumes xylose from a medium comprising
      • xylose and glucose, while glucose is still present in the medium.
    • 22. The Saccharomyces cell of claim 1, wherein
      • the polynucleotide encodes a polypeptide having
    • 23. The Saccharomyces cell of claim 1, wherein
      • the polynucleotide encodes a polypeptide having
    • 24. The Saccharomyces cell of claim 1, wherein
      • the polynucleotide encodes a polypeptide having
  • 8
    8. A nucleic acid construct encoding a polypeptide having
    • at least 90% sequence identity with SEQ ID NO:59, comprising: a) one or more substitution at a position corresponding to position 376 of SEQ ID NO:59, selected from the group consisting of N376M, N376T, N376C, N376L, N376I, N376F, and N376V
    • andb) one or more of the following amino acid motifs: i) G-R-x(3)-G-x(3)-G-x(11)-E-x(5)-[LIVM]-R-G-x(12)-[GA], corresponding to residues 179-221 of SEQ ID NO:59
    • ii) R-x(14)-G-x(2)-Y-x(2)-[YF]-[YF]-[GSAL], corresponding to residues 330-353 of SEQ ID NO:59
    • and iii) V-x(15)-[GNR]-[RH]-R-x(2)-[LM]-x(2)-[GA], corresponding to residues 375-399 of SEQ ID NO:59
    • wherein the polypeptide has sugar transporter activity.
    • 25. The nucleic acid construct of claim 8, encoding a polypeptide having
      • at least 95% sequence identity with SEQ ID NO:59.
    • 26. The nucleic acid construct of claim 8, encoding a polypeptide having
      • at least 98% sequence identity with SEQ ID NO:59.
    • 27. The nucleic acid construct of claim 8, encoding a polypeptide having
      • at least 99% sequence identity with SEQ ID NO:59.
  • 17
    17. A polypeptide having
    • at least 90% sequence identity with SEQ ID NO:59, comprising: a) a substitution corresponding to N376T of SEQ ID NO:59
    • andb) one or more of the following amino acid motifs: i) G-R-x(3)-G-x(3)-G-x(11)-E-x(5)-[LIVM]-R-G-x(12)-[GA], corresponding to residues 179-221 of SEQ ID NO:59
    • ii) R-x(14)-G-x(2)-Y-x(2)-[YF]-[YF]-[GSAL], corresponding to residues 330-353 of SEQ ID NO:59
    • and iii) V-x(15)-[GNR]-[RH]-R-x(2)-[LM]-x(2)-[GA], corresponding to residues 375-399 of SEQ ID NO:59
    • wherein the polypeptide has xylose transporter activity.
    • 18. The polypeptide according to claim 17, wherein
      • the polypeptide is expressed in an eukaryotic cell and the eukaryotic cell is used to ferment xylose in the presence of glucose.
    • 28. The polypeptide of claim 17, having
      • at least 95% sequence identity with SEQ ID NO:59.
    • 29. The polypeptide of claim 17, having
      • at least 98% sequence identity with SEQ ID NO:59.
    • 30. The polypeptide of claim 17, having
      • at least 99% sequence identity with SEQ ID NO:59.
  • 19
    19. A process for degradation of ligno-cellulosic or hemi-cellulosic material, wherein
    • ligno-cellulosic or hemi-cellulosic material is contacted with an enzyme composition, wherein
    • 20. The process according to claim 19, wherein
      • produced sugar comprises
  • 21
    21. A process for the degradation of ligno-cellulosic or hemi-cellulosic material, wherein
    • ligno-cellulosic or hemi-cellulosic material is contacted with an enzyme composition, wherein
See all independent claims <>

Description

CROSS REFERENCE TO RELATED APPLICATIONS

This application is a § 371 National Stage Application of PCT/EP2014/061632, filed 4 Jun. 2014, which claims priority to EP 13170644.2, filed 5 Jun. 2013, EP 13170646.7, filed 5 Jun. 2013, EP 13170648.3, filed 5 Jun. 2013, EP 13197988.2, filed 18 Dec. 2013, EP 14160772.1, filed 19 Mar. 2014 and EP 14164270.2, filed 10 Apr. 2014.

BACKGROUND

Field of the Invention

The invention is directed to novel polypeptides and to recombinant organisms expressing the polypeptides. In an embodiment, the present invention relates to novel permease polypeptides with altered sugar specificity and/or sugar transport activity.

Description of Related Art

The plasma membrane of yeast cells and other eukaryotes is a complex bio-membrane, consisting of two layers of phospholipids, with a plethora of proteins embedded in it. Many molecules may cross the plasma membrane by diffusion and osmosis or with the aid of specific transport systems.

Transport systems allow the uptake of nutrients and ions, export of products of metabolism and undesired or harmful substances. Different mechanisms exist. Primary active transporters drive solute accumulation or extrusion by using for instance ATP hydrolysis. Secondary carriers, belonging to the Major Facilitator Superfamily (MFS) transporters, facilitate the transport of one or more molecular species across the membrane in response to chemi-osmotic gradients. In the yeast Saccharomyces cerevisiae, 186 MFS proteins have been identified (Nelissen, 1997) in strain S288c.

An example of such a carrier is the Hxt1 protein, involved in hexose transport in Saccharomyces cerevisiae.

Permeases are membrane transport proteins, a class of multipass transmembrane proteins that facilitate the diffusion of a specific molecule, herein specifically one or more sugar, in or out of the cell by passive transport. In contrast, active transporters couple molecule transmembrane transport with an energy source such as ATP or a favorable ion gradient.

The terms permease, facilitator, transporter or transport protein or related terms are all describing proteins with multiple membrane spanning domains that exhibit a function in transporting molecules across a membrane. This transport can be brought about by different mechanisms: uniport (transport of one molecule), symport (simultaneous co-transport of two different molecules in the same direction), antiport (simultaneous transport of two molecules in opposite directions) and facilitated diffusion.

The family of sugar transporters in yeast consists of 30-40 members (34 members in strain S288c (Nelissen, 1997)). The sugar transporters can be divided in five clusters: hexose permeases (HXT-genes, GAL2), disaccharide permeases, myo-inositol permeases, sugar receptors and a final cluster of transporters of which the substrate is unknown.

Lignocellulosic biomass, an attractive alternative feedstock for the production of liquid transportation fuels, consists of several different sugars. The hexose fraction of lignocellulose, mainly glucose, can in principle be readily fermented by non-recombinant versions of the yeast S. cerevisiae. However, this organism is not able to metabolize the pentose sugars, such as xylose and arabinose, into ethanol.

Methods of creating microorganisms that are able to metabolize pentose sugars are known in the art. For instance, in WO/2009/109630 the construction of expression cassettes and the transformation of S. cerevisiae cells into pentose fermenting cells by expressing xylose isomerase are illustrated.

Native pentose-utilizing organisms exist but are lacking well-developed genetic tools and/or low product tolerances, which limit their suitability as hosts for lignocellulosic conversion processes.

As a consequence, efforts have focused on the introduction of pentose conversion pathways in the yeast S. cerevisiae, which is still the organism of choice in the ethanol industry, in order to enable pentose fermentation.

Despite the vast amount of progress achieved in the past years, the transport of pentose sugars is still considered to be (one of) the rate-limiting step in pentose metabolism.

Pentose transport in S. cerevisiae is mediated by the different members of the hexose transporter (Hxt) family. Hxt4, Hxt5, Hxt7 and Gal2 have been described as the main xylose transporters in S. cerevisiae (Hamacher et al, 2002), and Gal2 is also known to mediate arabinose transport (Becker et al, 2003). However, the affinity for the respective pentose sugars is approximately 10 to 100 times lower than for the respective hexose sugars. The lack of a dedicated xylose or arabinose transporter in recombinant yeast cells thus limits the capacity for co-utilization of hexoses and pentoses in sugar mixtures, and prohibits a high pentose catabolic flux. As a consequence, conversion of biomass sugars may be considered bi-phasic: in the first phase, a relatively fast conversion of hexoses (glucose) takes place, while in the second phase, which starts when the hexoses have been exhausted from the medium, pentose fermentation commences, but at a far lower rate as compared to the rate of hexose conversion.

It is therefore a long-felt desire to express pentose-specific sugar transporters, i.e. no glucose interference (pentose specificity) and high affinity to pentose, in an otherwise unchanged transporter landscape, in order to maintain the ability to convert hexoses at approximately the same level.

One way of solving this problem is to screen for heterologous sugar (pentose) transporters which are pentose specific and have a (moderately) high affinity for pentose. However, such efforts have been with limited success so far. Only a few have been shown to be able to facilitate pentose transport upon expression in S. cerevisiae, but all favour glucose above xylose (Young et al, 2011, and references therein), as is the case with the S. cerevisiae Hxt-proteins, as indicated above.

Another approach is to re-engineer hexose transporters to pentose transporters. For instance, the works by Kasahara et al (2000; 2009; 2010) indicate which residues in several sugar transporters play a key role in the determination of the substrate affinity to the natural substrate.

Mutant hexose transporters that are able to transport pentose sugars more efficiently are known in the art. For instance, in WO/2012/049173, the isolation of mutant hexose transporter genes from cultures of pentose-fermenting S. cerevisiae cells is described.

In Saccharomyces cerevisiae, the permease GAL2 transports galactose across the cell membrane. It is also known as a transporter of glucose across the membrane.

SUMMARY

An object of the invention is to provide novel permease polypeptides with altered, in particular improved, sugar specificity. Another object of the invention is to provide recombinant strains expressing the permease polypeptide that have improved uptake of the molecule that the permease transports across the cell membrane. Another object is to provide a permease polypeptide that has a improved capacity for transport of C5 sugars, in particular xylose compared to a parent polypeptide. Another object is to provide a permease polypeptide that has reduced transport activity for C6 sugar, in particular glucose, compared to a parent polypeptide. Another object is to provide a method to identify mutations in other related permease polypeptides that have a beneficial effect on the improved capacity for transport of xylose or reduced transport activity for glucose.

One or more of these objects are attained according to the invention. According to the present invention, there is provided a polypeptide having one or more substitution at a position corresponding to position 339 or 376 of SEQ ID NO: 59, wherein the polypeptide is a member of the Major Facilitator Superfamily (MFS). In an embodiment, the substitution is at position corresponding to 376 and wherein the amino acid at that position is replaced by an amino acid that has a van der Waals volume of 80 to 138 Å3 and a side chain hydrophobicity of 10 to 100 ΔtR. In an embodiment tha amino ccid has at position 376 have a van der Waals volume of 85 to 138 Å3 and a side chain hydrophobicity of 10 to 100 ΔtR.

The values for van der Waals volume (Å3) for amino acids are herein used as described in: www.proteinsandproteomics.org/content/free/tables_1/t able08.pdf. The corresponding literature is N. J. Darby, Thomas E. Creighton, Protein Structure (1993) Oxford University Press. The values for side chain hydrophobicity (ΔtR) of amino acids are herein used as described in onlinelibrary.wiley.com/doi/10.1002/psc.310010507/pdf. The reference corresponding to this is Monera, O. D. et al, Journal of Peptide Science 1995; 1(5):319-329.

A polypeptide according to the invention having one or more of these mutations has an advantageous sugar consumption and/or fermentation product production. This will be described in more detail below and will be illustrated by examples 1-5 below.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows results of aerobic shake flask cultures hexose transporter mutants on Verduyn-urea+15 g l−1 glucose+20 g l−1 xylose. (A) Optical density measurements at 600 nm wavelength, (B) glucose concentrations (g l−1), (C) xylose concentrations during the culture period.

FIG. 2 shows results of aerobic shake flask cultures hexose transporter mutants on Verduyn-urea+20 g l−1 xylose. (A) Optical density measurements at 600 nm wavelength, (B) xylose concentrations (g l−1).

FIG. 3 shows the strain construction scheme for strain YD01227

FIG. 4 shows results of aerobic shake flask cultures of quadruple hexose kinase mutant (col 2) and reference strain RN1014 on Verduyn-urea+100 g l−1 glucose+20 g l−1 xylose. A) Optical density measurements at 600 nm wavelength, (B) glucose concentrations (g l−1), (C) xylose concentrations during the culture period.

FIG. 5 shows results of micro-well plate cultures on glucose-xylose mixtures. Growth characteristics of reference strain RN1014, and quadruple hexokinase mutants YD01227 and colony 2 (Col 2) with equal genotype on Verduyn-urea supplemented with mixtures of glucose and xylose in the following concentrations: (A) 60+20, (B) 100+20, (C) 15+5, and (D) 25 g l−1+5 g l−1, respectively. Every 15 minutes, OD600 was measured automatically by a Bioscreen C apparatus. Data points are the average of measurements in triplicate.

FIG. 6 shows a plasmid map pRN993.

FIG. 7 shows the relationships between residual xylose and glucose concentrations (A), or residual xylose concentrations and growth (OD600; B) in the Glucose Transport Activity Counter Screen (GTAC screen), see examples. Residual xylose concentrations (g l−1) were plotted against the residual (A) glucose concentration (g l−1) and (B) OD600 at 96 hours. (Inset B) linear regression analysis of shows a good correlation of OD600 and xylose. Each data point represents the average of sugar concentrations of 1 to 3 replicates, or of multiple measurements of RN1001 control strain or medium samples per part of the screen.

FIG. 8 shows growth and xylose consumption of Gal2-N376-mutant variants in the GTAC screen. (A) OD600 measurements at time points 24, 72 and 96 hours, and (B) residual xylose concentrations (g l−1) measured for the Gal2-N376-mutant variants, RN1001 control strain and empty samples (YD10 medium-only) during the GTAC Screen. Each column represents the average OD600 or residual xylose concentration of 3 transformants; error bars represent the standard error of the mean. Asterisks indicate amino acids with large hydrophobic side chains with a clear effect.

FIG. 9 shows growth profiles of TOP15 Xylose Transport Activity (XTA) Screening (see examples). OD600 values of the three sampling points for the TOP15 strains/variants from (A) Part A and (B) Part B of the XTA Screen. Each column represents the average OD600 of 3 transformants; error bars represent the standard error of the mean.

FIG. 10 shows an alignment of permease protein sequences.

FIG. 11 shows plot of amino acid van der Waals volume (Å3) (Y-axis) against amino acid hydrophobicity (ΔtR) (X-axis). Advantageous amino acids (reduced glucose transport activity) for position corresponding to 376 in SEQ ID NO: 59 are within the area defined by the short striped lines and for position 339 by the long strips lines. Values for van der Waals volume used herein are described in: www.proteinsandproteomics.org/content/free/tables_1/t able08.pdf. The corresponding literature is N. J. Darby, Thomas E. Creighton, Protein Structure (1993) Oxford University Press. The values for hydrophobicity (ΔtR) of amino acids are herein used as described in onlinelibrary.wiley.com/doi/10.1002/psc.310010507/pdf. The reference corresponding to this is Monera, O. D. et al, Journal of Peptide Science 1995; 1(5):319-329.

FIG. 12 shows (A) Growth curve of evolved strain RN1053-X2 and wild-type strain RN1053 on Verduyn-urea-his supplemented with 2% xylose. Growth curves were expressed as units of optical density (OD) measured at 600 nm wavelength (OD600) over time (h) (B) Expression level of HXT8-HXT17 in the strain RN1053-X2. Expression level relative to ACT1 levels in each sample, was expressed as Normalised Fold Expression Level; expression levels were normalized against RN1053 mRNA levels of the specific HXT gene (RN1053 expression level set to 1).

FIG. 13 (A-B) shows. (A) HXT11 Expression level and (B) Growth of HXT11 knockout strains (KO1 to -6) compared to RN1053-X2-empty (1053-X2) and RN1053-empty. Growth was expressed as units of optical density (OD) measured at 600 nm wavelength (OD600).

FIG. 13 (C-D) shows (C) Plasmid map of pRS313-P7T7, (D) Growth of RN1053-X2 transformed with empty vector control (1053-X), and of four transformants after introduction of pRS313-P7T7-inverse HXT11 (iHXT1 to −4) on Verduyn-urea supplemented with 2% xylose. Growth was expressed as units of optical density (OD) measured at 600 nm wavelength (OD600)

FIG. 14 shows growth profiles of RN1053-HXT11 (Hxt11, closed diamonds), RN1053-HXT12 (Hxt12, open triangles), RN1053-empty vector control (1053; triangles), RN1041-empty vector control (1041; open squares) on Verduyn-urea supplemented with (A) mixture of glucose and xylose (2% each) or (B) 2% xylose. Growth curves were expressed as units of optical density (OD) measured at 600 nm wavelength (OD600) over time (h).

FIG. 15 shows xylose uptake studies on RN1053-HXT11 (HXT11), RN1053-HXT2 (Hxt2), RN1053-empty (empty) with or without increasing concentrations of competing glucose (0-500 mM).

FIG. 16 shows (A) Growth of RN1053 expressing chimeric Hxt11p-GFP protein on 2% xylose at 16 h (initial cell density was OD 0.5). (B) Fluorescence microscopy of RN1053-HXT11 and RN1041-HXT11 grown on Verduyn-urea supplemented with glucose or xylose.

FIG. 17 shows fermentation profiles of sugar consumption and ethanol production of (A) RN1041-empty plasmid and (B) RN1053-HXT11 on Verduyn-urea supplemented with 80 g l−1 glucose and 40 g l−1 xylose.

FIG. 18 shows growth profiles (OD600)(A), residual xylose (B) and glucose (C) concentrations (g l−1) after 96 hours GTAC-screen with YD01227-GAL2 (n=3), YD01227-HXT2 (n=3), YD01227-HXT11 (n=3) transformants. Medium and RN1001 samples were added as controls.

FIG. 19 (A-B). shows growth profiles of shake flask cultures of (A) YD01227-empty, YD01227-HXT11 and YD01227-mHXT11(N366D) transformants (n=2) on Verduyn-urea supplemented with 15% glucose and 1% xylose and, (B) of RN1053-transformants on Verduyn-urea with 2% xylose (n=3).

FIG. 19 (C-E) shows 14C-radiolabeled sugar uptake profiles by RN1053-HXT11 and RN1053-mHXT11(N366D). (A)14C-glucose uptake, and 14C-xylose uptake in the absence (D) and presence (E) of increasing unlabeled glucose (0-500 mM) concentrations. Sugar uptake was expressed as nmol mg dry weight (DW) of yeast per minute (min).

FIG. 19 (C-F) shows fermentation profiles of RN1041-empty (closed diamonds; 1041+empty), RN1053-HXT11 (closed triangles; 1053+HXT11), RN1053-mHXT11 (N366D) (closed squares; 1053+epHXT11) on Verduyn-urea+100 g l−1 glucose and 60 g l−1 xylose. (C) Growth curves (expressed by OD600 measurements) over time (h). Constituents measured in the fermentation broth over time (h) such as (D) glucose, (E) xylose and (F) ethanol.

FIG. 19 (J-L) shows fermentation profiles on Verduyn-urea supplemented with 80 g l−1 glucose and 40 g l−1 xylose of strain RN1053-HXT11 (J and L-grey dashed line) and RN1053-mHXT11(N366D) (K and L-black line). (L) Combined figure of both fermentation profiles illustrated in (J) and (K).

FIG. 20 shows the scheme for the glucose/xylose ratio in the Verduyn-urea-his medium during chemostat cultivation (days) of YD01227;

FIG. 21 shows growth profiles of shake flask cultures on Verduyn-urea-his supplemented with 1% xylose without (closed triangles; 1+0) or with (3% glucose, stripe, 1+3; 6% glucose, closed circles, 1+6; 10% glucose, closed diamonds, 1+10) increasing glucose concentrations with YD01227-evo (A) and YD01227-ori (B). (C)14C-xylose uptake study of YD01227-ori (1227-ori, closed squares) or YD01227-evo (1227-evo, closed diamonds) with or without increasing glucose concentrations (0-500 mM).

FIG. 22 shows (A) mRNA expression profile of YD01227-ori (white bars), YD01227-evoB on Verduyn-urea-his supplemented with a sugar mixture in a ratio xylose:glucose 1:3 (gray bars) and 1:10 (black bars). Data were expressed as normalized expression (relative to ACT1 and relative to YD01227-ori, which was set to 1).

FIG. 22 (B-D) Uptake experiments with Xylose (B) and Glucose (C). Uptake was measured in nmol/mg·DW·min in RN1053-Hxt3-6 (diamonds), RN1053-N367I (triangles) and 1053-emp (squares). (D) Uptake of 50 mM 14C Xylose in the presence of 0, 50, 100, 200 and 500 mM Glucose in the RN1053-Hxt3-6 (diamonds) and RN1053-N367I strain (squares).

FIG. 23 Fluorescence images of strain RN1053 expressing GFP fusion proteins of Hxt36 (A) and Hxt36-N367I (B). Images were analyzed on a Nikon Eclipse-Ti microscope. (C) Total amount of GFP fluorescence (in AU/OD600) in both strains.

FIG. 24 Growth of the YD01227 strain containing vectors expressing HXT36 transporters with all possible amino acid substitutions at position 367. Cells were grown on 1% xylose and 10% xylose, and YD01227 transformed with the empty vector pRS313-P7T7 was used as a control.

FIG. 25 Uptake experiments to determine the Km and Vmax for glucose (panel A) and xylose (panel B). Uptake was measured in nmol/mgDW·min in the RN1053-HXT36 strain (diamonds), the RN1053-HXT36-N367I strain (squares) and in the RN1053-HXT36-N367A strain (triangles). The uptake levels of the RN1053-empty strain were, for both sugars, subtracted from the RN1053-HXT36, RN1053-HXT36-N367I and RN1053-HXT36-N367A strains.

FIG. 26 Growth of the RN1053 strain expressing HXT36 (A), HXT36-N367I (B) and HXT36-N367A (C) on 5 g L−1 D-glucose and 5 g l−1 D-xylose. The residual D-glucose (diamonds), D-xylose (squares) and ethanol (circles) were measured in g/l.

FIG. 27 Characterization of xylose specificity of HXT11-N366X mutants. (A) Maximal Exponential growth rate (1/h) of HXT11-N366X mutants in the strain YD01227. Maximal exponential growth rate (1/h) for N366X mutants expressed in RN1053 on glucose (B) or xylose (C).

FIG. 28 Fluorescence images of strain RN1053 expressing GFP fusion proteins of HXT11 N366X mutants grown on 2% maltose. Letters in left upper hand of picture depict the amino acid on position 366 of the respective Hxt11 variant.

FIG. 29 Fermentations on Verduyn-urea supplemented with xylose (40 g L−1) and glucose (71.8 g L−1) of (A) RN1053 HXT11-N366M, (B) RN1053 HXT11-N366T, (C) RN1001 and (D) RN1053 HXT11-N366N. Symbols: glucose (♦), xylose (▪), ethanol (▴), cell density (●). (A), (B), (C) and (D) are the panels of FIG. 29.

BRIEF DESCRIPTION OF THE SEQUENCE LISTING

SEQ ID NO: 1: primer 5034-kanf

SEQ ID NO: 2: primer 5035-kanr

SEQ ID NO: 3: primer 5116-If2

SEQ ID NO: 4: primer 5118-Ir2

SEQ ID NO: 5: primer 5115-If1

SEQ ID NO: 6: primer 5117-Ir1

SEQ ID NO: 7: pRN201; TOPO-BLUNT-loxP-kanMX-loxP

SEQ ID NO: 8: pRN251; TOPO-BLUNT-loxP-hphMX-loxP

SEQ ID NO: 9. pRN365; TOPO-BLUNT-loxP-natMX-loxP

SEQ ID NO: 10: primer 115-natf

SEQ ID NO: 11: primer 116-natr

SEQ ID NO: 12: pRN447; TOPO-BLUNT-loxP-zeoMX-loxP

SEQ ID NO: 13: primer 28-H3f

SEQ ID NO: 14: primer 29-H3r

SEQ ID NO: 15: pRN247 (TOPO-BLUNT-HIS3:loxPkanMXloxP)

SEQ ID NO: 16: primer 201-Hx2uf

SEQ ID NO: 17: primer 202-Hx2ur

SEQ ID NO: 18: primer 203-Hx2df

SEQ ID NO: 19: primer 204-Hx2dr

SEQ ID NO: 20: primer 205-Hx3uf

SEQ ID NO: 21: primer 206-Hx3ur

SEQ ID NO: 22: primer 210-Hx4df

SEQ ID NO: 23: primer 211-Hx4dr

SEQ ID NO: 24: primer 212-Hx5uf

SEQ ID NO: 25: primer 213-Hx5ur

SEQ ID NO: 26: primer 229-Hx7df

SEQ ID NO: 27: primer 230-Hx7dr

SEQ ID NO: 28: primer 243-Gal2ufn

SEQ ID NO: 29: primer 244-Gal2urn

SEQ ID NO: 30: primer 233-Ga2df

SEQ ID NO: 31: primer 234-Ga2dr

SEQ ID NO: 32: pRN485; TOPO-BLUNT-GAL2:loxPzeoMXloxP

SEQ ID NO: 33: pRN566; TOPO-BLUNT-HXT367:loxP-hphMX-loxP

SEQ ID NO: 34: pRN569: TOPO-BLUNT-HXT514:loxP-natMX-loxP

SEQ ID NO: 35: pRN635; TOPO-BLUNT-HXT2:loxP-kanMX-loxP

SEQ ID NO: 36: primer 281-Hx3inr2

SEQ ID NO: 37: primer 323-Hx7inr1

SEQ ID NO: 38: primer Hx4inr2

SEQ ID NO: 39: primer Hx5inf

SEQ ID NO: 40: primer 324-Ga2inf1

SEQ ID NO: 41: primer 325-Ga2inr1

SEQ ID NO 42: primer 289-Hx2inf

SEQ ID NO: 43: primer 290-Hx2inr

SEQ ID NO: 44: primer 838-Glk1-psuc227f

SEQ ID NO: 45: primer 834-Hxk2-psuc227f

SEQ ID NO: 46: primer 645-pSUC227r

SEQ ID NO: 47: primer 839-Glk1-psuc225r

SEQ ID NO: 48: primer 835-Hxk2-psuc225r

SEQ ID NO: 49: primer 646-pSUC225f

SEQ ID NO: 50: primer 846-Hxk1_loxP_f

SEQ ID NO: 51: primer 847-Hxk1_loxP_r

SEQ ID NO: 52: primer 848-Gal1_loxP_f

SEQ ID NO: 53: primer 849-Gal1_loxP_r

SEQ ID NO: 54: pRN774; TOPO-BLUNT-loxP-hphMX-loxP (loxP sites in opposite orientation)

SEQ ID NO: 55: pRN775; TOPO-BLUNT-loxP-natMX-loxP (loxP sites in opposite orientation)

SEQ ID NO: 56: WT-GAL2 DNA sequence

SEQ ID NO: 57 pRN993; XbaI site (TCTAGA) and BssHII site (GCGCGC).

SEQ ID NO: 58: pDB1250; WT-GAL2 expression vector for screening; XbaI site (TCTAGA) and BssHII site (GCGCGC).

SEQ ID NO: 59: WT Gal2p amino acid sequence

SEQ ID NO: 60: pRN187 (pSH65-derived CRE recombinase expression vector)

SEQ ID NO: 61: pRN486 (TOPO-BLUNT-his3::loxP-natMX-loxP)

SEQ ID NO: 62: Primer ActinF (Real time PCR)

SEQ ID NO: 63: Primer ActinR (Real time PCR)

SEQ ID NO: 64: Primer HXT1F (Real time PCR)

SEQ ID NO: 65: Primer HXT1R (Real time PCR)

SEQ ID NO: 66: Primer HXT2F (Real time PCR)

SEQ ID NO: 67: Primer HXT2R (Real time PCR)

SEQ ID NO: 68: Primer HXT3F (Real time PCR)

SEQ ID NO: 69: Primer HXT3R (Real time PCR)

SEQ ID NO: 70: Primer HXT4F (Real time PCR)

SEQ ID NO: 71: Primer HXT4R (Real time PCR)

SEQ ID NO: 72: Primer HXT5F (Real time PCR)

SEQ ID NO: 73: Primer HXT5R (Real time PCR)

SEQ ID NO: 74: Primer HXT7F (Real time PCR)

SEQ ID NO: 75: Primer HXT7R (Real time PCR)

SEQ ID NO: 76: Primer HXT8F ((Real time PCR)

SEQ ID NO: 77: Primer HXT8R (Real time PCR)

SEQ ID NO: 78: Primer HXT9F (Real time PCR)

SEQ ID NO: 79: Primer HXT9R (Real time PCR)

SEQ ID NO: 80: Primer HXT10F (Real time PCR)

SEQ ID NO: 81: Primer HXT10R (Real time PCR)

SEQ ID NO: 82: Primer HXT11F (Real time PCR)

SEQ ID NO: 83: Primer HXT11R (Real time PCR)

SEQ ID NO: 84: Primer HXT12F (Real time PCR)

SEQ ID NO: 85: Primer HXT12R (Real time PCR)

SEQ ID NO: 86: Primer HXT13F (Real time PCR)

SEQ ID NO: 87: Primer HXT13R (Real time PCR)

SEQ ID NO: 88: Primer HXT14F (Real time PCR)

SEQ ID NO: 89: Primer HXT14R (Real time PCR)

SEQ ID NO: 90: Primer HXT15F (Real time PCR)

SEQ ID NO: 91: Primer HXT15R (Real time PCR)

SEQ ID NO: 92: Primer HXT16F (Real time PCR)

SEQ ID NO: 93: Primer HXT16R (Real time PCR)

SEQ ID NO: 94: Primer HXT17F (Real time PCR)

SEQ ID NO: 95: Primer HXT17R (Real time PCR)

SEQ ID NO: 96: Primer GAL2F (Real time PCR)

SEQ ID NO: 97: Primer GAL2R (Real time PCR)

SEQ ID NO: 98: Primer KOP11* for KO HXT11

SEQ ID NO: 99: Primer KOT11* for KO HXT11

SEQ ID NO: 100: Primer iHXT11F (Inverse HXT11)

SEQ ID NO: 101: Primer iHXT11R (Inverse HXT11)

SEQ ID NO: 102: Primer HXT11F (Cloning)

SEQ ID NO: 103: Primer HXT12F (Cloning)

SEQ ID NO: 104: Primer HXT11/12R (Cloning)

SEQ ID NO: 105: Primer HXT1 XbaI (Cloning)

SEQ ID NO: 106: Primer R HXT1 Cfr9i (Cloning)

SEQ ID NO: 107: Primer F HXT2 XbaI (Cloning)

SEQ ID NO: 108: Primer R HXT2 Cfr9i (Cloning)

SEQ ID NO: 109: Primer F HXT3 XbaI (Cloning)

SEQ ID NO: 110: Primer R HXT6 Cfr9i (Cloning)

SEQ ID NO: 111: Primer F HXT4 XbaI (Cloning)

SEQ ID NO: 112: Primer R HXT4RN Cfr9I (Cloning)

SEQ ID NO: 113: Primer F HXT5 XbaI (Cloning)

SEQ ID NO: 114: Primer R HXT5 Cfr9i (Cloning)

SEQ ID NO: 115: Primer F HXT7 XbaI (Cloning)

SEQ ID NO: 116: Primer R HXT7 Cfr9I (Cloning)

SEQ ID NO: 117: Plasmid pRS313-P7T7

SEQ ID NO: 118: Plasmid pRS313-P7t7-HXT11+GFP

SEQ ID NO: 119: DNA sequence of HXT11 ORF Saccharomyces cerevisiae

SEQ ID NO: 120: DNA sequence of HXT2 ORF Saccharomyces cerevisiae

SEQ ID NO: 121: DNA sequence of GAL2 ORF Saccharomyces cerevisiae

SEQ ID NO: 122: DNA sequence of HXT3-6 ORF Saccharomyces cerevisiae

SEQ ID NO: 123: Hxt11p amino acid sequence Saccharomyces cerevisiae

SEQ ID NO: 124: Hxt2p amino acid sequence Saccharomyces cerevisiae

SEQ ID NO: 125: Gal2p amino acid sequence Saccharomyces cerevisiae

SEQ ID NO: 126: Hxt3-6 amino acid sequence Saccharomyces cerevisiae

SEQ ID NO: 127: F HXT36 Bcui

SEQ ID NO: 128: R HXT36 367NNN

SEQ ID NO: 129: F HXT36 367NNN

SEQ ID NO: 130: R HXT36 BamHi

SEQ ID NO: 131: R HXT36 BamHI-stop

SEQ ID NO: 132: F GFP BamHI

SEQ ID NO: 133: R GFP ClaI

SEQ ID NO: 134: F HXT11 XbaI

SEQ ID NO: 135: R HXT11 BamHI

SEQ ID NO: 136: F HXT11 366NNN

SEQ ID NO: 137: R HXT11 366NNN

SEQ ID NO: 138: F HXT11 N366F

SEQ ID NO: 139: R HXT11 N366F

SEQ ID NO: 140: F HXT11 N366E

SEQ ID NO: 141: R HXT11 N366E

SEQ ID NO: 142: F HXT11 N366K

SEQ ID NO: 143: R HXT11 N366K

SEQ ID NO:144: F HXT11 N366M

SEQ ID NO: 145: R HXT11 N366M

SEQ ID NO: 146: F HXT11 N366W

SEQ ID NO: 147: R HXT11 N366W

SEQ ID NO: 148: F HXT11 N366Y

SEQ ID NO: 149: R HXT11 N366Y

DETAILED DESCRIPTION OF A PREFERRED EMBODIMENT

Throughout the present specification and the accompanying claims, the words “comprise” and “include” and variations such as “comprises”, “comprising”, “includes” and “including” are to be interpreted inclusively. That is, these words are intended to convey the possible inclusion of other elements or integers not specifically recited, where the context allows. The articles “a” and “an” are used herein to refer to one or to more than one (i.e. to one or at least one) of the grammatical object of the article. By way of example, “an element” may mean one element or more than one element.

The invention relates to a method of identifying amino acid positions in permease polypeptides, preferably hexose permease polypeptides, more preferably hexose permease polypeptides from yeast and fungi, even more preferably in Saccharomyces cerevisiae Hxt or Gal2 permease polypeptides, which can be mutated to alter the sugar specificity of the permease.

The invention relates to a polypeptide having one or more substitution at a position corresponding to position 339 or 376 of SEQ ID NO: 59, wherein the polypeptide is a member of the Major Facilitator Superfamily (MFS). In an embodiment, the substitution is at position corresponding to 376 and wherein the amino acid at that position is replaced by an amino acid that has a van der Waals volume of 80 to 138 Å3 and a side chain hydrophobicity of 10 to 100 ΔtR (T, C, V, M, L, I, F)

In an embodiment, the substitution is at position corresponding to 376 and wherein the amino acid at that position is replaced by an amino acid that has a van der Waals volume of 80 to 138 Å3 and a side chain hydrophobicity of 40 to 100 ΔtR. (C, V, M, L, I, F).

In an embodiment, the substitution is at position corresponding to 376 and wherein the amino acid at that position is replaced by an amino acid that has a van der Waals volume of 90 to 138 Å3 and a side chain hydrophobicity of 10 to 100 ΔtR (T, V, M, L, I, F)

In an embodiment, the substitution is at position corresponding to 376 and wherein the amino acid at that position is replaced by an amino acid that has a van der Waals volume of 100 to 138 Å3 and a side chain hydrophobicity of 60 to 100 ΔtR (V, M, L, I, F).

In an embodiment, the substitution is at position corresponding to 376 and wherein the amino acid at that position is replaced by an amino acid that has a van der Waals volume of 100 to 130 Å3 and a side chain hydrophobicity of 60 to 100 ΔtR (V, M, L, I).

In an embodiment, the substitution is at position corresponding to 376 and wherein the amino acid at that position is replaced by an amino acid that has a van der Waals volume of 120 to 130 Å3 and a side chain hydrophobicity of 60 to 100 ΔtR (M, L, I).

In an embodiment, the substitution is at position corresponding to 376 and wherein the amino acid at that position is replaced by an amino acid that has a van der Waals volume of 120 to 130 Å3 and a side chain hydrophobicity of 80 to 100 ΔtR (L, I).

In an embodiment, the substitution is at position corresponding to 376 and wherein the amino acid at that position is replaced by an amino acid that has a van der Waals volume of 100 to 130 Å3 and a side chain hydrophobicity of 60 to 80 ΔtR (V, M).

In an embodiment, the substitution is at position corresponding to 376 and wherein the amino acid at that position is replaced by an amino acid that has a van der Waals volume of 100 to 130 Å3 and a side chain hydrophobicity of 60 to 98 ΔtR (V, M, L).

In an embodiment, the substitution is N376T, N376C, N376V, N376M, N376L, N376I, or N376F.

In an embodiment polypeptide has a substitution is at position corresponding to 339 and wherein the amino acid at that position is replaced by an amino acid that has a side chain hydrophobicity of −30 to 10 ΔtR (G, S, N, Q, H, K, R).

In an embodiment polypeptide has a substitution is at position corresponding to 339 and wherein the amino acid at that position is replaced by an amino acid that has a side chain hydrophobicity of −30 to 10 ΔtR and a van der Waals volume of 60 to 160 Å3. (S, N, Q, H, K, R).

In an embodiment polypeptide has a substitution is at position corresponding to 339 and wherein the amino acid at that position is replaced by an amino acid that has a side chain hydrophobicity of −30 to 10 ΔtR and a van der Waals volume of 80 to 160 Å3. (N, Q, H, K, R).

In an embodiment polypeptide has a substitution is at position corresponding to 339 and wherein the amino acid at that position is replaced by an amino acid that has a side chain hydrophobicity of −30 to 10 ΔtR and a van der Waals volume of 100 to 160 Å3. (Q, H, K, R).

In an embodiment polypeptide has a substitution is at position corresponding to 339 and wherein the amino acid at that position is replaced by an amino acid that has a side chain hydrophobicity of −30 to 0 ΔtR and a van der Waals volume of 100 to 160 Å3. (Q, K, R).

In an embodiment polypeptide has a substitution is at position corresponding to 339 and wherein the amino acid at that position is replaced by an amino acid that has a side chain hydrophobicity of −30 to 0 ΔtR and a van der Waals volume of 120 to 160 Å3. (K, R).

In an embodiment polypeptide has a substitution is at position corresponding to 339 and wherein the amino acid at that position is replaced by an amino acid that has a side chain hydrophobicity of −30 to 10 ΔtR and a van der Waals volume of 80 to 120 Å3. (N, Q, H).

In an embodiment polypeptide has a substitution is at position corresponding to 339 and wherein the amino acid at that position is replaced by an amino acid that has a side chain hydrophobicity of −30 to 10 ΔtR and a van der Waals volume of 80 to 120 Å3. (N, Q).

In an embodiment, the substitution is M339G, M339S, M339N, M339Q, M339H, M339K, M339R, or M339V.

In an embodiment the polypeptide has one or more amino acid corresponding to 339N/V and/or 376I/M/V.

The permeases belong to the Major Facilitator Superfamily (MFS). This is defined hereinbelow. Cellular transport systems allow the uptake of essential nutrients and ions, and excretion of products of metabolism and deleterious substances. In addition, transport systems play a role in the communication between cells and the environment. Also, they are an essential part of the cell system to yield or consume energy-supplying molecules, such as ATP.

The transport of solutes by primary active transporters is energy-driven in the first place, such as by energy supplied from ATP hydrolysis, photon absorption, electron flow, substrate decarboxylation, or methyl transfer. If charged molecules are pumped in one direction as a consequence of the consumption of a primary cellular energy source, an electrochemical potential is the result. The resulting chemiosmotic gradient can then be used to drive the transport of additional molecules via secondary carrier structures which just facilitate the transport of one or more molecules across the membrane.

The last two decades the existence of a multitude of previously unknown protein families of primary and secondary transporters has been clarified by the emergence of genomics strategies and making use of the many performed biochemical and molecular genetics studies. The two main transporter families of which proteins were found throughout all living organism are of the ATP-binding cassette (ABC) superfamily and the major facilitator superfamily (MFS), also known as the uniporter-symporter-antiporter family. Whereas ABC family permeases consist of multiple components and are primary active transporters, capable of transporting both small molecules and macromolecules only after generating energy through ATP hydrolysis, the MFS transporters consist of a single polypeptide of a secondary carrier which facilitates transport of small solutes in response to a chemiosmotic ion gradient. ABC superfamily and MFS proteins account for almost half of the solute transporters encoded within the microbe genomes (reviewed by Pao et al, 1998, Microbiol Mol Biol Rev.; 62 pp. 1-34, and Saier et al, 1999, J Mol Microbiol Biotechnol, 1 pp. 257-279).

Suitable permease polypeptide sequences can contain one or more of the following motifs:


a) 
G-R-x(3)-G-x(3)-G-x(11)-E-x(5)-[LIVM]-R-G-x(12)-
[GA];
b) 
R-x(14)-G-x(2)-Y-x(2)-[YF]-[YF]-[GSAL];.
c) 
V-x(15)-[GNR]-[RH]-R-x(2)-[LM]-x(2)-[GA]

Motif (a) is corresponds to residues 179-221 in Gal2; motif (b) is corresponds to residues 330-353 in Gal2; motif (c) is corresponds to residues 375-399 in Gal2.

In an embodiment the polypeptide comprises a motif G-R-x(3)-G-x(3)-G-x(11)-E-x(5)-[LIVM]-R-G-x(12)-[GA].

The claimed method comprises modeling a permease polypeptide sequence onto the published crystal structure of the xylose- or glucose-bound Escherichia coli xylose permease XylE (respectively, PDB code 4GBY & 4GBZ in the PDB database, www.pdb.org) to identify the amino acid positions in the channel of the permease that directly interact with the bound sugar (called the first-shell residues in the art), and the residues that interact with the first shell residues (called the second shell residues in the art). Suitable modeling software to construct such models are YASARA, Prime (Schrodinger Inc.) or MODELLER using the default settings. Alternatively, the sugar-specificity-altering first and second shell amino acid positions in a permease polypeptide sequence can be identified by a global pairwise alignment of the permease sequence with the Gal2 sequence SEQ ID NO: 59 using the NEEDLE protocol described below. An example alignment for Gal2 and Hxt's from Saccharomyces cerevisiae is given in FIG. 10, which shows how alignment can be used to identify the corresponding amino acid positions in the different yeast Hxt's. The amino acid positions herein thus refer to SEQ ID NO: 59 that describes Gal2 or to corresponding amino acid positions in other polypeptides, in particular other permease polypeptides. For example, the corresponding position of the position N376 in Gal2 (SEQ ID NO; 59) in Hxt1 is N370, in Hxt2 N361, in Hxt3 N367, in Hxt4SC N376, in Hxt4RN N376, in Hxt5 N391, in Hxt6/7 N370, in Hxt8 N372, in Hxt9 N366, in Hxt10 N354, in Hxt11 N366, in Hxt12 N256, in Hxt13 N363, in Hxt14 N387, in Hxt15 N366, in Hxt16 N366 and in Hxt17 N363. Similarly, the corresponding position of N346 in Gal2 (SEQ ID NO:9) in Hxt1 is D340, in Hxt2 N331, in Hxt3 D337, in Hxt4SC D346, in Hxt4RN D346, in Hxt5 D361, in Hxt6/7 D340, in Hxt8 D342, in Hxt9 D336, in Hxt10 C324, in Hxt11 D336, in Hxt12 D226, in Hxt13 E333, in Hxt14 I357, in Hxt15 E336, in Hxt16 E336 and in Hxt17 E333. This can be similary done for other MFS Superfamily transporters, so that corresponding positions in these polypeptides corresponding to the positions in SEQ ID NO: 59 can be obtained. This is supported by the data of examples 6-20.

A person skilled in the art can subsequently mutate the identified amino acid positions in the permease polypeptide to all other 19 amino acids, and screen for improved C5 sugar uptake and/or reduced C6 sugar uptake of the mutant permease, as described in Example 4 and 5.

For instance, for a polypeptide having a mutation at a position corresponding to one or more position corresponding to N376 of SEQ ID NO: 59, the mutations at the positions corresponding to N376 may be a substitution with C, P, G, A, V, L, 1, M, F, W, Y, H, S, T, N, Q, D, E, K, R or a deletion. X may be any amino acid, X(2) means two X.

Herein, Gal2 is a facilitated diffusion transporter required for both the high-affinity galactokinase-dependent and low-affinity galactokinase-independent galactose transport processes. It belongs to the major facilitator superfamily, sugar transporter (TC 2.A.1.1) family. “Permease polypeptide”, is also designated herein as “polypeptide permease” or “polypeptide”. “Permease polypeptide polynucleotide”, is herein a polynucleotide that encodes the permease polypeptide.

In an embodiment of the invention, the permease polypeptide has at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with SEQ ID NO: 59.

Herein mutations are indicated by one letter amino acids and positions of these amino acids. For example, A6 herein indicates an amino acid (one letter code) at a certain position in SEQ ID NO: 59, here A (Alanine) at position 6 of the protein. A6 (L/N/Q/G/V/I/Y/S/E/K) indicates herein mutation of amino acid at a certain position, here A (Alanine) at position 6 of the protein is exchanged for any of L (Leucine), N (Asparagine), Q (Glutamine), G (Glycine), V (Valine), I (Isoleucine), Y (Tyrosine), S (Serine), E (Glutamic acid) or K (Lysine).

In an embodiment, the polypeptide has xylose transport activity.

In an embodiment the polypeptide has reduced glucose affinity compared to the polypeptide of SEQ ID NO: 59.

The permease polypeptide of the invention may have one or more alternative and/or additional activities other than that of sugar permease activity.

As set out above, a permease polypeptide of the invention will typically have sugar permease activity. However, a permease polypeptide of the invention may have one or more of the activities set out above in addition to or alternative to that activity.

Polynucleotide Sequence

With the permease polypeptide and its amino acid sequence as disclosed herein, the skilled person may determine suitable polynucleotides that encode the permease polypeptide.

In an embodiment the polynucleotide is a variant polynucleotide having at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with SEQ ID NO: 56, and encodes the polypeptide as described in claims 1 to 11.

The invention therefore provides polynucleotide sequences comprising the gene encoding the permease polypeptide, as well as its coding sequence.

The polynucleotides of the invention may be isolated or synthesized. The permease polypeptides and permease polypeptide polynucleotides herein may be synthetic polypeptides, respectively polynucleotides. The synthetic polynucleotides may be optimized in codon use, preferably according to the methods described in WO2006/077258 and/or PCT/EP2007/055943, which are herein incorporated by reference. PCT/EP2007/055943 addresses codon-pair optimization.

The term refers to a polynucleotide molecule, which is a ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) molecule, either single stranded or double stranded. A polynucleotide may either be present in isolated form, or be comprised in recombinant nucleic acid molecules or vectors, or be comprised in a host cell.

The word “polypeptide” is used herein for chains containing more than seven amino acid residues. All oligopeptide and polypeptide formulas or sequences herein are written from left to right and in the direction from amino terminus to carboxy terminus. The one-letter code of amino acids used herein is commonly known in the art.

By “isolated” polypeptide or protein is intended a polypeptide or protein removed from its native environment. For example, recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for the purpose of the invention as are native or recombinant polypeptides which have been substantially purified by any suitable technique such as, for example, the single-step purification method disclosed in Smith and Johnson, Gene 67:31-40 (1988).

The polynucleotides of the present invention, such as a polynucleotide encoding the permease polypeptide can be isolated or synthesized using standard molecular biology techniques and the sequence information provided herein.

The polynucleotide encoding the permease polypeptide of the invention can be amplified using cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.

Transformation

The polynucleotides according to the invention may be expressed in a suitable host. The invention thus relates to a transformed host cell. In an embodiment, the host cell may be transformed with a nucleic acid construct that comprises a polynucleotide that encodes the polypeptide according to the invention defined before. Therefore standard transformation techniques may be used.

In an embodiment the transformed host cell comprises a heterologous nucleotide that encodes a polypeptide according to claim 1 or encodes a polypeptide having substitution F85QN, T89V, V187A/F, I218S, T219A, Q341S/A, N346V, T380A, F444L/V, T448A, T449F, T451G or W455M of sequence ID NO: 59, and in an embodiment thereof the host cell is Saccharomyces cerevisiae.

In an embodiment the transformed host is transformed with a polynucleotide that encodes a polypeptide that is a mutant of a polypeptide that is native in the untransformed host cell.

In an embodiment the polypeptide that is native in the untransformed host cel is a member of the Major Facilitator Superfamily (MFS) transporters, in an embodiment a hexose transporter polypeptide.

In an embodiment he polypeptide that is native in the untransformed host cell is a transporter polypeptide chosen from the list consisting of Gal2, Hxt1, Hxt2, Hxt3, Hxt4, Hxt5, Hxt6, Hxt7, Hxt8, Hxt9, Hxt10, Hxt11, Hxt12, Hxt13, Hxt14, Hxt15, Hxt16 and Hxt17.

In an embodiment, in the polypeptide of the invention has not the amino acid residue X (X may be any amino acid) at a given position A (A maybe any specific position in the polypeptide in SEQ ID NO:59, where X is a mutation in SEQ ID NO: 59, when X is native at the to A corresponding position in a second MFS family polypeptide.

In an embodiment, the polypeptide has not the amino acid residue S, that corresponds to M339S in SEQ ID NO:59, in the corresponding position in HXT1 (i.e. not 333S in HXT1), in HXT2 (i.e. not 324S in HXT2), in HXT3 (i.e. not 330S in HXT3), in HXT4 (i.e. not 339S in HXT4), in HXT5 (i.e not 354S in HXT5), in HXT6 or in HXT7 (i.e. not 333S in HXT6 or HXT7), in HXT8 (i.e. not 335S in HXT8), in HXT9 (i.e. not 329S in HXT9), in HXT10 (i.e. not 317S in HXT10) or in HXT11 (i.e. not 329S in HXT11).

In an embodiment, the polypeptide is a mutant HXT3-6 and has one or more substitutions in HXT3-6, In an embodiment thereof, the polypeptide has substitutions corresponding to N367A/C/D/F/G/I/L/M/S/T/V of SEQ ID NO: 126. In an embodiment, the polypeptide has substitutions corresponding to N367A/I of SEQ ID NO: 126. In an embodiment, the polypeptide has substitutions corresponding to N367A of SEQ ID NO: 126.

In an embodiment, the polypeptide is a mutant HXT11 and has one or more substitiutions in HXT11, In an embodiment thereof, the polypeptide has substitutions corresponding to N366A/C/D/F/G/I/L/M/S/T/V of SEQ ID NO: 123. In an embodiment the polypeptide is a mutant HXT11. In an embodiment the polypeptide has substitutions corresponding to N366/F/I/L/M/T/V of SEQ ID NO: 123. In an embodiment, the polypeptide has substitutions corresponding to N366D/M/T of SEQ ID NO: 123. In an embodiment, the polypeptide has substitutions corresponding to N366M/T of SEQ ID NO: 123. In an embodiment the polypeptide has substitutions corresponding to N366M/T or N366T of SEQ ID NO: 123.

Co-Consumption

In an embodiment the transformed host is capable of co-consumption of glucose and at least one pentose. This pentose may be arabinose or xylose, in an embodiment it is xylose. Co-consumption (or co-fermentation) of two substrates is defined herein as a simultaneous uptake and intracellular conversion of two different carbon sources (e.g. xylose and glucose), at an appreciable level. Said carbon sources are simultaneously converted into products, such as e.g. biomass, ethanol, glycerol, and the like.

Co-consumption of a cell is herein quantified and expressed as co-consumption index. The co-consumption index is herein the co-consumption index for glucose and xylose and is calculated as the sum over the time interval of 0-24 hours (measured at 0, 8, 12, 14, 16, 18, 20, 22 and 24 hours) of the absolute difference of the glucose uptake rate (Qg) and the xylose uptake rate (Qx), expressed as grams of sugar consumed per time unit, in an anaerobic batch culture fermentation at 1.0 g/l dry yeast pitch, 30 degrees C. temperature and wherein the fermentation medium contains 71.8 grams of glucose per liter and 40.0 grams xylose per liter, at the start of the fermentation. See examples 16-18.

In an embodiment, the co-consumption index of the transformed host cell is 27 g/h or less, 25 g/h or less, 23 g/h or less, 20 g/h or less, 18 g/h or less, 16 g/h or less, 14 g/h or less, or 12 g/h or less,

The invention further relates to a nucleic acid construct comprising the polynucleotide as described before, e.g. a vector.

Another aspect of the invention thus pertains to vectors, including cloning and expression vectors, comprising a polynucleotide of the invention encoding a permease polypeptide protein or a functional equivalent thereof and methods of growing, transforming or transfecting such vectors in a suitable host cell, for example under conditions in which expression of a permease of the invention occurs. As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.

Polynucleotides of the invention can be incorporated into a recombinant replicable vector, for example a cloning or expression vector. The vector may be used to replicate the nucleic acid in a compatible host cell. Thus in a further embodiment, the invention provides a method of making polynucleotides of the invention by introducing a polynucleotide of the invention into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector. The vector may be recovered from the host cell. Suitable host cells are described below.

It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The vectors, such as expression vectors, of the invention can be introduced into host cells to thereby produce proteins or peptides, encoded by nucleic acids as described herein. The vectors, such as recombinant expression vectors, of the invention can be designed for expression of permease polypeptide proteins in prokaryotic or eukaryotic cells.

For example, permease polypeptides can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors), filamentous fungi, yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Representative examples of appropriate hosts are described hereafter.

Appropriate culture mediums and conditions for the above-described host cells are known in the art.

For most filamentous fungi and yeast, the vector or expression construct is preferably integrated in the genome of the host cell in order to obtain stable transformants. However, for certain yeasts also suitable episomal vectors are available into which the expression construct can be incorporated for stable and high level expression, examples thereof include vectors derived from the 2μ and pKD1 plasmids of Saccharomyces and Kluyveromyces, respectively, or vectors containing an AMA sequence (e.g. AMA1 from Aspergillus). In case the expression constructs are integrated in the host cells genome, the constructs are either integrated at random loci in the genome, or at predetermined target loci using homologous recombination, in which case the target loci preferably comprise a highly expressed gene.

Accordingly, expression vectors useful in the present invention include chromosomal-, episomal- and virus-derived vectors e.g., vectors derived from bacterial plasmids, bacteriophage, yeast episome, yeast chromosomal elements, viruses such as baculoviruses, papova viruses, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids.

When the polypeptide according to the invention is to be secreted from the host cell into the cultivation medium, an appropriate signal sequence can be added to the polypeptide in order to direct the de novo synthesized polypeptide to the secretion route of the host cell. The person skilled in the art knows to select an appropriate signal sequence for a specific host.

The vector may further include sequences flanking the polynucleotide giving rise to RNA which comprise sequences homologous to eukaryotic genomic sequences or viral genomic sequences. This will allow the introduction of the polynucleotides of the invention into the genome of a host cell.

An integrative cloning vector may integrate at random or at a predetermined target locus in the chromosome(s) of the host cell into which it is to be integrated.

The vector system may be a single vector, such as a single plasmid, or two or more vectors, such as two or more plasmids, which together contain the total DNA to be introduced into the genome of the host cell.

The vector may contain a polynucleotide of the invention oriented in an antisense direction to provide for the production of antisense RNA.

Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms “transformation” and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, transduction, infection, lipofection, cationic lipidmediated transfection or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual, 2nd, ed. Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), Davis et al., Basic Methods in Molecular Biology (1986) and other laboratory manuals.

As indicated before, the invention provides an isolated polypeptide having the amino acid sequence according to SEQ ID NO: 59 with the mutations indicated in claim 1.

The permease polypeptide according to the invention can be recovered and purified from recombinant cell cultures by methods known in the art. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification.

Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.

The invention also features biologically active fragments of the polypeptides according to the invention.

Provided also are host cells, comprising a polynucleotide or vector of the invention. The polynucleotide may be heterologous to the genome of the host cell. The term “heterologous”, usually with respect to the host cell, means that the polynucleotide does not naturally occur in the genome of the host cell or that the polypeptide is not naturally produced by that cell.

In another embodiment, the invention features cells, e.g., transformed host cells or recombinant host cells that contain a nucleic acid encompassed by the invention. A “transformed cell” or “recombinant cell” is a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a nucleic acid according to the invention. Both prokaryotic and eukaryotic cells are included, e.g., bacteria, fungi, yeast, and the like, especially preferred are yeast cells including e.g. Saccharomyces, for example Saccharomyces cerevisiae.

A host cell can be chosen that modulates the expression of the inserted sequences, or modifies and processes the gene product in a specific, desired fashion. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may facilitate optimal functioning of the protein.

Various host cells have characteristic and specific mechanisms for post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems familiar to those of skill in the art of molecular biology and/or microbiology can be chosen to ensure the desired and correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells that possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product can be used. Such host cells are well known in the art.

If desired, a cell as described above may be used to in the preparation of a polypeptide according to the invention. Such a method typically comprises cultivating a host cell (e. g. transformed or transfected with an expression vector as described above) under conditions to provide for expression (by the vector) of a coding sequence encoding the polypeptide, and optionally recovering the expressed polypeptide. Polynucleotides of the invention can be incorporated into a recombinant replicable vector, e. g. an expression vector. The vector may be used to replicate the nucleic acid in a compatible host cell. Thus in a further embodiment, the invention provides a method of making a polynucleotide of the invention by introducing a polynucleotide of the invention into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about the replication of the vector. The vector may be recovered from the host cell.

The vectors may be transformed or transfected into a suitable host cell as described above to provide for expression of a polypeptide of the invention. This process may comprise culturing a host cell transformed with an expression vector as described above under conditions to provide for expression by the vector of a coding sequence encoding the polypeptide.

Herein standard isolation, hybridization, transformation and cloning techniques are used (e. g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual.2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989).

Homology & Identity

Amino acid or nucleotide sequences are said to be homologous when exhibiting a certain level of similarity. Two sequences being homologous indicate a common evolutionary origin. Whether two homologous sequences are closely related or more distantly related is indicated by “percent identity” or “percent similarity”, which is high or low respectively. Although disputed, to indicate “percent identity” or “percent similarity”, “level of homology” or “percent homology” are frequently used interchangeably.

A comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. The skilled person will be aware of the fact that several different computer programs are available to align two sequences and determine the homology between two sequences (Kruskal, J. B. (1983) An overview of sequence comparison In D. Sankoff and J. B. Kruskal, (ed.), Time warps, string edits and macromolecules: the theory and practice of sequence comparison, pp. 1-44 Addison Wesley). The percent identity between two amino acid sequences can be determined using the Needleman and Wunsch algorithm for the alignment of two sequences. (Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48, 443-453). The algorithm aligns amino acid sequences as well as nucleotide sequences. The Needleman-Wunsch algorithm has been implemented in the computer program NEEDLE. For the purpose of this invention the NEEDLE program from the EMBOSS package was used (version 2.8.0 or higher, EMBOSS: The European Molecular Biology Open Software Suite (2000) Rice, P. Longden, I. and Bleasby,A. Trends in Genetics 16, (6) pp276-277, emboss.bioinformatics.nl). For protein sequences, EBLOSUM62 is used for the substitution matrix. For nucleotide sequences, EDNAFULL is used. Other matrices can be specified. The optional parameters used for alignment of amino acid sequences are a gap-open penalty of 10 and a gap extension penalty of 0.5. The skilled person will appreciate that all these different parameters will yield slightly different results but that the overall percentage identity of two sequences is not significantly altered when using different algorithms.

Global Homology Definition

The homology or identity is the percentage of identical matches between the two full sequences over the total aligned region including any gaps or extensions. The homology or identity between the two aligned sequences is calculated as follows: Number of corresponding positions in the alignment showing an identical amino acid in both sequences divided by the total length of the alignment including the gaps. The identity defined as herein can be obtained from NEEDLE and is labelled in the output of the program as “IDENTITY”.

Longest Identity Definition

The homology or identity between the two aligned sequences is calculated as follows: Number of corresponding positions in the alignment showing an identical amino acid in both sequences divided by the total length of the alignment after subtraction of the total number of gaps in the alignment. The identity defined as herein can be obtained from NEEDLE by using the NOBRIEF option and is labelled in the output of the program as “longest-identity”.

The various embodiments of the invention described herein may be cross-combined.

The Sugar Composition

The sugar composition according to the invention comprises glucose, arabinose and xylose. Any sugar composition may be used in the invention that suffices those criteria. Optional sugars in the sugar composition are galactose and mannose. In a preferred embodiment, the sugar composition is a hydrolysate of one or more lignocellulosic material. Lignocelllulose herein includes hemicellulose and hemicellulose parts of biomass. Also lignocellulose includes lignocellulosic fractions of biomass. Suitable lignocellulosic materials may be found in the following list: orchard primings, chaparral, mill waste, urban wood waste, municipal waste, logging waste, forest thinnings, short-rotation woody crops, industrial waste, wheat straw, oat straw, rice straw, barley straw, rye straw, flax straw, soy hulls, rice hulls, rice straw, corn gluten feed, oat hulls, sugar cane, corn stover, corn stalks, corn cobs, corn husks, switch grass, miscanthus, sweet sorghum, canola stems, soybean stems, prairie grass, gamagrass, foxtail; sugar beet pulp, citrus fruit pulp, seed hulls, cellulosic animal wastes, lawn clippings, cotton, seaweed, trees, softwood, hardwood, poplar, pine, shrubs, grasses, wheat, wheat straw, sugar cane bagasse, corn, corn husks, corn hobs, corn kernel, fiber from kernels, products and by-products from wet or dry milling of grains, municipal solid waste, waste paper, yard waste, herbaceous material, agricultural residues, forestry residues, municipal solid waste, waste paper, pulp, paper mill residues, branches, bushes, canes, corn, corn husks, an energy crop, forest, a fruit, a flower, a grain, a grass, a herbaceous crop, a leaf, bark, a needle, a log, a root, a sapling, a shrub, switch grass, a tree, a vegetable, fruit peel, a vine, sugar beet pulp, wheat midlings, oat hulls, hard or soft wood, organic waste material generated from an agricultural process, forestry wood waste, or a combination of any two or more thereof.

An overview of some suitable sugar compositions derived from lignocellulose and the sugar composition of their hydrolysates is given in table 1. The listed lignocelluloses include: corn cobs, corn fiber, rice hulls, melon shells, sugar beet pulp, wheat straw, sugar cane bagasse, wood, grass and olive pressings.


TABLE 1
Overview of sugar compositions from lignocellulosic materials.
Lignocellulosic
%.
material
Gal
Xyl
Ara
Man
Glu
Rham
Sum
Gal.
Corn cob a
10
286
36
227
11
570
1.7
Corn cob b
131
228
160
144
663
19.8
Rice hulls a
9
122
24
18
234
10
417
2.2
Rice hulls b
8
120
28
209
12
378
2.2
Melon Shells
6
120
11
208
16
361
1.7
Sugar beet pulp
51
17
209
11
211
24
523
9.8
Wheat straw
15
249
36
396
696
2.2
Idaho
Corn fiber
36
176
113
372
697
5.2
Cane Bagasse
14
180
24
5
391
614
2.3
Corn stover
19
209
29
370
626
Athel (wood)
5
118
7
3
493
625
0.7
Eucalyptus
22
105
8
3
445
583
3.8
(wood)
CWR (grass)
8
165
33
340
546
1.4
JTW (grass)
7
169
28
311
515
1.3
MSW
4
24
5
20
440
493
0.9
Reed Canary
16
117
30
6
209
1
379
4.2
Grass Veg
Reed Canary
13
163
28
6
265
1
476
2.7
Grass Seed
Olive pressing
15
111
24
8
329
487
3.1
residue
Gal = galactose, Xyl = xylose, Ara = arabinose, Man = mannose, Glu = glucose, Rham = rhamnose.
The percentage galactose (% Gal) and literature source is given.

It is clear from table 1 that in these lignocelluloses a high amount of sugar is presence in de form of glucose, xylose, arabinose and galactose. The conversion of glucose, xylose, arabinose and galactose to fermentation product is thus of great economic importance. Also mannose is present in some lignocellulose materials be it usually in lower amounts than the previously mentioned sugars. Advantageously therefore also mannose is converted by the transformed host cell.

The Transformed Host Cell

In an embodiment, the transformed host cell may comprise one or more copies of xylose isomerase gene and/or one or more copies of xylose reductase and/or xylitol dehydrogenase, and two to ten copies of araA, araB and araD, genes, wherein these genes are integrated into the cell genome.

In one embodiment, the transformed host cell comprises genes, for example the above xylose isomerase gene and/or one or more copies of xylose reductase and/or xylitol dehydrogenase, and two to ten copies of araA, araB and araD, genes, are integrated into the transformed host cell genome.

The number of copies may be determined by the skilled person by any known method. In the examples, a suitable method is described.

IN an embodiment, the transformed host cell is able to ferment glucose, arabinose, xylose and galactose.

In an embodiment, the cell is capable of converting 90% or more glucose, xylose arabinose, galactose and mannose available, into a fermentation product. In an embodiment, cell is capable of converting 91% or more, 92% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more or 100% of all glucose, xylose arabinose, galactose and mannose available, into a fermentation product.

In one embodiment of the invention the transformed host cell is able to ferment one or more additional sugar, preferably C5 and/or C6 sugar e.g. mannose. In an embodiment of the invention the transformed host cell comprises one or more of: a xylA-gene, XYL1 gene and XYL2 gene and/or XKS1-gene, to allow the transformed host cell to ferment xylose; deletion of the aldose reductase (GRE3) gene; overexpression of PPP-genes TAL1, TKL1, RPE1 and RKI1 to allow the increase of the flux through the pentose phosphate pathway in the cell.

In an embodiment, the transformed host cell is an industrial cell, more preferably an industrial yeast. An industrial cell and industrial yeast cell may be defined as follows. The living environments of (yeast) cells in industrial processes are significantly different from that in the laboratory. Industrial yeast cells must be able to perform well under multiple environmental conditions which may vary during the process. Such variations include change in nutrient sources, pH, ethanol concentration, temperature, oxygen concentration, etc., which together have potential impact on the cellular growth and ethanol production of Saccharomyces cerevisiae. Under adverse industrial conditions, the environmental tolerant strains should allow robust growth and production. Industrial yeast strains are generally more robust towards these changes in environmental conditions which may occur in the applications they are used, such as in the baking industry, brewing industry, wine making and the ethanol industry. In one embodiment, the industrial transformed host cell is constructed on the basis of an industrial host cell, wherein the construction is conducted as described hereinafter. Examples of industrial yeast (S. cerevisiae) are Ethanol Red® (Fermentis) Fermiol® (DSM) and Thermosacc® (Lallemand).

In an embodiment the transformed host cell is inhibitor tolerant. Inhibitor tolerance is resistance to inhibiting compounds. The presence and level of inhibitory compounds in lignocellulose may vary widely with variation of feedstock, pretreatment method hydrolysis process. Examples of categories of inhibitors are carboxylic acids, furans and/or phenolic compounds. Examples of carboxylic acids are lactic acid, acetic acid or formic acid. Examples of furans are furfural and hydroxy-methylfurfural. Examples or phenolic compounds are vannilin, syringic acid, ferulic acid and coumaric acid. The typical amounts of inhibitors are for carboxylic acids: several grams per liter, up to 20 grams per liter or more, depending on the feedstock, the pretreatment and the hydrolysis conditions. For furans: several hundreds of milligrams per liter up to several grams per liter, depending on the feedstock, the pretreatment and the hydrolysis conditions.

For phenolics: several tens of milligrams per liter, up to a gram per liter, depending on the feedstock, the pretreatment and the hydrolysis conditions.

The transformed host cells according to the invention may be inhibitor tolerant, i.e. they can withstand common inhibitors at the level that they typically have with common pretreatment and hydrolysis conditions, so that the transformed host cells can find broad application, i.e. it has high applicability for different feedstock, different pretreatment methods and different hydrolysis conditions.

In one embodiment, the industrial transformed host cell is constructed on the basis of an inhibitor tolerant host cell, wherein the construction is conducted as described hereinafter. Inhibitor tolerant host cells may be selected by screening strains for growth on inhibitors containing materials, such as illustrated in Kadar et al, Appl. Biochem. Biotechnol. (2007), Vol. 136-140, 847-858, wherein an inhibitor tolerant S. cerevisiae strain ATCC 26602 was selected.

In an embodiment, the transformed host cell is marker-free. As used herein, the term “marker” refers to a gene encoding a trait or a phenotype which permits the selection of, or the screening for, a host cell containing the marker. Marker-free means that markers are essentially absent in the transformed host cell. Being marker-free is particularly advantageous when antibiotic markers have been used in construction of the transformed host cell and are removed thereafter. Removal of markers may be done using any suitable prior art technique, e.g intramolecular recombination. A suitable method of marker removal is illustrated in the examples.

A transformed host cell may be able to convert plant biomass, celluloses, hemicelluloses, pectins, starch, starch derivatives, for example into fermentable sugars. Accordingly, a transformed host cell may express one or more enzymes such as a cellulase (an endocellulase or an exocellulase), a hemicellulase (an endo- or exo-xylanase or arabinase) necessary for the conversion of cellulose into glucose monomers and hemicellulose into xylose and arabinose monomers, a pectinase able to convert pectins into glucuronic acid and galacturonic acid or an amylase to convert starch into glucose monomers.

The transformed host cell further may comprise those enzymatic activities required for conversion of pyruvate to a desired fermentation product, such as ethanol, butanol, lactic acid, di-terpene, glycosylated di-terpene, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, fumaric acid, malic acid, itaconic acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, a ß-lactam antibiotic or a cephalosporin.

In an embodiment, the transformed host cell is a cell that is naturally capable of alcoholic fermentation, preferably, anaerobic alcoholic fermentation. A transformed host cell preferably has a high tolerance to ethanol, a high tolerance to low pH (i.e. capable of growth at a pH lower than about 5, about 4, about 3, or about 2.5) and towards organic and/or a high tolerance to elevated temperatures.

Any of the above characteristics or activities of a transformed host cell may be naturally present in the cell or may be introduced or modified by genetic modification.

Construction of the Transformed Host Cell

According to an embodiment, the genes may be introduced in the host cell by introduction into a host cell:

  • a) a cluster consisting of the genes araA, araB and araD under control of a strong constitutive promoter
  • b) a cluster consisting of PPP-genes TAL1, TKL1, RPE1 and RKI1, optionally under control of strong constitutive promoter; and deletion of an aldose reductase gene;
  • c) a cluster consisting of a xylA-gene and a XKS1-gene under control of strong constitutive promoter;
  • d) a construct comprising a xylA gene under control of a strong constitutive promoter, which has the ability to integrate into the genome on multiple loci;

    and adaptive evolution to produce the transformed host cell. The above cell may be constructed using recombinant expression techniques.

Recombinant Expression

The transformed host cell is a recombinant cell. That is to say, a transformed host cell comprises, or is transformed with or is genetically modified with a nucleotide sequence that does not naturally occur in the cell in question.

Techniques for the recombinant expression of enzymes in a cell, as well as for the additional genetic modifications of a transformed host cell are well known to those skilled in the art. Typically such techniques involve transformation of a cell with nucleic acid construct comprising the relevant sequence. Such methods are, for example, known from standard handbooks, such as Sambrook and Russel (2001) “Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, or F. Ausubel et al., eds., “Current protocols in molecular biology”, Green Publishing and Wiley Interscience, New York (1987). Methods for transformation and genetic modification of host cells are known from e.g. EP-A-0635 574, WO 98/46772, WO 99/60102, WO 00/37671, WO90/14423, EP-A-0481008, EP-A-0635574 and U.S. Pat. No. 6,265,186.

Typically, the nucleic acid construct may be a plasmid, for instance a low copy plasmid or a high copy plasmid. The cell according to the present invention may comprise a single or multiple copies of the nucleotide sequence encoding a enzyme, for instance by multiple copies of a nucleotide construct or by use of construct which has multiple copies of the enzyme sequence.

The nucleic acid construct may be maintained episomally and thus comprise a sequence for autonomous replication, such as an autosomal replication sequence sequence. A suitable episomal nucleic acid construct may e.g. be based on the yeast 2μ or pKD1 plasmids (Gleer et al., 1991, Biotechnology 9: 968-975), or the AMA plasmids (Fierro et al., 1995, Curr Genet. 29:482-489). Alternatively, each nucleic acid construct may be integrated in one or more copies into the genome of the cell. Integration into the cell's genome may occur at random by non-homologous recombination but preferably, the nucleic acid construct may be integrated into the cell's genome by homologous recombination as is well known in the art (see e.g. WO90/14423, EP-A-0481008, EP-A-0635 574 and U.S. Pat. No. 6,265,186).

Most episomal or 2μ plasmids are relatively unstable in yeast, being lost in approximately 10−2 or more cells after each generation. Even under conditions of selective growth, only 60% to 95% of the cells retain the episomal plasmid. The copy number of most episomal plasmids ranges from 20-100 per cell of cir+ hosts. However, the plasmids are not equally distributed among the cells, and there is a high variance in the copy number per cell in populations. Strains transformed with integrative plasmids are extremely stable, even in the absence of selective pressure. However, plasmid loss can occur at approximately 10−3 to 10−4 frequencies by homologous recombination between tandemly repeated DNA, leading to looping out of the vector sequence. Preferably, the vector design in the case of stable integration is thus, that upon loss of the selection marker genes (which also occurs by intramolecular, homologous recombination) that looping out of the integrated construct is no longer possible. Preferably the genes are thus stably integrated. Stable integration is herein defined as integration into the genome, wherein looping out of the integrated construct is no longer possible. Preferably selection markers are absent. Typically, the enzyme encoding sequence will be operably linked to one or more nucleic acid sequences, capable of providing for or aiding the transcription and/or translation of the enzyme sequence.

The term “operably linked” refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. For instance, a promoter or enhancer is operably linked to a coding sequence the said promoter or enhancer affects the transcription of the coding sequence.

As used herein, the term “promoter” refers to a nucleic acid fragment that functions to control the transcription of one or more genes, located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences known to one of skilled in the art. A “constitutive” promoter is a promoter that is active under most environmental and developmental conditions. An “inducible” promoter is a promoter that is active under environmental or developmental regulation.

The promoter that could be used to achieve the expression of a nucleotide sequence coding for an enzyme according to the present invention, may be not native to the nucleotide sequence coding for the enzyme to be expressed, i.e. a promoter that is heterologous to the nucleotide sequence (coding sequence) to which it is operably linked. The promoter may, however, be homologous, i.e. endogenous, to the host cell.

Promotors are widely available and known to the skilled person. Suitable examples of such promoters include e.g. promoters from glycolytic genes, such as the phosphofructokinase (PFK), triose phosphate isomerase (TPI), glyceraldehyde-3-phosphate dehydrogenase (GPD, TDH3 or GAPDH), pyruvate kinase (PYK), phosphoglycerate kinase (PGK) promoters from yeasts or filamentous fungi; more details about such promoters from yeast may be found in (WO 93/03159). Other useful promoters are ribosomal protein encoding gene promoters, the lactase gene promoter (LAC4), alcohol dehydrogenase promoters (ADH1, ADH4, and the like), and the enolase promoter (ENO). Other promoters, both constitutive and inducible, and enhancers or upstream activating sequences will be known to those of skill in the art. The promoters used in the host cells of the invention may be modified, if desired, to affect their control characteristics. Suitable promoters in this context include both constitutive and inducible natural promoters as well as engineered promoters, which are well known to the person skilled in the art. Suitable promoters in eukaryotic host cells may be GAL7, GAL10, or GAL1, CYC1, HIS3, ADH1, PGL, PH05, GAPDH, ADC1, TRP1, URA3, LEU2, ENO1, TPI1, and AOX1. Other suitable promoters include PDC1, GPD1, PGK1, TEF1, and TDH3.

In a transformed host cell, the 3′-end of the nucleotide acid sequence encoding enzyme preferably is operably linked to a transcription terminator sequence. Preferably the terminator sequence is operable in a host cell of choice, such as e.g. the yeast species of choice. In any case the choice of the terminator is not critical; it may e.g. be from any yeast gene, although terminators may sometimes work if from a non-yeast, eukaryotic, gene. Usually a nucleotide sequence encoding the enzyme comprises a terminator. Preferably, such terminators are combined with mutations that prevent nonsense mediated mRNA decay in the host transformed host cell (see for example: Shirley et al., 2002, Genetics 161:1465-1482).

The transcription termination sequence further preferably comprises a polyadenylation signal.

Optionally, a selectable marker may be present in a nucleic acid construct suitable for use in the invention. As used herein, the term “marker” refers to a gene encoding a trait or a phenotype which permits the selection of, or the screening for, a host cell containing the marker. The marker gene may be an antibiotic resistance gene whereby the appropriate antibiotic can be used to select for transformed cells from among cells that are not transformed. Examples of suitable antibiotic resistance markers include e.g. dihydrofolate reductase, hygromycin-B-phosphotransferase, 3′-O-phosphotransferase II (kanamycin, neomycin and G418 resistance). Antibiotic resistance markers may be most convenient for the transformation of polyploid host cells, Also non-antibiotic resistance markers may be used, such as auxotrophic markers (URA3, TRP1, LEU2) or the S. pombe TPI gene (described by Russell P R, 1985, Gene 40: 125-130). In a preferred embodiment the host cells transformed with the nucleic acid constructs are marker gene free. Methods for constructing recombinant marker gene free microbial host cells are disclosed in EP-A-0 635 574 and are based on the use of bidirectional markers such as the A. nidulans amdS (acetamidase) gene or the yeast URA3 and LYS2 genes. Alternatively, a screenable marker such as Green Fluorescent Protein, lacL, luciferase, chloramphenicol acetyltransferase, beta-glucuronidase may be incorporated into the nucleic acid constructs of the invention allowing to screen for transformed cells.

Optional further elements that may be present in the nucleic acid constructs suitable for use in the invention include, but are not limited to, one or more leader sequences, enhancers, integration factors, and/or reporter genes, intron sequences, centromers, telomers and/or matrix attachment (MAR) sequences. The nucleic acid constructs of the invention may further comprise a sequence for autonomous replication, such as an ARS sequence.

The recombination process may thus be executed with known recombination techniques. Various means are known to those skilled in the art for expression and overexpression of enzymes in a transformed host cell. In particular, an enzyme may be overexpressed by increasing the copy number of the gene coding for the enzyme in the host cell, e.g. by integrating additional copies of the gene in the host cell's genome, by expressing the gene from an episomal multicopy expression vector or by introducing a episomal expression vector that comprises multiple copies of the gene.

Alternatively, overexpression of enzymes in the host cells of the invention may be achieved by using a promoter that is not native to the sequence coding for the enzyme to be overexpressed, i.e. a promoter that is heterologous to the coding sequence to which it is operably linked. Although the promoter preferably is heterologous to the coding sequence to which it is operably linked, it is also preferred that the promoter is homologous, i.e. endogenous to the host cell. Preferably the heterologous promoter is capable of producing a higher steady state level of the transcript comprising the coding sequence (or is capable of producing more transcript molecules, i.e. mRNA molecules, per unit of time) than is the promoter that is native to the coding sequence. Suitable promoters in this context include both constitutive and inducible natural promoters as well as engineered promoters.

In an embodiment, the transformed host cell is markerfree, which means that no auxotrophic or dominant markers, in particular antibiotic resistance markers, are present in the genome or extra-chromosomally.

The coding sequence used for overexpression of the enzymes mentioned above may preferably be homologous to the host cell. However, coding sequences that are heterologous to the host may be used.

Overexpression of an enzyme, when referring to the production of the enzyme in a genetically modified cell, means that the enzyme is produced at a higher level of specific enzymatic activity as compared to the unmodified host cell under identical conditions. Usually this means that the enzymatically active protein (or proteins in case of multi-subunit enzymes) is produced in greater amounts, or rather at a higher steady state level as compared to the unmodified host cell under identical conditions. Similarly this usually means that the mRNA coding for the enzymatically active protein is produced in greater amounts, or again rather at a higher steady state level as compared to the unmodified host cell under identical conditions. Preferably in a host, an enzyme to be overexpressed is overexpressed by at least a factor of about 1.1, about 1.2, about 1.5, about 2, about 5, about 10 or about 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity, the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme.

Adaptation

Adaptation is the evolutionary process whereby a population becomes better suited (adapted) to its habitat or habitats. This process takes place over several to many generations, and is one of the basic phenomena of biology.

The term adaptation may also refer to a feature which is especially important for an organism's survival. Such adaptations are produced in a variable population by the better suited forms reproducing more successfully, by natural selection.

Changes in environmental conditions alter the outcome of natural selection, affecting the selective benefits of subsequent adaptations that improve an organism's fitness under the new conditions. In the case of an extreme environmental change, the appearance and fixation of beneficial adaptations can be essential for survival. A large number of different factors, such as e.g. nutrient availability, temperature, the availability of oxygen, etcetera, can drive adaptive evolution.

Fitness

There is a clear relationship between adaptedness (the degree to which an organism is able to live and reproduce in a given set of habitats) and fitness. Fitness is an estimate and a predictor of the rate of natural selection. By the application of natural selection, the relative frequencies of alternative phenotypes will vary in time, if they are heritable.

Genetic Changes

When natural selection acts on the genetic variability of the population, genetic changes are the underlying mechanism. By this means, the population adapts genetically to its circumstances. Genetic changes may result in visible structures, or may adjust the physiological activity of the organism in a way that suits the changed habitat.

It may occur that habitats frequently change. Therefore, it follows that the process of adaptation is never finally complete. In time, it may happen that the environment changes gradually, and the species comes to fit its surroundings better and better. On the other hand, it may happen that changes in the environment occur relatively rapidly, and then the species becomes less and less well adapted. Adaptation is a genetic process, which goes on all the time to some extent, also when the population does not change the habitat or environment.

The Adaptive Evolution

The transformed host cells may in their preparation be subjected to adaptive evolution. A transformed host cell may be adapted to sugar utilisation by selection of mutants, either spontaneous or induced (e.g. by radiation or chemicals), for growth on the desired sugar, preferably as sole carbon source, and more preferably under anaerobic conditions. Selection of mutants may be performed by techniques including serial transfer of cultures as e.g. described by Kuyper et al. (2004, FEMS Yeast Res. 4: 655-664) or by cultivation under selective pressure in a chemostat culture. E.g. in a preferred host cell at least one of the genetic modifications described above, including modifications obtained by selection of mutants, confer to the host cell the ability to grow on the xylose as carbon source, preferably as sole carbon source, and preferably under anaerobic conditions. When XI is used as gene to convert xylose, preferably the cell produce essentially no xylitol, e.g. the xylitol produced is below the detection limit or e.g. less than about 5, about 2, about 1, about 0.5, or about 0.3% of the carbon consumed on a molar basis.

Adaptive evolution is also described e.g. in Wisselink H. W. et al, Applied and Environmental Microbiology August 2007, p. 4881-4891

In one embodiment of adaptive evolution a regimen consisting of repeated batch cultivation with repeated cycles of consecutive growth in different media is applied, e.g. three media with different compositions (glucose, xylose, and arabinose; xylose and arabinose. See Wisselink et al. (2009) Applied and Environmental Microbiology, February 2009, p. 907-914.

Yeast Transformation and Genetic Stability

Genetic engineering, i.e. transformation of yeast cells with recombinant DNA, became feasible for the first time in 1978 [Beggs, 1978; Hinnen et al., 1978]. Recombinant DNA technology in yeast has established itself since then. A multitude of different vector constructs are available. Generally, these plasmid vectors, called shuttle vectors, contain genetic material derived from E. coli vectors consisting of an origin of replication and a selectable marker (often the ßlactamase gene, ampR), which enable them to be propagated in E. coli prior to transformation into yeast cells. Additionally, the shuttle vectors contain a selectable marker for selection in yeast. Markers can be genes encoding enzymes for the synthesis of a particular amino acid or nucleotide, so that cells carrying the corresponding genomic deletion (or mutation) are complemented for auxotrophy or autotrophy. Alternatively, these vectors contain heterologous dominant resistance markers, which provides recombinant yeast cells (i.e. the cells that have taken up the DNA and express the marker gene) resistance towards certain antibiotics, like g418 (Geneticin), hygromycinB or phleomycin. In addition, these vectors may contain a sequence of (combined) restriction sites (multiple cloning site or MCS) which will allow to clone foreign DNA into these sites, although alternative methods exist as well.

Traditionally, four types of shuttle vectors can be distinguished by the absence or presence of additional genetic elements:

    • Integrative plasmids (YIp) which by homologous recombination are integrated into the host genome at the locus of the marker or another gene, when this is opened by restriction and the linearized DNA is used for transformation of the yeast cells. This generally results in the presence of one copy of the foreign DNA inserted at this particular site in the genome.
    • Episomal plasmids (YEp) which carry part of the 2μ plasmid DNA sequence necessary for autonomous replication in yeast cells. Multiple copies of the transformed plasmid are propagated in the yeast cell and maintained as episomes.
    • Autonomously replicating plasmids (YRp) which carry a yeast origin of replication (ARS, autonomously replicated sequence) that allows the transformed plasmids to be propagated several hundred-fold.
    • CEN plasmids (YCp) which carry in addition to an ARS sequence a centromeric sequence (derived from one of the nuclear chromosomes) which normally guarantees stable mitotic segregation and usually reduces the copy number of self-replicated plasmid to just one.

These plasmids are being introduced into the yeast cells by transformation. Transformation of yeast cells may be achieved by several different techniques, such as permeabilization of cells with lithium acetate (Ito et al, 1983) and electroporation methods.

In commercial application of recombinant microorganisms, plasmid instability is the most important problem. Instability is the tendency of the transformed cells to lose their engineered properties because of changes to, or loss of, plasmids. This issue is discussed in detail by Zhang et al (Plasmid stability in recombinant Saccharomyces cerevisiae. Biotechnology Advances, Vol. 14, No. 4, pp. 401-435, 1996). Strains transformed with integrative plasmids are extremely stable, even in the absence of selective pressure (Sherman, F. dbb.urmc.rochester.edu/labs/sherman_f/yeast/9.html and references therein).

The heterologous DNA is usually introduced into the organism in the form of extra-chromosomal plasmids (YEp, YCp and YRp). Unfortunately, it has been found with both bacteria and yeasts that the new characteristics may not be retained, especially if the selection pressure is not applied continuously. This is due to the segregational instability of the hybrid plasmid when recombinant cells grow for a long period of time. This leads to population heterogeneity and clonal variability, and eventually to a cell population in which the majority of the cells has lost the properties that were introduced by transformation. If vectors with auxotrophic markers are being used, cultivation in rich media often leads to rapid loss of the vector, since the vector is only retained in minimal media. The alternative, the use of dominant antibiotic resistance markers, is often not compatible with production processes. The use of antibiotics may not be desired from a registration point of view (the possibility that trace amounts of the antibiotic end up in the end product) or for economic reasons (costs of the use of antibiotics at industrial scale).

Loss of vectors leads to problems in large scale production situations. Alternative methods for introduction of DNA do exist for yeasts, such as the use of integrating plasmids (Ylp). The DNA is integrated into the host genome by recombination, resulting in high stability. (Gaunt, P. Stability of recombinant plasmids in yeast. Journal of Biotechnology 9(1988) 173-192). We have found that an integration method using the host transposons are a good alternative. In an embodiment genes may be integrated into the transformed host cell genome. Initial introduction (i.e. before adaptive evolution) of multiple copies be executed in any way known in the art that leads to introduction of the genes. In an embodiment, this may be accomplished using a vector with parts homologous to repeated sequences (transposons), of the host cell. When the host cell is a yeast cell, suitable repeated sequences are the long terminal repeats (LTR) of the Ty element, known as delta sequence. Ty elements fall into two rather similar subfamilies called Ty1 and Ty2. These elements are about 6 kilobases (kb) in length and are bounded by long terminal repeats (LTR), sequences of about 335 base pairs (Boeke J D et al, The Saccharomyces cerevisiae Genome Contains Functional and Nonfunctional Copies of Transposon Ty1. Molecular and Cellular Biology, April 1988, p. 1432-1442 Vol. 8, No. 4). In the fully sequenced S. cerevisiae strain, S288c, the most abundant transposons are Ty1 (31 copies) and Ty2 (13 copies) (Gabriel A, Dapprich J, Kunkel M, Gresham D, Pratt S C, et al. (2006) Global mapping of transposon location. PLoS Genet 2(12): e212.doi:10.1371/journal.pgen.0020212). These transposons consist of two overlapping open reading frames (ORFs), each of which encode several proteins. The coding regions are flanked by the aforementioned, nearly identical LTRs. Other, but less abundant and more distinct Ty elements in S. cereviaise comprise Ty3, Ty4 and Ty5. For each family of full-length Ty elements there are an order of magnitude more solo LTR elements dispersed through the genome. These are thought to arise by LTR-LTR recombination of full-length elements, with looping out of the internal protein encoding regions.

The retrotransposition mechanism of the Ty retrotransposon has been exploited to integrate multiple copies throughout the genome (Boeke et al., 1988; Jacobs et al., 1988). The long terminal repeats (LTR) of the Ty element, known as delta sequences, are also good targets for integration by homologous recombination as they exist in about 150-200 copies that are either Ty associated or solo sites (Boeke, 1989; Kingsman and Kingsman, 1988). (Parekh R. N. (1996). An Integrating Vector for Tunable, High Copy, Stable Integration into the Dispersed Ty DELTA Sites of Saccharomyces cerevisiae. Biotechnol. Prog. 1996, 12, 16-21). By adaptive evolution, the number of copies may change.

The Host Cell

The host cell may be any host cell suitable for production of a useful product. A host cell may be any suitable cell, such as a prokaryotic cell, such as a bacterium, or a eukaryotic cell. Typically, the cell will be a eukaryotic cell, for example a yeast or a filamentous fungus.

Yeasts are herein defined as eukaryotic microorganisms and include all species of the subdivision Eumycotina (Alexopoulos, C. J., 1962, In: Introductory Mycology, John Wiley & Sons, Inc., New York) that predominantly grow in unicellular form.

Yeasts may either grow by budding of a unicellular thallus or may grow by fission of the organism. A preferred yeast as a transformed host cell may belong to the genera Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces or Yarrowia. Preferably the yeast is one capable of anaerobic fermentation, more preferably one capable of anaerobic alcoholic fermentation.

Filamentous fungi are herein defined as eukaryotic microorganisms that include all filamentous forms of the subdivision Eumycotina. These fungi are characterized by a vegetative mycelium composed of chitin, cellulose, and other complex polysaccharides. The filamentous fungi of the suitable for use as a cell of the present invention are morphologically, physiologically, and genetically distinct from yeasts. Filamentous fungal cells may be advantageously used since most fungi do not require sterile conditions for propagation and are insensitive to bacteriophage infections. Vegetative growth by filamentous fungi is by hyphal elongation and carbon catabolism of most filamentous fungi is obligately aerobic. Preferred filamentous fungi as a host cell may belong to the genus Aspergillus, Trichoderma, Humicola, Acremoniurra, Fusarium or Penicillium. More preferably, the filamentous fungal cell may be a Aspergillus niger, Aspergillus oryzae, a Penicillium chrysogenum, or Rhizopus oryzae cell.

In one embodiment the host cell may be yeast.

Preferably the host is an industrial host, more preferably an industrial yeast. An industrial host and industrial yeast cell may be defined as follows. The living environments of yeast cells in industrial processes are significantly different from that in the laboratory. Industrial yeast cells must be able to perform well under multiple environmental conditions which may vary during the process. Such variations include change in nutrient sources, pH, ethanol concentration, temperature, oxygen concentration, etc., which together have potential impact on the cellular growth and ethanol production of Saccharomyces cerevisiae. Under adverse industrial conditions, the environmental tolerant strains should allow robust growth and production. Industrial yeast strains are generally more robust towards these changes in environmental conditions which may occur in the applications they are used, such as in the baking industry, brewing industry, wine making and the ethanol industry. Examples of industrial yeast (S. cerevisiae) are Ethanol Red® (Fermentis) Fermiol® (DSM) and Thermosacc® (Lallemand).

In an embodiment the host is inhibitor tolerant. Inhibitor tolerant host cells may be selected by screening strains for growth on inhibitors containing materials, such as illustrated in Kadar et al, Appl. Biochem. Biotechnol. (2007), Vol. 136-140, 847-858, wherein an inhibitor tolerant S. cerevisiae strain ATCC 26602 was selected.

araA, araB and araD Genes

A transformed host cell is capable of using arabinose. A transformed host cell is therefore, be capable of converting L-arabinose into L-ribulose and/or xylulose 5-phosphate and/or into a desired fermentation product, for example one of those mentioned herein.

Organisms, for example S. cerevisiae strains, able to produce ethanol from L-arabinose may be produced by modifying a cell introducing the araA (L-arabinose isomerase), araB (L-ribulokinase) and araD (L-ribulose-5-P4-epimerase) genes from a suitable source. Such genes may be introduced into a transformed host cell is order that it is capable of using arabinose. Such an approach is given is described in WO2003/095627. araA, araB and araD genes from Lactobacillus plantarum may be used and are disclosed in WO2008/041840. The araA gene from Bacillus subtilis and the araB and araD genes from Escherichia coli may be used and are disclosed in EP1499708. In another embodiment, araA, araB and araD genes may derived from of at least one of the genus Clavibacter, Arthrobacter and/or Gramella, in particular one of Clavibacter michiganensis, Arthrobacter aurescens, and/or Gramella forsetii, as disclosed in WO 2009011591.

PPP-Genes

A transformed host cell may comprise one or more genetic modifications that increases the flux of the pentose phosphate pathway. In particular, the genetic modification(s) may lead to an increased flux through the non-oxidative part of the pentose phosphate pathway. A genetic modification that causes an increased flux of the non-oxidative part of the pentose phosphate pathway is herein understood to mean a modification that increases the flux by at least a factor of about 1.1, about 1.2, about 1.5, about 2, about 5, about 10 or about 20 as compared to the flux in a strain which is genetically identical except for the genetic modification causing the increased flux. The flux of the non-oxidative part of the pentose phosphate pathway may be measured by growing the modified host on xylose as sole carbon source, determining the specific xylose consumption rate and subtracting the specific xylitol production rate from the specific xylose consumption rate, if any xylitol is produced. However, the flux of the non-oxidative part of the pentose phosphate pathway is proportional with the growth rate on xylose as sole carbon source, preferably with the anaerobic growth rate on xylose as sole carbon source. There is a linear relation between the growth rate on xylose as sole carbon source (μmax) and the flux of the non-oxidative part of the pentose phosphate pathway. The specific xylose consumption rate (Qs) is equal to the growth rate (μ) divided by the yield of biomass on sugar (Yxs) because the yield of biomass on sugar is constant (under a given set of conditions: anaerobic, growth medium, pH, genetic background of the strain, etc.; i.e. Qs=μ/Yxs). Therefore the increased flux of the non-oxidative part of the pentose phosphate pathway may be deduced from the increase in maximum growth rate under these conditions unless transport (uptake is limiting).

One or more genetic modifications that increase the flux of the pentose phosphate pathway may be introduced in the host cell in various ways. These including e.g. achieving higher steady state activity levels of xylulose kinase and/or one or more of the enzymes of the non-oxidative part pentose phosphate pathway and/or a reduced steady state level of unspecific aldose reductase activity. These changes in steady state activity levels may be effected by selection of mutants (spontaneous or induced by chemicals or radiation) and/or by recombinant DNA technology e.g. by overexpression or inactivation, respectively, of genes encoding the enzymes or factors regulating these genes.

In a preferred host cell, the genetic modification comprises overexpression of at least one enzyme of the (non-oxidative part) pentose phosphate pathway. Preferably the enzyme is selected from the group consisting of the enzymes encoding for ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, transketolase and transaldolase. Various combinations of enzymes of the (non-oxidative part) pentose phosphate pathway may be overexpressed. E.g. the enzymes that are overexpressed may be at least the enzymes ribulose-5-phosphate isomerase and ribulose-5-phosphate epimerase; or at least the enzymes ribulose-5-phosphate isomerase and transketolase; or at least the enzymes ribulose-5-phosphate isomerase and transaldolase; or at least the enzymes ribulose-5-phosphate epimerase and transketolase; or at least the enzymes ribulose-5-phosphate epimerase and transaldolase; or at least the enzymes transketolase and transaldolase; or at least the enzymes ribulose-5-phosphate epimerase, transketolase and transaldolase; or at least the enzymes ribulose-5-phosphate isomerase, transketolase and transaldolase; or at least the enzymes ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, and transaldolase; or at least the enzymes ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, and transketolase. In one embodiment of the invention each of the enzymes ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, transketolase and transaldolase are overexpressed in the host cell. More preferred is a host cell in which the genetic modification comprises at least overexpression of both the enzymes transketolase and transaldolase as such a host cell is already capable of anaerobic growth on xylose. In fact, under some conditions host cells overexpressing only the transketolase and the transaldolase already have the same anaerobic growth rate on xylose as do host cells that overexpress all four of the enzymes, i.e. the ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, transketolase and transaldolase. Moreover, host cells overexpressing both of the enzymes ribulose-5-phosphate isomerase and ribulose-5-phosphate epimerase are preferred over host cells overexpressing only the isomerase or only the epimerase as overexpression of only one of these enzymes may produce metabolic imbalances.

The enzyme “ribulose 5-phosphate epimerase” (EC 5.1.3.1) is herein defined as an enzyme that catalyses the epimerisation of D-xylulose 5-phosphate into D-ribulose 5-phosphate and vice versa. The enzyme is also known as phosphoribulose epimerase; erythrose-4-phosphate isomerase; phosphoketopentose 3-epimerase; xylulose phosphate 3-epimerase; phosphoketopentose epimerase; ribulose 5-phosphate 3-epimerase; D-ribulose phosphate-3-epimerase; D-ribulose 5-phosphate epimerase; D-ribulose-5-P 3-epimerase; D-xylulose-5-phosphate 3-epimerase; pentose-5-phosphate 3-epimerase; or D-ribulose-5-phosphate 3-epimerase. A ribulose 5-phosphate epimerase may be further defined by its amino acid sequence. Likewise a ribulose 5-phosphate epimerase may be defined by a nucleotide sequence encoding the enzyme as well as by a nucleotide sequence hybridising to a reference nucleotide sequence encoding a ribulose 5-phosphate epimerase. The nucleotide sequence encoding for ribulose 5-phosphate epimerase is herein designated RPE1.

The enzyme “ribulose 5-phosphate isomerase” (EC 5.3.1.6) is herein defined as an enzyme that catalyses direct isomerisation of D-ribose 5-phosphate into D-ribulose 5-phosphate and vice versa. The enzyme is also known as phosphopentosisomerase; phosphoriboisomerase; ribose phosphate isomerase; 5-phosphoribose isomerase; D-ribose 5-phosphate isomerase; D-ribose-5-phosphate ketol-isomerase; or D-ribose-5-phosphate aldose-ketose-isomerase. A ribulose 5-phosphate isomerase may be further defined by its amino acid sequence. Likewise a ribulose 5-phosphate isomerase may be defined by a nucleotide sequence encoding the enzyme as well as by a nucleotide sequence hybridising to a reference nucleotide sequence encoding a ribulose 5-phosphate isomerase. The nucleotide sequence encoding for ribulose 5-phosphate isomerase is herein designated RKI1.

The enzyme “transketolase” (EC 2.2.1.1) is herein defined as an enzyme that catalyses the reaction: D-ribose 5-phosphate+D-xylulose 5-phosphate<−>sedoheptulose 7-phosphate+D-glyceraldehyde 3-phosphate and vice versa. The enzyme is also known as glycolaldehydetransferase or sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glycolaldehydetransferase. A transketolase may be further defined by its amino acid. Likewise a transketolase may be defined by a nucleotide sequence encoding the enzyme as well as by a nucleotide sequence hybridising to a reference nucleotide sequence encoding a transketolase. The nucleotide sequence encoding for transketolase is herein designated TKL1.

The enzyme “transaldolase” (EC 2.2.1.2) is herein defined as an enzyme that catalyses the reaction: sedoheptulose 7-phosphate+D-glyceraldehyde 3-phosphate<−>D-erythrose 4-phosphate+D-fructose 6-phosphate and vice versa. The enzyme is also known as dihydroxyacetonetransferase; dihydroxyacetone synthase; formaldehyde transketolase; or sedoheptulose-7-phosphate: D-glyceraldehyde-3-phosphate glyceronetransferase. A transaldolase may be further defined by its amino acid sequence. Likewise a transaldolase may be defined by a nucleotide sequence encoding the enzyme as well as by a nucleotide sequence hybridising to a reference nucleotide sequence encoding a transaldolase. The nucleotide sequence encoding for transketolase from is herein designated TAL1.

Xylose Isomerase or Xylose Reductase Genes

According to the invention, one or more copies of one or more xylose isomerase gene and/or one or more xylose reductase and xylitol dehydrogenase are introduced into the genome of the host cell. The presence of these genetic elements confers on the cell the ability to convert xylose by isomerisation or reduction.

In one embodiment, the one or more copies of one or more xylose isomerase gene are introduced into the genome of the host cell.

A “xylose isomerase” (EC 5.3.1.5) is herein defined as an enzyme that catalyses the direct isomerisation of D-xylose into D-xylulose and/or vice versa. The enzyme is also known as a D-xylose ketoisomerase. A xylose isomerase herein may also be capable of catalysing the conversion between D-glucose and D-fructose (and accordingly may therefore be referred to as a glucose isomerase). A xylose isomerase herein may require a bivalent cation, such as magnesium, manganese or cobalt as a cofactor.

Accordingly, such a transformed host cell is capable of isomerising xylose to xylulose. The ability of isomerising xylose to xylulose is conferred on the host cell by transformation of the host cell with a nucleic acid construct comprising a nucleotide sequence encoding a defined xylose isomerase. A transformed host cell isomerises xylose into xylulose by the direct isomerisation of xylose to xylulose.

A unit (U) of xylose isomerase activity may herein be defined as the amount of enzyme producing 1 nmol of xylulose per minute, under conditions as described by Kuyper et al. (2003, FEMS Yeast Res. 4: 69-78).

The Xylose isomerise gene may have various origin, such as for example Piromyces sp. as disclosed in WO2006/009434. Other suitable origins are Bacteroides, in particular Bacteroides uniformis as described in PCT/EP2009/52623, Bacillus, in particular Bacillus stearothermophilus as described in PCT/EP2009/052625.

In another embodiment, one or more copies of one or more xylose reductase and xylitol dehydrogenase genes are introduced into the genome of the host cell. In this embodiment the conversion of xylose is conducted in a two step conversion of xylose into xylulose via a xylitol intermediate as catalysed by xylose reductase and xylitol dehydrogenase, respectively. In an embodiment thereof xylose reductase (XR), xylitol dehydrogenase (XDH), and xylokinase (XK) may be overexpressed, and optionally one or more of genes encoding NADPH producing enzymes are up-regulated and one or more of the genes encoding NADH consuming enzymes are up-regulated, as disclosed in WO 2004085627.

XKS1 Gene

A transformed host cell may comprise one or more genetic modifications that increase the specific xylulose kinase activity. Preferably the genetic modification or modifications causes overexpression of a xylulose kinase, e.g. by overexpression of a nucleotide sequence encoding a xylulose kinase. The gene encoding the xylulose kinase may be endogenous to the host cell or may be a xylulose kinase that is heterologous to the host cell. A nucleotide sequence used for overexpression of xylulose kinase in the host cell is a nucleotide sequence encoding a polypeptide with xylulose kinase activity.

The enzyme “xylulose kinase” (EC 2.7.1.17) is herein defined as an enzyme that catalyses the reaction ATP+D-xylulose=ADP+D-xylulose 5-phosphate. The enzyme is also known as a phosphorylating xylulokinase, D-xylulokinase or ATP:D-xylulose 5-phosphotransferase. A xylulose kinase of the invention may be further defined by its amino acid sequence. Likewise a xylulose kinase may be defined by a nucleotide sequence encoding the enzyme as well as by a nucleotide sequence hybridising to a reference nucleotide sequence encoding a xylulose kinase.

In a transformed host cell, a genetic modification or modifications that increase(s) the specific xylulose kinase activity may be combined with any of the modifications increasing the flux of the pentose phosphate pathway as described above. This is not, however, essential.

Thus, a host cell may comprise only a genetic modification or modifications that increase the specific xylulose kinase activity. The various means available in the art for achieving and analysing overexpression of a xylulose kinase in the host cells of the invention are the same as described above for enzymes of the pentose phosphate pathway. Preferably in the host cells of the invention, a xylulose kinase to be overexpressed is overexpressed by at least a factor of about 1.1, about 1.2, about 1.5, about 2, about 5, about 10 or about 20 as compared to a strain which is genetically identical except for the genetic modification(s) causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity, the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme.

Aldose Reductase (GRE3) Gene Deletion

In the embodiment, where XI is used as gene to convert xylose, it may be advantageous to reduce aldose reducatase activity. A transformed host cell may therefore comprise one or more genetic modifications that reduce unspecific aldose reductase activity in the host cell. Preferably, unspecific aldose reductase activity is reduced in the host cell by one or more genetic modifications that reduce the expression of or inactivates a gene encoding an unspecific aldose reductase. Preferably, the genetic modification(s) reduce or inactivate the expression of each endogenous copy of a gene encoding an unspecific aldose reductase in the host cell (herein called GRE3 deletion). Transformed host cells may comprise multiple copies of genes encoding unspecific aldose reductases as a result of di-, poly- or aneu-ploidy, and/or the host cell may contain several different (iso)enzymes with aldose reductase activity that differ in amino acid sequence and that are each encoded by a different gene. Also in such instances preferably the expression of each gene that encodes an unspecific aldose reductase is reduced or inactivated. Preferably, the gene is inactivated by deletion of at least part of the gene or by disruption of the gene, whereby in this context the term gene also includes any non-coding sequence up- or down-stream of the coding sequence, the (partial) deletion or inactivation of which results in a reduction of expression of unspecific aldose reductase activity in the host cell.

A nucleotide sequence encoding an aldose reductase whose activity is to be reduced in the host cell is a nucleotide sequence encoding a polypeptide with aldose reductase activity.

Thus, a host cell comprising only a genetic modification or modifications that reduce(s) unspecific aldose reductase activity in the host cell is specifically included in the invention.

The enzyme “aldose reductase” (EC 1.1.1.21) is herein defined as any enzyme that is capable of reducing xylose or xylulose to xylitol. In the context of the present invention an aldose reductase may be any unspecific aldose reductase that is native (endogenous) to a host cell of the invention and that is capable of reducing xylose or xylulose to xylitol. Unspecific aldose reductases catalyse the reaction:

aldose+NAD(P)H+H+H+alditol+NAD(P)+

The enzyme has a wide specificity and is also known as aldose reductase; polyol dehydrogenase (NADP+); alditol:NADP oxidoreductase; alditol:NADP+1-oxidoreductase; NADPH-aldopentose reductase; or NADPH-aldose reductase.

A particular example of such an unspecific aldose reductase that is endogenous to S. cerevisiae and that is encoded by the GRE3 gene (Traff et al., 2001, Appl. Environ. Microbiol. 67: 5668-74). Thus, an aldose reductase of the invention may be further defined by its amino acid sequence. Likewise an aldose reductase may be defined by the nucleotide sequences encoding the enzyme as well as by a nucleotide sequence hybridising to a reference nucleotide sequence encoding an aldose reductase.

Bioproducts Production

Over the years suggestions have been made for the introduction of various organisms for the production of bio-ethanol from crop sugars. In practice, however, all major bio-ethanol production processes have continued to use the yeasts of the genus Saccharomyces as ethanol producer. This is due to the many attractive features of Saccharomyces species for industrial processes, i. e., a high acid-, ethanol- and osmo-tolerance, capability of anaerobic growth, and of course its high alcoholic fermentative capacity. Preferred yeast species as host cells include S. cerevisiae, S. bulderi, S. barnetti, S. exiguus, S. uvarum, S. diastaticus, K. lactis, K. marxianus or K fragilis.

A transformed host cell may be a cell suitable for the production of ethanol. A transformed host cell may, however, be suitable for the production of fermentation products other than ethanol

Such non-ethanolic fermentation products include in principle any bulk or fine chemical that is producible by a eukaryotic microorganism such as a yeast or a filamentous fungus.

A transformed host cell that may be used for production of non-ethanolic fermentation products is a host cell that contains a genetic modification that results in decreased alcohol dehydrogenase activity.

In an embodiment the transformed host cell may be used in a process wherein sugars originating from lignocellulose are converted into ethanol.

Lignocellulose

Lignocellulose, which may be considered as a potential renewable feedstock, generally comprises the polysaccharides cellulose (glucans) and hemicelluloses (xylans, heteroxylans and xyloglucans). In addition, some hemicellulose may be present as glucomannans, for example in wood-derived feedstocks. The enzymatic hydrolysis of these polysaccharides to soluble sugars, including both monomers and multimers, for example glucose, cellobiose, xylose, arabinose, galactose, fructose, mannose, rhamnose, ribose, galacturonic acid, glucoronic acid and other hexoses and pentoses occurs under the action of different enzymes acting in concert.

In addition, pectins and other pectic substances such as arabinans may make up considerably proportion of the dry mass of typically cell walls from non-woody plant tissues (about a quarter to half of dry mass may be pectins).

Pretreatment

Before enzymatic treatment, the lignocellulosic material may be pretreated. The pretreatment may comprise exposing the lignocellulosic material to an acid, a base, a solvent, heat, a peroxide, ozone, mechanical shredding, grinding, milling or rapid depressurization, or a combination of any two or more thereof. This chemical pretreatment is often combined with heat-pretreatment, e.g. between 150-220° C. for 1 to 30 minutes.

Enzymatic Hydrolysis

The pretreated material is commonly subjected to enzymatic hydrolysis to release sugars that may be fermented according to the invention. This may be executed with conventional methods, e.g. contacting with cellulases, for instance cellobiohydrolase(s), endoglucanase(s), beta-glucosidase(s) and optionally other enzymes. The conversion with the cellulases may be executed at ambient temperatures or at higher tempatures, at a reaction time to release sufficient amounts of sugar(s). The result of the enzymatic hydrolysis is hydrolysis product comprising C5/C6 sugars, herein designated as the sugar composition.

Fermentation

The fermentation process may be an aerobic or an anaerobic fermentation process. An anaerobic fermentation process is herein defined as a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than about 5, about 2.5 or about 1 mmol/L/h, more preferably 0 mmol/L/h is consumed (i.e. oxygen consumption is not detectable), and wherein organic molecules serve as both electron donor and electron acceptors. In the absence of oxygen, NADH produced in glycolysis and biomass formation, cannot be oxidised by oxidative phosphorylation. To solve this problem many microorganisms use pyruvate or one of its derivatives as an electron and hydrogen acceptor thereby regenerating NAD+.

Thus, in a preferred anaerobic fermentation process pyruvate is used as an electron (and hydrogen acceptor) and is reduced to fermentation products such as ethanol, butanol, lactic acid, di-terpene, glycosylated di-terpene, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, a β-lactam antibiotic and a cephalosporin.

The fermentation process is preferably run at a temperature that is optimal for the cell. Thus, for most yeasts or fungal host cells, the fermentation process is performed at a temperature which is less than about 42° C., preferably less than about 38° C. For yeast or filamentous fungal host cells, the fermentation process is preferably performed at a temperature which is lower than about 35, about 33, about 30 or about 28° C. and at a temperature which is higher than about 20, about 22, or about 25° C.

The ethanol yield on xylose and/or glucose in the process preferably is at least about 50, about 60, about 70, about 80, about 90, about 95 or about 98%. The ethanol yield is herein defined as a percentage of the theoretical maximum yield.

The invention also relates to a process for producing a fermentation product.

The fermentation process according to the present invention may be run under aerobic and anaerobic conditions. In an embodiment, the process is carried out under micro-aerophilic or oxygen limited conditions.

An anaerobic fermentation process is herein defined as a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than about 5, about 2.5 or about 1 mmol/L/h, and wherein organic molecules serve as both electron donor and electron acceptors.

An oxygen-limited fermentation process is a process in which the oxygen consumption is limited by the oxygen transfer from the gas to the liquid. The degree of oxygen limitation is determined by the amount and composition of the ingoing gasflow as well as the actual mixing/mass transfer properties of the fermentation equipment used. Preferably, in a process under oxygen-limited conditions, the rate of oxygen consumption is at least about 5.5, more preferably at least about 6, such as at least 7 mmol/L/h. A process of the invention may comprise recovery of the fermentation product.

In a preferred process the cell ferments both the xylose and glucose, preferably simultaneously in which case preferably a cell is used which is insensitive to glucose repression to prevent diauxic growth. In addition to a source of xylose (and glucose) as carbon source, the fermentation medium will further comprise the appropriate ingredient required for growth of the cell. Compositions of fermentation media for growth of microorganisms such as yeasts are well known in the art

The fermentation processes may be carried out in batch, fed-batch or continuous mode. A separate hydrolysis and fermentation (SHF) process or a simultaneous saccharification and fermentation (SSF) process may also be applied. A combination of these fermentation process modes may also be possible for optimal productivity. These processes are described hereafter in more detail.

SSF Mode

For Simultaneous Saccharification and Fermentation (SSF) mode, the reaction time for liquefaction/hydrolysis or presaccharification step is dependent on the time to realize a desired yield, i.e. cellulose to glucose conversion yield. Such yield is preferably as high as possible, preferably 60% or more, 65% or more, 70% or more, 75% or more 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, even 99.5% or more or 99.9% or more.

According to the invention very high sugar concentrations in SHF mode and very high product concentrations (e.g. ethanol) in SSF mode are realized. In SHF operation the glucose concentration is 25 g/L or more, 30 g/L or more, 35 g/L or more, 40 g/L or more, 45 g/L or more, 50 g/L or more, 55 g/L or more, 60 g/L or more, 65 g/L or more, 70 g/L or more, 75 g/L or more, 80 g/L or more, 85 g/L or more, 90 g/L or more, 95 g/L or more, 100 g/L or more, 110 g/L or more, 120 g/L or more or may e.g. be 25 g/L-250 g/L, 30 g1/L-200 g/L, 40 g/L-200 g/L, 50 g/L-200 g/L, 60 g/L-200 g/L, 70 g/L-200 g/L, 80 g/L-200 g/L, 90 g/L, 80 g/L-200 g/L.

Product Concentration in SSF Mode

In SSF operation, the product concentration (g/L) is dependent on the amount of glucose produced, but this is not visible since sugars are converted to product in the SSF, and product concentrations can be related to underlying glucose concentration by multiplication with the theoretical maximum yield (Yps max in gr product per gram glucose)

The theoretical maximum yield (Yps max in gr product per gram glucose) of a fermentation product can be derived from textbook biochemistry. For ethanol, 1 mole of glucose (180 gr) yields according to normal glycolysis fermentation pathway in yeast 2 moles of ethanol (=2×46=92 gr ethanol. The theoretical maximum yield of ethanol on glucose is therefore 92/180=0.511 gr ethanol/gr glucose.

For Butanol (MW 74 gr/mole) or iso butanol, the theoretical maximum yield is 1 mole of butanol per mole of glucose. So Yps max for (iso-)butanol=74/180=0.411 gr (iso-)butanol/gr glucose.

For lactic acid the fermentation yield for homolactic fermentation is 2 moles of lactic acid (MW=90 gr/mole) per mole of glucose. According to this stoichiometry, the Yps max=1 gr lactic acid/gr glucose.

For other fermentation products a similar calculation may be made.

SSF Mode

In SSF operation the product concentration is 25 g*Yps g/L/L or more, 30*Yps g/L or more, 35 g*Yps/L or more, 40*Yps g/L or more, 45*Yps g/L or more, 50*Yps g/L or more, 55*Yps g/L or more, 60*Yps g/L or more, 65*Yps g/L or more, 70*Yps g/L or more, 75*Yps g/L or more, 80*Yps g/L or more, 85*Yps g/L or more, 90*Yps g/L or more, 95*Yps g/L or more, 100*Yps g/L or more, 110*Yps g/L or more, 120 g/L*Yps or more or may e.g. be 25*Yps g/L-250*Yps g/L, 30*Yps gl/L-200*Yps g/L, 40*Yps g/L-200*Yps g/L, 50*Yps g/L-200*Yps g/L, 60*Yps g/L-200*Yps g/L, 70*Yps g/L-200*Yps g/L, 80*Yps g/L-200*Yps g/L, 90*Yps g/L, 80*Yps g/L-200*Yps g/L

Accordingly, the invention provides a method for the preparation of a fermentation product, which method comprises:

a. degrading lignocellulose using a method as described herein; and

b. fermenting the resulting material,

thereby to prepare a fermentation product.

Fermentation Product

The fermentation product of the invention may be any useful product. In one embodiment, it is a product selected from the group consisting of ethanol, n-butanol, isobutanol, lactic acid, di-terpene, glycosylated di-terpene, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, fumaric acid, malic acid, itaconic acid, maleic acid, citric acid, adipic acid, an amino acid, such as lysine, methionine, tryptophan, threonine, and aspartic acid, 1,3-propane-diol, ethylene, glycerol, a β-lactam antibiotic and a cephalosporin, vitamins, pharmaceuticals, animal feed supplements, specialty chemicals, chemical feedstocks, plastics, solvents, fuels, including biofuels and biogas or organic polymers, and an industrial enzyme, such as a protease, a cellulase, an amylase, a glucanase, a lactase, a lipase, a lyase, an oxidoreductases, a transferase or a xylanase. For example the fermentation products may be produced by cells according to the invention, following prior art cell preparation methods and fermentation processes, which examples however should herein not be construed as limiting. n-butanol may be produced by cells as described in WO2008121701 or WO2008086124; lactic acid as described in US2011053231 or US2010137551; 3-hydroxy-propionic acid as described in WO2010010291; acrylic acid as described in WO2009153047.

Recovery of the Fermentation Product

For the recovery of the fermentation product existing technologies are used. For different fermentation products different recovery processes are appropriate. Existing methods of recovering ethanol from aqueous mixtures commonly use fractionation and adsorption techniques. For example, a beer still can be used to process a fermented product, which contains ethanol in an aqueous mixture, to produce an enriched ethanol-containing mixture that is then subjected to fractionation (e.g., fractional distillation or other like techniques). Next, the fractions containing the highest concentrations of ethanol can be passed through an adsorber to remove most, if not all, of the remaining water from the ethanol.

The following examples illustrate the invention:

EXAMPLES

Methods

Molecular Biology Techniques and Chemicals.

Restriction enzymes and T4 DNA ligase were acquired from Fermentas. Antibiotics hygromycin (HG), phleomycin (phleo) and geneticin (G418) were acquired from Invivogen. pYL16 and nourseothricin (nour) were acquired from Werner Bioagents. Ampicillin and kanamycin were acquired from Sigma-Aldrich.

For PCR amplifications, Phusion® High-Fidelity DNA Polymerase was used (Finnzymes). PCR fragments were sub-cloned using the TOPO® TA Cloning@ Kit or the Zero Blunt@ TOPO® PCR Cloning Kit (both from Life Technologies). Oligonucleotides used for strain construction were purchased from Sigma-Aldrich.

Plasmids were amplified and maintained in chemically competent TOP10 cells (TOPO® TA Cloning@ Kit, Life Techonologies) following manufacturer's instructions. Plasmids were isolated from E. coli mini cultures using the GeneJET™ Plasmid Miniprep Kit (Fermentas). Genomic DNA was isolated from yeast using the YeaStar™ Genomic DNA Kit (ZymoResearch) following manufacturer's instructions.

Standard molecular biology and yeast genetics techniques were conducted according to textbooks including Sambrook et al. (1989) and Ausubel et al. (1995).

Strains and Maintenance.

For storage of the strains used in this work (Table 2), shake flask cultures were performed in rich medium (YP), consisting of 10 g l−1 yeast extract (Oxoid) and 20 g l−1 peptone (BD Difco), supplemented with either 2% glucose (YPD), 2% maltose (YPM), or 3% xylose (YPX). Cultures were maintained at 30° C. in an orbital shaker until cultures reached stationary growth phase. After adding glycerol to 30% (v/v), samples from shake-flask cultures were stored in 2 ml aliquots at −80° C.


TABLE 2
Strains used or prepared herein
Strain
Genotype
RN1001
Mat a, ura3-52, leu2-112, gre3::loxP, loxP-Ptpi:TAL1,
loxP-Ptpi::RKI1, loxP-Ptpi-TKL1, loxP-Ptpi-RPE1,
delta::Padh1XKS1Tcyc1-LEU2, delta::URA3-Ptpi-xylA-
Tcyc1
RN1014
RN1001 + in vivo engineering on xylose and acetic acid
RN1041
RN1001 his3::loxP
RN1053
RN1041 hxt2::loxP-kanMX-loxP, hxt367::loxP-hphMX-loxP,
hxt145::loxP-natMX-loxP, gal2::loxP-zeoMX-loxP
YD01227
RN1014 glk1::lox72; hxk1::loxP; hxk2::lox72; gal1::loxP;
his3::loxPnatMXloxP

OD600 and HPLC Analysis in Shake Flask Culture.

Shake flask cultures were sampled regularly during culture. For OD600 measurements, cultures were diluted appropriately for accurate measurement and optical density was measured at 600 nm wavelength in a Perkin Elmer Spectrophotometer λ2 instrument. Remaining sample was filtrated to separate medium from yeast.

The filtrate was inserted into the appropriate vials for HPLC analysis. The concentrations of glucose, xylose, glycerol, acetic acid and ethanol in the medium were determined using a Shimadzu HPLC system. The system is equipped with column oven CTO-10A-vp and Autoinjector SIL-10AD-vp with a guard column (Bio-Rad H cartridge, Bio-Rad) and an Aminex HPX-87H column (300×7.8 mm; Bio-Rad). Elution took place at 80° C. with 5 mM H2SO4 at 0.6 mL/min. The eluate was monitored using a Refractive Index detector RID-10A (Shimadzu).

Microwell Plate Culture for Growth Curve Profiling.

For micro-well cultivation of strains, the Bioscreen C (Growth Curves Ltd.) was used. Overnight pre-cultures were pelleted, washed with demi water and diluted in demi water to twice the desired OD600 for inoculation. Medium was prepared in twice the concentration as desired. In one well of a honeycomb wellplate, 150 μl medium was mixed with 150 μl cell suspension. Measurements were conducted in triplicate. Settings for the Bioscreen C were maintained at 30° C. incubation T, measurements every 15 min, shaking at type Continuous, amplitude Maximum, and speed Normal. Shaking was set to stop 5 sec before measurement.

Automated Transformation and Colony Picking.

For the generation of transformation of a saturation mutagenesis library into the model strains shake-flask cultures were performed in either YPM for RN1053, or YPX for YD01227 (see below). Yeast cells were pelleted and, subsequently, used in an automated transformation protocol based on Schiestl and Gietz (1989). Transformation mixes were plated on selection medium consisting of yeast nitrogen base (Sigma-Aldrich; 6.7 g l-1), agar (BD Biosciences; 15 g l−1), supplemented with either 2% maltose (RN1053 transformations) or 3% xylose (YD01227 transformations). Transformation plates were incubated at 30° C., and after colony formation, colonies were re-plated using an automated process transferring colonies to 96 well microtiter plates (MTP) containing the above-referred selection media. MTPs with transformants were incubated at 30° C. until clear growth was observed.

NMR Analysis.

For the quantification of glucose, xylose, glycerol, acetic acid and ethanol in the sample, 100 μl sample is transferred accurately into a suitable vial. Subsequently 100 μl internal standard solution, containing maleic acid (20 g/l), EDTA (40 g/l) and trace amounts of DSS (4,4-dimethyl-4-silapentane-1-sulfonic acid) in D2O, and 450 μL D2O is added.

1D 1H NMR spectra are recorded on a Bruker Avance III 700 MHz, equipped with a cryo-probe, using a pulse program with water suppression (power corresponding to 3 Hz) at a temperature of 27° C.

The analyte concentrations are calculated based on the following signals (6 relative to DSS):

    • α-glucose peak at 5.22 ppm (d, 0.38 H, J=4 Hz),
    • α-xylose peak at 5.18 ppm (d, 0.37 H, J=4 Hz),
    • glycerol peak at 3.55 ppm (dd, 2H, J1,2=6 Hz and J1a,1b=12 Hz)
    • acetic acid peak at 1.91 ppm (s, 3H)
    • ethanol peak at 1.17 ppm (t, 3H, J=7 Hz)
    • The signal user for the standard:
    • Maleic acid peak at 6.05 ppm (s, 2H)

Example 1—Hexose Transporter Gene Deletions

Deletion Cassettes Construction.

Primers used in plasmid constructions are shown in Table 3; generated plasmids are shown in Table 4. Schemes with restriction sites used for cloning and sites used to release deletion constructs from the plasmid backbone are shown in Table 5.


TABLE 3
Primers (oligonucleotides) used in the examples
SEQ ID
Internal
NO:
code
Primer
Sequence (5′→3′)
Gene(s)
Purpose
 1
5034
Kanf
AAGCTTGCCTCGTCCCCGCC
kanMX
Amplification
kanMX
 2
5035
Kanr
GTCGACACTGGATGGCGGCG
kanMX
Amplification
kanMX
 3
5116
If2
ATTCTAGTAACGGCCGCCAGTGTG
loxP
Part of loxP
CTGGAATTCGCCCTTAAGCTTGCC
flank
TCGTCCCCGCCG
45
5118
Ir2
CATACATTATACGAAGTTATGCGC
loxP
Part of loxP
GCTCTAGATATCGTCGACACTGGA
flank
TGGCGGCG
 5
5115
If1
ATCCGGACGTACGTATAACTTCGT
loxP
Reamplification/
ATAGCATACATTATACGAAGTTATT
full loxP flank
CTAGTAACGGCCGCCA
 6
5117
Ir1
TCATGACGTCTCGAGGCCTATAAC
loxP
Reamplification/
TTCGTATAGCATACATTATACGAAG
full loxP flank
TTATGCGCGCT
10
 115
Natf
ACATGTAAAATGACCACTCTTGAC
natl
Amplification
GACACGGC
nat1
11
 116
Natr
CAGTACTAGGGGCCAGGGCATGC
natl
Amplification
TC
nat1
13
  28
H3f
TGTACATCCGGAATTCTAGATTGG
HIS3
TGAGCGCTAGGAGTCACTGCC
14
  29
H3r
CTCGAGTATTTCACACCGCATATG
HIS3
ATCCGTCG
16
 201
Hx2uf
GACTAGTACCGGTGTTTTCAAAAC
HXT2
Upstream flank
CTAGCAACCCC
17
 202
Hx2ur
CGTACGCGTCTTCCGGAAGGGTA
HXT2
Upstream flank
CCATCAGATTTCATTTGACC
18
 203
Hx2df
GAAGACACTCGAGACGTCCTTTGT
HXT2
Downstream
CTGTGAAACCAAGGGC
flank
19
 204
Hx2dr
GTCGACGGGCCCTTATGTTGGTCT
HXT2
Downstream
TGTTTAGTATGGCCG
flank
20
 205
Hx3uf
AAGCGGCCGCACTAGTACCGGTG
HXT3
Upstream flank
AAACAACTCAATAACGATGTGGGA
C
21
 206
Hx3ur
ATCCGGACGTCTTCCTCAAGAAAT
HXT3
Upstream flank
CAGTTTGGGCGACG
22
 210
Hx4df
AGAAGACGCTCGAGACGTCCCTTA
HXT4
Downstream
TGGGAAGAAGGTGTTTTGCC
flank
23
 211
Hx4dr
ATGGATCCTAGGGGTTCTTGCAGA
HXT4
Downstream
GTAAACTGCG
flank
24
 212
Hx5uf
AAGCGGCCGCACTAGTACATGTGA
HXT5
Upstream flank
ACTTGAAAACGCTCATCAAGGC
25
 213
Hx5ur
TTCGTACGCGTCTTCCGGAGTAAC
HXT5
Upstream flank
ATGAAACCAGAGTACCACG
26
 229
Hx7df
AGAAGACCCTCGAGACGTCCGAC
HXT7
Downstream
GCTGAAGAAATGACTCACG
flank
27
 230
Hx7dr
AGTCGACGGATCCGTAATTTTTCT
HXT7
Downstream
TCTTTTAAGTGACGGGCG
flank
28
 243
Gal2ufn
AAGCGGCCGCACTAGTACCGGTG
GAL2
Upstream flank
ATCTATATTCGAAAGGGGCGG
29
 244
Gal2urn
AACGTACGTCCGGATCATTAGAAT
GAL2
Upstream flank
ACTTTTGAGATTGTGCGCT
30
 233
Ga2df
AGAAGACCCTCGAGACGTCTTACC
GAL2
Downstream
TTGGAAATCTGAAGGCTGG
flank
31
 234
Ga2dr
GTGGATCCTAGGTAAAACGGTACG
GAL2
Downstream
AGAAAAGCTCCG
flank
36
 281
Hx3inr2
GCTCTTTTCACGGAGAAATTCGGG
HXT3-6-7
Integration
check
39
 289
Hx2inf
TCTTCGGGAACTAGATAGGTGGC
HXT2
Integration
check
43
 290
Hx2inr
GAAGTAATCAGCCACAATACGCC
HXT2
Integration
check
38
 299
Hx4inr2
CCATACTATTTGTCGACTCAAGCG
HXT5-1-4
Integration
C
check
39
 317
Hx5inf
GGGTTAATTAGTTTTAGGGGCACG
HXT5-1-4
Integration
G
check
37
 323
Hx7inr1
GATGAGAATCCTTGGCAACCGC
HXT3-6-7
Integration
check
40
 324
Ga2inf1
TCAATTCGGAAAGCTTCCTTCCGG
GAL2
Integration
check
41
 325
Ga2inr1
CAGTGATAGTTTGGTTCGAGCGG
GAL2
Integration
check
44
 838
Glk1-
ATGTCATTCGACGACTTACACAAA
GLK1
Hexokinase
psuc22
GCCACTGAGAGAGCGGTCATCCA
flank/Bipartite
7f
GGCCCGTCGACCTCGAGTACCGT
cassette
TCG
45
 834
Hxk2-
GCCAGAAAGGGTTCCATGGCCGA
HXK2
Hexokinase
psuc22
TGTGCCAAAGGAATTGATGCAACA
flank/Bipartite
7f
AATCCGTCGACCTCGAGTACCGTT
cassette
CG
46
 645
pSUC2
GCAATTTCGGCTATACGTAAC
Bipartite
27r
cassette
47
 839
Glk1-
CAATCTTCAAGTGCACCTTCCTCT
GLK1
Hexokinase
psuc22
CACCCTCGGCACCCAAGGGTGAC
flank/Bipartite
5r
AAGCCGGATCCTACCGTTCGTATA
cassette
GC
48
 835
Hxk2-
GCCAGAAAGGGTTCCATGGCCGA
HXK2
Hexokinase
psuc22
TGTGCCAAAGGAATTGATGCAACA
flank/Bipartite
5r
AATCCGTCGACCTCGAGTACCGTT
cassette
CG
49
 646
pSUC2
CGTTCACTCATGGAAAATAGC
Bipartite
25f
cassette
50
 846
Hxk1_
ATGGTTCATTTAGGTCCAAAGAAA
HXK1
Hexokinase
loxP_f
CCACAGGCTAGAAAGGGTTCCATG
flank/DRM
GCCGGATCCACTAGCATAACTTCG
cassette
51
 847
Hxkl_
ATGGTTCATTTAGGTCCAAAGAAA
HXK1
Hexokinase
loxP_r
CCACAGGCTAGAAAGGGTTCCATG
flank/DRM
GCCGGATCCACTAGCATAACTTCG
cassette
52
 848
Gal1_
ATGACTAAATCTCATTCAGAAGAA
GAL1
Hexokinase
loxP _f
GTGATTGTACCTGAGTTCAATTCTA
flank/DRM
GCGGATCCACTAGCATAACTTCG
cassette
53
 849
Gal1_
TTATAATTCATATAGACAGCTGCCC
GAL1
Hexokinase
loxP_r
AATGCTGGTTTAGAGACGATGATA
flank/DRM
GTTGGGCCGCCAGTGTGATGG
cassette


TABLE 4
Plasmids used in the strain construction
Number
Construct
Purpose
SEQ ID NO:
pRN201
pCR-BLUNT-loxP-kanMX-loxP
Dominant resistance marker
7
pRN251
pCR-BLUNT-loxP-hphMX-loxP
Dominant resistance marker
8
pRN365
pCR-BLUNT-loxP-natMX-loxP
Dominant resistance marker
9
pRN447
pCR-BLUNT-loxP-zeoMX-loxP
Dominant resistance marker
12
pRN247
pCR-BLUNT-his3:loxP-kanMX-loxP
HIS3 deletion construct
15
pRN485
pCR-BLUNT-gal2:loxP-zeoMX-loxP
GAL2 deletion construct
32
pRN566
pCR-BLUNT-hxt367:loxP-hphMX-
HXT3-HXT6-HXT7 cluster
33
loxP
deletion construct
pRN569
pCR-BLUNT-hxt514:loxP-natMX-
HXT5-HXT1-HXT4 cluster
34
loxP
deletion contruct
pRN635
pCR-BLUNT-hxt2:loxP-kanMX-loxP
HXT2 deletion construct
35
pRN993
pRN978-PHXT7(−491)-GAL2-TADH1
GAL2 expression vector
57
pDB1250
pRN978-PHXT7(−491)-synt.wt-GAL2-
Synthetic wild-type GAL2
58
TADH1
expression vector
pRN187
pCRE-zeoMX (based on pSH65)
CRE recombinase expression
60
vector
pRN486
pCR-BLUNT-HIS3::loxPnatMXloxP
HIS3 deletion construct
61


TABLE 5
Cloning scheme
Construct
Fragment
Cloning Sites
Release Sites
pRN247
HIS3 upstream
SacI-DraI
XhoI-BsrGI
loxP-kanMX-loxP
StuI-BsiWI
HIS3 downstream
BsiWI-ApaI
pRN485
GAL2 upstream
NotI-BsiWI
BamHI-SpeI-PmlI
loxP-zeoMX-loxP
BsiWI-XhoI
GAL2 downstream
XhoI-BamHI
pRN566
HXT3 upstream
SpeI-BsiWI
BamHI-AgeI-NaeI
loxP-hphMX-loxP
BsiWI-XhoI
HXT7 downstream
XhoI-BamHI
pRN569
HXT5 upstream
NotI-BspEI
BamHI-NotI-ApaLI
loxP-natMX-loxP
BspEI-XhoI
HXT4 downstream
XhoI-BamHI
pRN635
HXT2 upstream
SpeI-BsiWI
AgeI-NotI-BspHI
loxP-kanMX-loxP
BsiWI-XhoI
HXT2 downstream
XhoI-EcoRI

The kanMX marker was amplified from the plasmid pFA6-kanMX4 (www-sequence.stanford.edu/group/yeast_deletion_project/kanmx 4.txt) using primers SEQ ID NO's 1 and 2. Subsequently, the kanMX marker was floxed through adding loxP flanks by PCR amplification with primers SEQ ID NO's 3 and 4. Re-amplification was done with primers SEQ ID NO's 5 and 6. The resulting loxP-kanMX-IoxP fragment was cloned in pCR-BLUNT resulting in pRN201 (SEQ ID NO: 7).

For the construction of pRN251 (SEQ ID NO: 8), hphMX was isolated from pGRE3:hphMX (Kuyper et al, 2005). To delete a MluI site as appropriate restriction site in the vicinity of hphMX, pGRE3:hphMX was cut with Eco321 and re-ligated. Subsequently, hphMX was cloned as XhoI-MluI fragment into pRN201 digested with SalI and MluI to replace kanMX.

For the construction of pRN365 (SEQ ID NO: 9), the Streptomyces noursei nat1 gene was PCR-amplified from pYL16 (Werner Bioagents) using primers with SEQ ID NO:'s 10 and -11. The PscI-ScaI nat1 fragment together with the Acc65I-NcoI pRN201-fragment were cloned into pRN201, already linearized with Acc65I and ScaI, in order to replace kanR for nat1.

For the construction of pRN447 (SEQ ID NO: 12), pRN201 was digested with PmlI. This served two ends. Firstly, the Streptoalloteichus hindustanus ble (zeocin or phleomycin resistance gene) ORF was isolated, and secondly, after re-ligation of the PmlI-digested pRN201 an NcoI site was deleted. Subsequently, ble as NcoI-PmlI fragment and part of pRN201 as BamHI-NcoI vector fragment were cloned into the re-ligated pRN201 (missing ble), digested with BamHI and ScaI resulting in pRN447.

For the HIS3 deletion construct, primers SEQ ID13 and -14 were used to amplify the HIS3 locus from yeast genomic DNA. Sites used to cut out the HIS3 flanks and to ligate these to the floxed kanMX marker are shown in Table 5. The ligation product was digested with SacI and ApaI and cloned into pCR-BLUNT digested with SacI and ApaI. The resulting plasmid is pRN247 (SEQ ID NO: 15).

For the deletion of the eight main hexose transporters (HXT1-7 and GAL2 in S. cerevisiae, four deletion constructs were generated (see Table 4). Each deletion construct contained a different floxed dominant resistance marker. For each HXT gene 400-700 bp flanks were amplified using the primers listed in Table 3 (SEQ ID NO:'s 16-31) using RN1001 genomic DNA as template. The upstream flank, the dominant resistance marker and the downstream marker were ligated using the fragments and cloning sites listed under Table 5. The ligations were amplified using the forward primers 2 combinations SEQ ID NO:'s 16+19, SEQ ID NO:'s 20+27, SEQ ID NO:'s 24+23, and SEQ ID NO:'s 28+31). The fused PCR fragments were cloned into pCR-BLUNT to obtain pRN485, pRN566, pRN569, pRN635 (SEQ ID NO:'s 32-35, respectively). To obtain high yields of plasmid DNA, the plasmids were isolated from 50 mL E. coli cultures using NucleoBond® Xtra Midi kit (Bioké, Leiden, the Netherlands). Before transformation to yeast, deletion constructs were released from plasmid backbone by digestion with the release restriction sites listed in Table 5.

Strain Construction.

The xylose-fermenting strain RN1001 was made histidine auxotroph by the insertion of loxP-kanMX-loxP (released from pRN247; SEQ NO ID15) at the HIS3 locus. Subsequently, the marker was removed through transient expression of plasmid pRN187 (derived from pSH65 expressing galactose-inducible cre recombinase; SEQ ID NO 60). Introduction of pRN187 was selected on phleo and CRE recombinase expression was induced on YP-medium supplemented with galactose. The resulting his3:loxP strain was named RN1041. The hexose transporters were deleted in the following order: 1) HXT3-HXT6-HXT7cluster, 2) HXT5-HXT1-HXT4 cluster, 3) GAL2, 4) HXT2. The deletion constructs were linearized or released from the plasmid backbone by cutting with the enzyme combinations listed in Table 5 and these were integrated in the genome of RN1041. All transformations were plated on yeast extract (10 g/L), peptone (20 g/L) agar (15 g/L) medium supplemented with 20 g/L maltose. Maltose was added to the medium, because the uptake of this disaccharide goes via an alternative transport system than the glucose transport system (Wieczorke et al, 1999). With each deletion of a (cluster of) HXT gene(s), an additional marker was inserted in the order: 1) hphMX, 2) natMX, 3) zeoMX, 4) kanMX. With each inserted additional marker the respective antibiotic was additionally supplemented to the medium in the following order: 1) HG, 2) HG and nour, 3) HG, nour and phleo, 4) HG, nour, phleo and G418. After integration of all four deletion constructs, a single colony was isolated under selection of all four antibiotics. Correct integrations were verified by PCR analysis on genomic DNA isolates. Primers outside of the integration site were used (combinations SEQ ID NO:'s 36+37, SEQ ID NO:'s 38+39, SEQ ID NO:'s 40+41, SEQ ID NO:'s 42+43; sequences listed in Table 3).

Strain Characterization.

To characterize the (intermediate) hexose transporter strains, shake flask cultures were performed. Cultures were inoculated at OD600=0.1. The resulting strain, RN1053 (Δhxt1-7; gal2-mutant RN1041; see Table 2 for exact genotype), showed a retarded growth pattern on Verduyn-urea (mineral medium according to Verduyn using urea as nitrogen source; Luttik et al, 2001) supplemented with 0.2 g l−1 histidine (Sigma-Aldrich; Verduyn-urea-his; to complement for the histidine auxotrophy) and 15 g l−1 glucose and 20 g l−1 xylose only starting to grow slowly on glucose only after 60 hours; interestingly, when glucose was present in the medium xylose was finished as well after 150 hrs (FIG. 1) indicating that one or more of the cryptic hexose transporter genes (HXT8-17) was induced on glucose and facilitated xylose transport (FIG. 1). However, on xylose as sole carbon source RN1053 did not grow on Verduyn-urea (+20 g l-1% xylose during the culturing period (FIG. 2) indicating the strain is useable as model strain for testing putative xylose transporters. RN10153 was further maintained on YPM.

Example 2—Hexokinase Gene Deletions

Deletion Cassettes Construction.

For deletion of hexokinase genes oligonucleotides were designed (SEQ ID NO:'s in Table 3) comprised of 60 nucleotide flanking sequences homologous to the hexokinase gene locus and of 20 nucleotides homologous to a floxed dominant resistance marker cassette. The oligonucleotides were used to amplify the deletion constructs. Subsequent PCR products were column filter-purified (Fermentas GeneJet Kit) and used for transformations experiments. Three types of deletion cassettes were used: firstly, for GLK1 and HXK2 deletions a bipartite system was used. One fragment consisted of a lox66 site, KanMX, GAL1 promoter upstream of CRE, and the 5′-part of CRE (CRE1) amplified from pSUC227 with one gene-specific primer (SEQ ID NO: 44 for GLK1 and SEQ ID NO: 45 for HXK2) and one pSUC227-specific primer (SEQ ID NO: 46); the second fragment consisted of the 3′-part of CRE (CRE2) with overlap on CRE1, and a lox71 site, amplified from pSUC225 with again one gene-specific primers (SEQ ID NO: 47 for GLK1 and SEQ ID48 for HXK2) and one pSUC225-specific primer SEQ ID NO: 49. Through homologous recombination the two fragments integrate as lox66-kanMX-CRE-lox71 at the hexokinase locus (pSUC225 and pSUC227 sequences and method provided in PCT/EP2013/055047). Secondly, for HXK1 (primers SEQ ID NO:'s 50-51) and GAL1 (primers SEQ ID NO:'s 52-53) deletions, a floxed dominant resistance marker (DRM) was amplified with flanking sequences homologous to the respective hexokinase to replace the coding region at the locus; as templates for the PCR amplifications of the DRM cassettes pRN774 (loxP-hphMX-loxP; SEQ ID NO: 54) and pRN775 (loxP-natMx-loxP; SEQ ID NO: 55) were used, respectively. Thirdly, for HIS3 deletion to allow for complementation of the auxotrophic phenotype by transporter episomal plasmids, a similar construct with HIS3-homologous flanks was integrated as was used to generate RN1041 (RN1001-his3:loxP, in strain family RN1053; see above Example 1). In this case the construct beared natMX as dominant resistance marker instead of kanMX (SEQ ID NO 61).

Strain Construction.

For the generation of a strain incapable of hexose metabolism but capable of hexose transport, hexokinase gene deletions were made in the xylose-fermenting strain RN1014 (Table 2; FIG. 3 for deletion scheme).

As mentioned, in the case of GLK1 and HXK2, the disruption cassettes were bipartite. Through homologous recombination the two fragments integrate as lox66-kanMX-CRE-lox71 at the hexokinase locus. The integration was selected on YPD supplemented with G418. The disruption cassettes for HXK1 and GAL1 consisted of one fragment: either loxP-natMX-loxP or loxP-hphMX-loxP, respectively. RN1014 was transformed with the purified PCR products and the integration was selected on the appropriate antibiotic. Additionally, HIS3 was disrupted with a similar construct (SEQ ID NO: 61) used for the generation of RN1053. In this case natMX was the selection marker instead of kanMX.

The genes were deleted in the following order: 1) GLK1, 2) HXK1, 3) GAL1, 4) HXK2 and 5) HIS3. After the deletion of GLK1 and HXK1 both markers were recycled by galactose-induced Cre-mediated recombination. After deletion of HXK2 the intermediate strain was maintained on xylose-containing rich medium (YPX). After HIS3 deletion the integrated hphMX and kanMX markers were removed by galactose-induced CRE recombination. To ensure growth of the strain, 2% xylose was added to YP 2% galactose+nourseothricin (YPGX). Selection on nourseothricin ensured maintenance of the natMX marker at the HIS3 locus leaving a selection trait to be used possibly later on. After single colony isolation, the strain was verified for its deletions and delta sequence profile by colony PCR, and named YD01227.

Strain Characterization.

In aerobic shake flask culture experiments using Verduyn-urea-his, another colony with the same quadruple hexokinase knockout (KO) genotype (col 2) as YD01227 was characterized in a pre-screen for its ability to consume xylose in the absence and presence an excess of glucose (10%), and for its ability to consume glucose (FIG. 4). Cultures were inoculated at OD600=0.1. Both RN1014 and the quadruple hexokinase KO are able to grow on and consume xylose (data not shown). And expectedly, the quadruple hexokinase KO does neither grow on nor consumes glucose, whereas RN1014 does (data not shown). Furthermore, the excess of glucose (10%) prevents the growth on and consumption of xylose for at least 96 hours, whereas RN1014 utilizes xylose (FIG. 4).

In Bioscreen C experiments, YD01227 and the aforementioned col 2 were screened for growth on Verduyn-urea-his supplemented with different sugars and sugar mixtures. Cultures were inoculated at OD600=0.05. YD01227 grew on xylose but was not able to grow on glucose, maltose or galactose (data not shown). The glucose-xylose mixtures were screened to support a choice of medium composition suitable for the screen for pentose-specific transporters. As seen in FIG. 5, with a ratio of glucose:xylose of 5:1 showed the optimal inhibition of growth on xylose for strain YD01227. This was the case for both a high (10:2), as for a low sugar load (2.5:0.5). YD01227 was further maintained on YPX for storage and handling.

Example 3. GAL2 Saturation Mutagenesis Library and Other Constructs

A synthetic DNA construct for wild-type (WT) GAL2 was ordered at GeneArt (SEQ ID NO: 56; Invitrogen) and was used as template for site-directed mutagenesis. The synthetic WT GAL2 DNA construct was cloned into pRN993 (SEQ ID NO: 57) as XbaI-BssHII fragment exchanging another ORF for the synthetic WT GAL2 construct to generate pDB1250 (SEQ ID NO: 58). pDB1250 is a yeast shuttle vector based on pRS313, bearing as most prominent features besides the synthetically made GAL2 ORF: 1) a HIS3 expression cassette to complement the histidine auxotrophy, 2) a CEN.ARSH to maintain 1-2 copies (low copy number) of the expression vector in yeast cells, 3) truncated HXT7 promoter (−491 bp) resulting in medium expression levels of downstream ORF, 4) ADH1 terminator, and 5) ampicillin resistance gene (amp′) for selection in E. coli TOP10 cells (see above) for cloning purposes (FIG. 6). The saturation mutagenesis library for at least 13 non-wild-type amino acid changes on 30 amino acid positions in Gal2p was ordered from Invitrogen Life Technologies (www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/gene-synthesis/directed-evolution/GeneArt-Site-Saturation-Mutagenesis.html); for positions and amino acid changes to the wild-type Gal2p amino acid sequence (SEQ ID NO: 59) see Table 6.


TABLE 6
GAL2 Single Site Saturation Mutagenesis Library
Gal2
# sites
Position
WT AA
# non wt AA
Non wt AA
1
85
F
15
A, C, D, E, G, H, K, M, N, P, Q, R, S, T, V
1
89
T
18
A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, V, W, Y
3
187
V
17
A, C, D, E, F, G, H, I, K, L, M, Q, R, S, T, W, V
4
191
A
19
C, D, E, F, G, H, K, L, M, N, P, Q, R, S, T, V, W, Y
5
214
Y
15
A, C, G, I, K, L, M, N, P, Q, R, S, T, V, W
6
215
Q
16
A, C, D, E, F, G, H, I, L, M, N, R, S, V, W, Y
7
218
I
15
A, C, D, E, G, H, K, L, M, N, R, S, T, V, W
8
219
T
15
A, C, D, E, F, G, I, K, L, M, N P, Q, R, S, V, W
9
222
I
15
A, C, D, E, G, H, K, M, P, R, S, T, V, W, Y
10
226
Y
19
A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W
11
338
Q
18
A, C, D, E, F, G, H, I, L, M, N, P, R, S, T, V, W, Y
12
339
M
19
A, C, D, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W, Y
13
341
Q
13
D, E, H, I, K, L, M, N, R, S, T, V, Y
14
342
Q
19
A, C, D, E, F, G, H, I, K, L, M, N, P, R, S, T, V, W, Y
15
343
L
19
A, C, D, E, F, G, H, I, K, M, N, P, Q, R, S, T, V, W, Y
16
346
N
19
A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W, Y
17
347
N
13
A, D, E, G, H, I, K, L, Q, R, S, T, V
18
350
F
14
D, E, H, I, K, L, M, N, Q, R, S, T, V, Y
19
373
G
19
A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y
20
376
N
18
A, C, D, E, F, H, I, K, L, M, P, Q, R, S, T, V, W, Y
21
380
T
18
A, C, D, E, F, G, I, K, L, M, N, P, Q, R, S, V, W, Y
22
383
S
17
A, C, D, E, F, G, I, K, L, M, N, Q, R, T, V, W, Y
23
444
F
19
A, C, D, E, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y
24
446
Y
13
D, E, H, I, K, L, M, N, Q, R, S, T, V
25
448
T
18
A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, V, W, Y
26
449
T
19
A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, V, W, Y
27
451
A
18
C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y
28
455
W
18
A, C, D, E, F, G, I, K, L, M, N, P, Q, R, S, T, V, Y
29
478
N
16
A, C, D, F, G, H, I, K, L, P, Q, R, V, W, Y
30
479
W
18
C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, Y

Resulting constructs were inserted by custom cloning at GeneArt (Invitrogen, Regensburg, Germany) in pDB1250 (SEQ ID NO: ID58).

Example 4: Glucose Transport Activity Counter-Screening

Aim.

Using the Glucose Transport Activity Counter (GTAC)-screen, i.e. transforming hexokinase-mutant strain YD01227 as host to introduce GAL2 variants and screening the resulting transformants on medium for growth on and consumption of xylose in the presence of a 5 times higher amount of glucose, mutations can be identified that favour xylose above in the presence of a surplus glucose in the Gal2p variant (i.e. higher affinity for xylose than for glucosea reduction or more preferably full removal of glucose transport capability, while keeping xylose transport capability more or less intact).

Transformation and Colony Picking.

YD01227 was transformed with a total of 497 constructs, each one bearing a GAL2 mutant. One construct with wild-type GAL2 sequence (pDB1250; SEQ ID NO: 58) was included as control. For each transformation, 3 colonies, when available, were re-plated to agar medium MTPs amounting to 1450 transformants. The 1450 transformants were screened in three parts. For each part of the screening, wild-type GAL2 was included as control.

Pre-Culture and Screen.

For pre-culture, transformants were transferred by automated process from selection agar medium MTPs to 96 well half-deepwell plates (96HDWP) containing liquid selection medium consisting of mineral medium (according to Verduyn, with urea as nitrogen source) supplemented with 3% xylose. The 96 HDWPs were cultured for 3 days of pre-culture in an orbital shaker at 30° C. and 750 rpm. Subsequently, for each well 20 μl of culture was transferred by automated process to 24 deepwell plates (24 DWPs) containing 2.5 ml Verduyn-urea supplemented with the sugar mixture glucose:xylose in a ratio 5:1 with the following concentrations: 10 g l−1 glucose and 2 g l−1 xylose (YD10-medium). For each of the three sampling points a series of 24DWPs was inoculated. On each 24DWP, one RN1001 growth control was inoculated to have an indication of plate variation effects. After 24 hours, 72 hours and 96 hours automatic sampling and transfer to 96HDWP was conducted for automated OD-measurement at 600 nm wavelength.

After the last OD measurement after 96 hours, cells were pelleted after centrifugation and 100 μl supernatant was collected by automated process for flow-NMR analysis residual constituents in the medium after culture (see above for method description). For each construct and each time point, the measured residual glucose and xylose concentrations for the different replicates were averaged. In order to compare the different parts of the screen, a relative value was calculated based on the difference to the wild-type residual xylose concentration measured in the particular part of the GTAC screen, according to the following formula:

RelXyl=(residualxyloseGal2-wildtype-residualxyloseGal2-mutant)residualxyloseGal2-wildtype×100%

Results.

Whereas RN1001 displayed complete consumption of both glucose and xylose, YD01227 transformants of wild-type and mutagenesis library GAL2 constructs did not consume glucose and displayed a spectrum of residual xylose concentrations representing their individual ability to consume xylose in the presence of glucose (FIG. 7A). As shown in FIG. 7B, the xylose consumption displayed a high correlation (R2=0.93) with the growth measurements (OD600). Since the screen was conducted in aerobic conditions, and little ethanol formation was shown (data not shown) and growth displayed high correlation with the xylose consumption, the residual xylose concentrations were used as main parameter to compare GAL2 variants with wild-type. The comparison of all tested mutant GAL2 variants versus wild-type GAL2 on xylose consumption (average RelXyl) at 96 hours is listed in Table 7. All mutations affecting glucose transport to the benefit of xylose transport have RelXyl>0 (Table 7). The TOP positions to target for a second round of mutagenesis were sorted based on their average RelXyl score per mutation; specific mutations were sorted on preference based on RelXyl score as well (Table 8).


TABLE 7
Relative OD600 (RelOD600) and xylose consumption (RelXyl)
of GTAC Screen. Wild-type GAL2 construct pDB1250 was set
to 0. RelOD600 values are the averages of 1-3 replicates and
are relative values compared to wild-type.
Pos
wtAA
MutAA
RelXyl
85
F
A
1.45
C
0.66
D
−1.89
E
−13.09
G
−1.06
H
1.76
K
−20.81
M
7.03
N
1.96
P
2.83
Q
37.68
R
−1.93
S
19.81
T
50.51
V
32.76
89
T
A
11.68
C
13.22
D
19.68
F
−9.97
H
25.59
I
−17.32
K
−24.84
L
12.38
M
−8.38
N
9.88
Q
−16.03
R
−16.11
S
−11.44
V
41.06
Y
−2.89
187
V
A
26.84
C
9.98
D
3.76
E
6.21
F
14.53
G
10.01
H
8.32
I
6.69
K
4.09
L
4.12
M
1.85
Q
10.17
R
3.05
S
7.54
T
10.41
W
1.81
Y
1.22
191
A
C
4.70
D
12.43
E
−2.61
F
5.49
G
15.83
H
2.83
I
11.93
K
1.94
L
−8.25
M
−14.37
N
20.35
P
14.89
Q
2.94
R
−1.09
S
3.09
T
10.61
V
4.52
W
2.49
Y
1.93
214
Y
A
−12.81
C
−5.85
G
18.41
I
−12.07
K
−4.66
L
35.33
M
23.92
N
32.71
P
18.44
Q
39.94
R
25.50
S
14.91
V
55.48
W
47.35
215
Q
A
2.01
C
9.90
D
13.62
F
10.12
G
−9.62
H
−18.18
I
17.72
L
24.63
M
21.59
N
−11.47
S
2.14
V
−8.22
W
−20.47
Y
−8.07
218
I
A
17.98
C
5.52
D
4.64
E
8.44
G
4.62
H
9.88
K
27.86
L
9.73
M
5.80
N
24.31
R
−0.73
S
24.96
T
−2.65
V
7.69
W
−2.10
219
T
A
52.55
C
25.05
D
18.04
E
−14.58
F
43.86
G
46.45
I
−11.07
K
−4.44
M
−18.28
N
7.85
Q
−22.81
R
−24.62
S
4.90
W
−16.77
222
I
A
11.37
C
13.45
D
20.91
E
3.35
G
3.75
H
9.73
K
−4.92
M
4.39
P
0.97
S
1.85
T
−1.59
V
8.42
W
−8.04
Y
7.87
226
Y
A
63.63
C
62.07
D
81.68
E
70.43
G
39.06
H
5.10
I
32.79
K
−1.86
L
42.48
M
74.04
N
62.81
P
49.78
Q
56.23
R
65.53
S
14.97
T
7.27
V
−11.15
W
44.48
338
Q
A
38.18
C
52.66
D
33.17
E
46.93
F
46.65
G
13.80
H
26.28
I
28.32
L
33.08
M
−2.53
N
22.26
P
3.96
R
39.83
S
3.96
T
11.84
V
24.84
W
35.55
Y
19.90
339
M
A
50.56
C
30.36
D
46.71
E
10.48
F
63.75
G
73.03
H
67.99
I
40.96
K
71.92
L
67.43
N
83.73
P
12.77
Q
77.74
R
70.25
S
81.65
T
57.02
V
82.35
W
−23.02
Y
37.43
341
Q
D
−20.08
E
−3.38
H
−22.19
L
46.71
M
23.17
N
11.77
R
−5.18
S
15.78
T
28.67
Y
19.78
342
Q
A
61.47
C
64.63
D
48.62
E
34.90
F
45.61
G
14.10
H
46.28
I
16.81
K
41.75
L
37.38
M
27.70
N
32.30
P
44.88
R
23.95
S
68.48
T
50.54
V
24.39
W
59.43
Y
76.45
343
L
A
9.67
C
8.74
D
9.41
E
2.39
F
15.49
G
11.87
H
16.96
I
10.67
K
40.15
M
16.94
N
14.03
P
26.08
Q
8.73
R
29.11
S
20.28
T
14.38
V
−6.06
W
7.76
Y
20.43
346
N
A
21.99
C
17.11
D
8.88
E
−8.32
F
9.91
G
8.42
H
26.01
I
17.12
K
17.48
L
6.48
M
13.19
Q
19.93
R
7.94
S
23.37
T
23.19
V
47.09
W
45.58
Y
41.70
347
N
A
44.64
D
26.67
E
25.36
G
−22.71
H
11.18
I
27.33
K
−22.05
L
7.79
Q
−14.96
R
−15.36
S
−15.56
T
−19.33
V
−28.12
350
Y
D
2.93
E
−13.15
H
−19.99
I
−10.76
K
3.00
L
40.49
M
5.01
N
13.57
Q
0.66
R
57.58
S
15.25
T
21.64
V
13.39
Y
−7.36
373
G
A
25.90
C
36.56
D
36.22
E
41.01
F
15.15
H
6.96
I
9.10
K
20.72
L
51.94
M
35.03
N
38.49
P
35.75
Q
5.50
R
8.35
S
11.62
T
10.67
V
21.91
W
22.96
Y
31.04
376
N
A
36.70
C
78.63
D
19.23
E
20.15
F
92.62
H
39.30
I
99.46
K
7.53
L
93.69
M
97.33
P
51.70
Q
24.24
R
27.86
S
59.39
T
99.01
V
96.57
W
13.51
Y
43.95
380
T
A
53.06
C
42.34
D
37.28
E
−29.92
F
54.67
G
34.22
I
47.40
K
42.12
L
39.25
M
74.78
N
49.79
P
43.28
Q
43.31
R
42.31
S
42.03
V
42.53
W
51.16
Y
25.09
383
S
A
57.21
C
67.78
D
29.42
E
54.55
F
52.71
G
39.71
I
25.88
K
49.19
L
37.72
M
52.64
N
58.14
Q
83.94
R
61.78
T
71.85
V
19.38
W
65.32
Y
62.76
444
F
A
32.41
C
14.64
D
13.21
E
16.38
G
12.78
H
25.62
I
31.95
K
28.79
L
39.43
M
17.30
N
5.43
P
15.65
Q
19.63
R
0.06
S
10.94
T
7.44
V
37.29
W
2.94
Y
32.56
446
F
D
10.80
E
10.63
H
16.93
I
8.65
K
−3.40
L
22.78
M
18.62
N
14.99
Q
34.25
R
−8.44
S
−20.59
T
−16.07
V
−9.48
448
T
A
76.95
C
58.53
D
66.10
E
53.25
F
61.94
G
65.05
H
67.00
I
58.01
K
54.82
L
63.49
M
77.64
P
64.39
Q
58.15
R
33.80
S
59.40
V
53.50
W
56.69
Y
47.73
449
T
A
57.64
C
50.44
D
55.89
E
37.14
F
92.65
G
61.00
H
82.47
I
71.71
K
79.30
L
81.03
M
89.29
N
84.60
P
37.06
Q
81.19
R
82.14
S
83.15
V
74.98
W
80.75
Y
79.80
451
T
C
10.57
D
9.68
E
15.39
F
13.38
G
43.34
H
7.65
I
17.96
K
8.59
L
11.00
M
5.68
N
14.56
P
11.89
Q
8.63
R
4.46
S
13.08
T
2.10
V
4.99
W
15.25
Y
1.62
455
W
A
1.31
C
1.19
D
−6.13
E
19.68
F
−1.57
G
0.73
I
−2.70
K
6.91
L
19.08
M
19.92
N
19.10
P
14.76
Q
3.03
R
−14.86
S
8.05
T
19.75
V
10.66
Y
7.30
478
N
A
−11.71
C
−1.14
D
−3.08
F
30.35
G
8.29
H
−15.02
I
10.06
K
9.95
L
−3.27
P
30.98
Q
4.37
R
11.41
V
21.91
W
3.25
Y
4.98
479
W
C
13.20
D
6.12
E
11.20
F
1.41
G
1.34
H
6.90
I
1.50
K
5.54
L
7.80
M
5.47
N
2.20
P
7.07
Q
15.50
R
1.63
S
18.50
T
21.51
V
5.89
Y
8.63


TABLE 8
Gal2p positions and mutations identified in the GTAC screen are ordered on preference. SCORE TOP HIT is the RelXyl score
for the amino acid substitution within a position yielding the clearest improvement compared to wild-type Gal2p This allows
a sorting of the most influential mutations and relevant positions to target in Gal2p to eliminate glucose affinity.
GTAC
Mutations
SCORE TOP
Position
wt AA
Most preferred
Preferred
Least preferred
Inactive
HIT
Most preferred
376
N
FILMTV
ACHPSY
DEKQRW
99.46
449
T
FM
HIKLNQRSVWY
ACDEGP
92.65
383
S
CQRTWY
AEFKMN
DGILV
83.94
339
M
NQSV
AFGHKLRT
CDEIPY
W
83.73
226
Y
ACDMNR
EQ
GHILPSTW
KV
81.68
448
T
AM
CDEFGHIKLPQSVW
RY
77.64
342
Q
ACSWY
DFHKPT
EGILMNRV
76.45
380
T
AFMW
CDGIKLNPQRSV
Y
E
74.78
350
F
LR
NSTV
DKMQ
EHIY
57.58
214
Y
VW
LNQ
GMPRS
ACIK
55.48
338
Q
CEF
ADHILRW
GNPSTVY
M
52.66
219
T
AFG
CD
NS
EIKMQRW
52.55
373
G
L
ACDEMNPVWY
FHIKQRST
51.94
85
F
QTV
S
ACHMNP
DEGKR
50.51
Preferred
346
N
VWY
AHST
CDFGIKLMQR
E
47.09
341
Q
L
MT
NSY
DEHR
46.71
347
N
A
DEI
HL
GKQRSTV
44.64
451
A
G
CDEFILNPSW
HKMQRTVY
43.34
89
T
DHV
ACL
N
FIKMQRSY
41.06
343
L
K
PRSY
ACDEFGHIMNQTW
V
40.15
444
F
AILVY
HK
CDEGMNPQSTW
R
39.43
446
F
Q
HLMN
DEI
KRSTV
34.25
478
N
FP
V
GIKQRWY
ACDHL
30.98
Least preferred
218
I
KNS
AHL
CDEGMV
RTW
27.86
187
V
A
CFGQT
DEHIKLMRSWY
26.84
215
Q
LM
CDF
AIS
GHNVWY
24.63
479
W
QST
CE
DFGHIKLMNPRVY
21.51
222
I
D
ACH
EGMPSVY
KTW
20.91
191
A
N
DGIPT
CFHKQSVWY
ELMR
20.35
455
W
ELMNT
PV
ACGKQSY
DFIR
19.92

The most prominent mutations were found at position 376 when the wild-type amino acid Asn was exchanged for amino acids with large hydrophobic side chains such as Phe, Ile, Leu, Met, Thr, or Val; these variants facilitated clear growth and almost full xylose consumption and almost no transport activity for glucose in the GTAC screen (FIG. 8). We have found that advantageous amino acids at position 376 have a van der Waals volume of 85 to 138 Å3 and a hydrophobicity of 10 to 100 ΔtR or in an embodiment a van der Waals volume of 100 to 138 Å3 and a hydrophobicity of 10 to 100 ΔtR. A further important embodiment is specific amino acids at position 339, where we have found an amino acid that has a hydrophobicity of −30 to 10 ΔtR results in mutants with reduced glucose transport activity. This is illustrated by FIG. 11.

The values for van der Waals volume (Å3) for amino acids are herein used as described in: www.proteinsandproteomics.org/content/free/tables_1/t able08.pdf. The corresponding literature is N. J. Darby, Thomas E. Creighton, Protein Structure (1993) Oxford University Press. The values for hydrophobicity (ΔtR) of amino acids are herein used as described in onlinelibrary.wiley.com/doi/10.1002/psc.310010507/pdf. The reference corresponding to this is Monera, O. D. et al, Journal of Peptide Science 1995; 1(5):319-329.

Example 5: Xylose Transport Activity Screening

Aim.

Using the Xylose Transport Activity (XTA) screen, i.e. using hexose transporter-mutant strain RN1053 as host to introduce GAL2 variants and screening the resulting transformants on medium for growth on low xylose (1 g l−1) concentrations, mutations can be identified that increase the xylose transport activity in the Gal2p variant. Activity of transport can be defined by more than one parameter, for instance, the affinity of the transporter (expressed by the Michaelis constant, i.e. Km), or the rate of the transporter (expressed as Vmax). It is also possible that a mutation increases the expression of the tranporter, and thus improves xylose transport activity in the host cell.

Transformation and Colony Picking.

RN1053 was transformed with a total of 468 constructs, each one bearing a GAL2 mutant. One construct with wild-type GAL2 sequence (SEQ. ID58) was included as control. For each transformation, 1-3 colonies were re-plated to agar medium MTPs amounting to 1229 transformants. The 1229 transformants were screened in two parts. For each part of the screening, wild-type GAL2 was included as control.

Pre-Culture and Screen.

For the pre-culture, transformants resulting from automated transformation and colony picking were transferred by automated process from selection agar medium MTPs to 96HDWP containing in each well 250 μl Verduyn-urea supplemented with 2% maltose. After 3 days of pre-culture in an orbital shaker at 30° C. and 750 rpm, 5 μl of culture was transferred to three different 96HDWP containing 250 μl Verduyn-urea supplemented with 1 g l−1 xylose (RN01-medium), each 96 HDWP representing a sampling point. On each plate (24 DWP or 96 HDWP) at least one RN1001 growth control was inoculated to have an indication of plate-to-plate effects. After 24 hours, 72 hours and 96 hours a series of 96HDWPs was harvested for automated OD-measurement at 600 nm. For each construct and each time point the OD600 values for the different replicates was averaged. In order to compare the different parts of the screen, a relative value was calculated based on the difference to the wild-type OD600 value measured in the particular part of the XTA screen, according to the following formula:

RelOD600=(OD600Gal2-mutant-OD600Gal2-wildtype)OD600Gal2-wildtype×100%

Results.

In both parts of the XTA screen RN1001 is part of the TOP15 positions based on the growth profile compared to wild-type Gal2p; RN1001 has the full complement of hexose transporters and the presence of RN1001 in the TOP15 in both parts of the XTA Screen (FIG. 9), indicates that one or more endogenous hexose transporters in yeast facilitate high affinity xylose uptake in contrast with the wild-type Gal2 RN1053-transformants which displayed poorer growth profiles. The mutant variants with the single amino acid changes present in the TOP15 displayed an increased affinity to xylose compared to wild-type Gal2p and developed towards the RN1001 growth profile or even showed similar or improved growth characteristics on low xylose concentrations. Interestingly, when aligning amino acid sequences of the S. cerevisiae hexose transporter family, some of the Gal2p mutations found in the TOP15, e.g. N346D and M339S, are to be found in the wild-type sequences of Hxt2 (S324) and Hxt11 (D336 and S329), respectively. The comparison of all tested mutant GAL2 variants versus wild-type GAL2 on growth (average RelOD600) at 96 hours is listed in Table 8. All mutations with RelOD600>0 are proposed to have a positive effect on the xylose affinity.


TABLE 9
Average RelOD600 values for the screened Gal2p mutants in the XTA
Screen.
Wild-type GAL2 construct pDB1250 was set to 0.
RelOD600 values are the averages of
1-3 replicates and are relative values compared to wild-type.
Pos
wtAA
MutAA
RelOD600
85
F
A
−2.50
C
−1.81
D
−32.03
E
−37.55
G
−51.06
H
−35.08
K
−27.75
N
−6.14
P
−23.27
Q
−0.27
R
−18.30
S
7.30
T
−6.07
V
2.40
89
T
A
−1.12
C
19.39
E
−13.89
I
−20.86
K
−13.89
L
1.12
M
−9.48
N
−8.70
Q
−4.57
R
−10.12
V
3.11
W
−43.47
Y
0.01
187
V
A
−10.62
C
14.34
D
−5.07
E
−2.94
F
−6.14
G
14.77
H
−2.79
I
15.55
L
10.08
M
36.83
Q
26.77
R
−11.36
S
−28.01
T
−10.54
W
−17.20
Y
11.95
191
A
C
5.10
D
7.05
E
0.58
F
−1.81
G
−4.01
H
−12.93
I
10.13
K
7.11
M
−4.82
N
4.60
P
1.90
Q
−8.47
R
3.34
S
−19.15
T
−2.00
V
−9.91
W
4.10
Y
−15.24
214
Y
A
−3.04
C
−12.04
G
−6.92
I
−6.92
K
−4.15
L
6.02
M
−26.59
N
−9.60
P
5.35
Q
−26.44
R
−29.77
S
−37.90
W
−21.91
215
Q
A
1.54
C
5.92
D
25.93
E
20.81
F
3.28
I
−5.50
L
8.24
M
11.19
R
−48.74
S
16.66
V
−21.07
W
−39.22
Y
−24.30
218
I
A
−15.52
C
−13.03
D
−19.50
E
−15.31
G
−9.12
H
−9.12
K
−10.19
L
−15.45
M
−24.27
N
−23.20
R
−13.39
S
−13.60
T
−15.95
V
−4.00
W
40.30
219
T
A
−6.71
C
−20.53
D
−21.69
E
3.47
F
−17.01
G
−35.80
I
−47.23
L
3.78
M
−20.00
N
−13.93
P
−18.27
Q
−14.25
R
7.17
S
−18.08
V
11.19
W
−15.13
222
I
A
−7.91
C
−6.92
D
−12.54
E
−16.80
G
28.78
H
−13.50
K
−48.17
M
20.18
P
11.01
R
−0.62
S
3.03
T
10.25
V
−12.55
W
11.38
Y
23.82
226
Y
A
23.92
C
−6.78
D
−12.89
E
5.10
F
−28.04
G
−4.64
H
−11.26
I
−12.46
K
−10.55
M
24.16
N
−4.86
P
20.39
Q
0.33
R
−9.19
S
−5.78
T
23.80
W
−5.71
338
Q
A
4.10
C
10.88
D
7.99
E
3.59
F
0.45
G
5.29
H
11.63
I
12.95
L
0.58
M
4.79
N
14.12
P
2.21
R
15.03
S
−17.02
T
−26.76
V
−11.33
W
−6.92
Y
−17.30
339
M
A
28.42
C
20.32
D
−0.09
E
18.97
F
4.17
G
−20.00
H
−14.46
I
−17.55
K
−11.75
L
21.03
N
4.25
P
−4.64
Q
−3.65
R
−7.91
S
54.52
T
10.79
V
−11.90
W
6.56
Y
38.66
341
Q
D
−10.62
E
−8.13
H
2.89
K
−21.66
L
−22.79
M
−11.30
N
−13.31
R
−10.76
S
7.16
T
−3.08
V
18.89
Y
9.37
342
Q
A
−15.66
C
2.04
D
−12.54
E
−9.23
F
33.22
G
42.01
H
45.21
I
34.38
K
12.92
L
28.91
M
7.99
N
45.31
P
−7.15
R
44.36
S
22.25
T
20.62
V
−16.07
W
32.62
Y
−21.41
343
L
A
15.98
C
7.16
D
−12.82
E
9.65
F
−6.07
G
−6.63
H
−9.83
I
19.04
K
2.40
M
−0.73
N
0.97
P
4.53
Q
19.53
R
−10.62
S
10.72
T
−6.46
W
0.69
Y
29.99
346
N
A
26.36
C
15.73
D
69.10
F
10.15
G
24.01
H
−4.93
I
0.76
K
−1.66
P
−0.80
Q
−5.28
R
−7.84
V
−44.97
Y
−3.51
347
N
D
5.29
E
−24.11
G
7.59
H
−4.57
I
−3.08
K
9.65
L
14.52
Q
6.55
R
−1.93
S
18.92
T
2.61
V
6.09
350
Y
D
−2.08
E
39.52
I
−28.19
L
33.56
M
7.09
Q
6.95
R
−40.48
S
7.93
T
−6.33
V
−15.81
Y
−9.27
373
G
A
−51.50
E
−50.72
F
−47.17
H
−37.99
I
2.84
K
15.40
L
18.36
M
14.21
N
21.06
Q
14.02
R
32.18
S
18.92
T
−11.04
V
−6.71
W
−5.20
Y
1.21
376
N
A
10.19
C
24.67
D
8.93
E
10.19
F
−13.02
H
−13.78
I
14.59
K
47.76
L
−9.63
M
6.29
P
29.04
Q
35.51
R
−23.42
S
44.42
V
−42.40
W
−15.74
Y
−21.28
380
T
A
3.56
C
8.37
D
24.95
E
14.21
F
−17.33
G
29.22
I
20.81
K
14.34
L
23.45
M
29.16
N
−50.25
P
−7.46
Q
−15.32
R
−0.55
S
−6.02
V
−6.21
W
14.78
Y
29.48
383
S
A
16.05
C
3.32
D
−2.94
E
1.97
F
−15.10
G
−4.50
I
2.40
K
−47.86
L
3.59
M
−2.56
N
−44.72
Q
14.40
R
21.37
T
−28.26
V
24.58
W
26.71
Y
27.84
444
F
C
−6.49
D
−2.08
E
−16.16
G
1.54
H
−16.38
I
−20.29
K
−24.06
L
−10.19
M
−7.20
N
−9.76
P
−18.79
Q
−27.18
S
−14.45602
W
−16.94
Y
−18.08
446
F
D
19.61
E
−36.17
H
30.98
I
0.83
L
−40.55
M
−2.58
N
−10.90
Q
−35.54
R
−37.62
S
−2.94
T
−39.41
V
−47.79
448
T
A
10.57
C
0.08
D
15.78
E
19.55
F
−6.65
G
16.91
H
25.64
I
−0.18
K
26.65
L
22.31
M
0.77
P
12.58
Q
14.08
R
29.22
S
11.19
V
W
8.09
Y
−2.01
449
T
A
4.67
C
6.59
D
−2.58
E
−2.08
F
16.48
G
11.00
H
16.26
I
9.51
K
−3.51
L
11.29
M
−15.59
N
−7.13
P
8.73
Q
13.21
R
−10.33
S
15.48
V
14.41
W
−5.78
Y
−5.57
451
T
C
−33.23
D
−23.20
F
−4.75
G
−16.94
H
−41.76
I
−40.26
K
−8.91
L
−23.73
N
−6.07
P
−6.14
Q
−8.22
R
−6.21
S
2.90
T
−11.42
V
−5.89
W
4.10
Y
3.91
455
W
C
−14.75
D
8.18
E
4.22
F
−2.31
G
−10.67
I
5.45
K
8.12
L
−5.96
M
6.39
N
−9.22
P
0.83
Q
0.95
R
−48.55
S
−4.82
T
−9.44
V
−2.06
Y
−19.81
478
N
A
−25.74
C
−14.75
D
−9.91
F
6.86
G
0.01
H
−13.12
I
8.81
K
−24.30
P
−20.47
Q
14.40
R
−27.44
W
−13.40
Y
6.77
479
W
C
−12.96
D
15.20
E
18.40
F
24.87
H
1.83
I
48.83
K
8.58
L
−3.79
M
7.87
N
8.05
P
−42.40
Q
−33.73
R
13.42
S
57.22
T
15.48
V
−12.54
Y
12.07


TABLE 10
Gal2p positions and mutations identified in the XTA screening are ordered on preference. SCORE
TOP HIT is the RelXyl score for the amino acid substitution within a position yielding the clearest
improvement compared to wild-type Gal2p This allows a sorting of the most influential mutations
and relevant positions to target in Gal2p to increase xylose transport activity.
XTA
Mutations
SCORE
Position
wt AA
Most preferred
Preferred
Least preferred
Inactive
TOP HIT
Most Preferred
346
N
D
AG
CF
HIKPQRVY
69.10
479
W
S
I
DEFHKMNRTY
CLPQV
57.22
339
M
SY
ACEL
FNTW
DGHIKPQRV
54.52
342
Q
GHNR
FILW
CKMST
ADEPVY
47.76
376
N
KS
CPQ
ADEIM
FHLRVWY
47.76
Preferred
218
I
W
ACDEGHKLMNRSTV
40.30
350
F
E
L
MQS
DIRTVY
39.52
187
V
MQ
CGI
LY
ADEFHRSTW
36.83
373
G
R
KLMNQS
IY
AEFHTVW
32.18
446
F
H
D
EILMNQRSTV
30.98
Least preferred
343
L
Y
AIQ
CEKSP
DFGHMNRTW
29.99
380
T
GMY
DIL
ACEKW
FNPQRSV
29.48
448
T
HKR
EL
ADGPQSW
MCFIVY
29.22
222
I
G
MY
PTW
ACDEHKRSV
28.78
383
S
VWY
AQR
CEIL
DFGKMNT
27.84
215
Q
DE
S
ACFL
IMRVWY
25.93
226
Y
AMPT
E
CDFGHIKNQRSW
24.16
89
T
C
LVY
AEIKMNQRW
19.39
347
N
S
KL
DGQTV
EHIR
18.92
449
T
FH
QSV
ACGILP
DEKMNRWY
16.48
338
Q
NR
CDHI
AEFGLMP
STVWY
15.03
478
N
Q
FIY
ACDGHKPRW
14.40
191
A
I
DK
CENPRW
FGHMQSTVY
10.13
341
Q
V
SY
H
DEKLMNRT
9.37
455
W
DK
EIM
CFGLNPQRSTVY
8.18
85
F
S
V
ACDEGHKNPQRT
7.30
219
T
V
R
EL
ACDFGIMNPQSW
7.17
214
Y
LP
ACGIKMNQRSW
6.02
451
A
WY
S
CDFGHIKLNPQRTV
4.10
444
F
G
CDEHIKLMNPQSWY
1.54

Examples 6 to 15

Methods

Molecular Biology Techniques and Chemicals.

Restriction enzymes and T4 DNA ligase were acquired from Fermentas (Fisher Scientific, Landsmeer, the Netherlands). Primers used in the studies (SEQ ID NO: 1-55) are indicated in Table 11. Standard molecular biology and yeast genetics techniques were conducted according to textbooks including Sambrook et al. (2001; Molecular cloning: a laboratory manual, third edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., N.Y., USA) and Ausubel et al. (1995; Current Protocols in Molecular Biology).

PCR Amplification and Cloning.

For PCR amplifications, Phusion® High-Fidelity PCR Master Mix with HF buffer was used (Finnzymes; Fisher Scientific, Landsmeer, the Netherlands). Primers used for cloning and sequencing are indicated in Table 11 (SEQ ID NO: 37-55). HXT2, HXT3-6, and HXT11 PCR fragments were cloned into the yeast expression vector pRS313-P7T7 (SEQ ID NO 56), based on the shuttle vector pRS313 (Sikorski & Hieter, 1989, A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics, 122, pp. 19-27). Construct pRS313-P7T7 bears the truncated HXT7 promoter (Hauf et al, 2000, Simultaneous genomic overexpression of seven glycolytic enzymes in the yeast Saccharomyces cerevisiae. Enzyme Microb Technol, 26:688-698) and the HXT7 terminator. In between the promoter and the terminator, a multiple cloning site (MCS) exists. Resulting PCR fragments, were digested by restriction enzyme combinations (as further indicated in the Examples below) and cloned by standard molecular biology techniques into the yeast expression vector. HXT11 was also cloned into pRS313-P7T7-GFP (resulting in SEQ ID NO: 57) for localization studies of the GFP-tagged Hxt11 protein using fluorescence microscopy (Example 5). pDB1250 contained the GAL2 ORF (SEQ ID NO:60) between the truncated HXT7 promoter and the ADH1 terminator (for reference of sequence pDB1250 see SEQ ID NO: 58. Plasmids were amplified and maintained in DH5α cells following manufacturer's instructions. Plasmids were isolated from E. coli mini cultures using the GeneElute plasmid Miniprep kit (Sigma-Aldrich, Zwijndrecht, the Netherlands). Gene/Protein sequences and constructs used and generated during these studies are listed in Table 12.


TABLE 11
oligonucleotides used in the examples
SEQ
ID
Name
Sequence (5′→3′)
purpose
NO
ActinF
GGATTCTGAGGTTGCTGCTTTGG
Real time
 62
PCR
ActinR
GAGCTTCATCACCAACGTAGGAG
Real time
 63
PCR
HXT1F
TGTTCTCTGTACACCGTTGACCG
Real time
 64
PCR
HXT1R
AGATCATACAGTTACCAGCACCC
Real time
 65
PCR
HXT2F
CTTCGCATCCACTTTCGTG
Real time
 66
PCR
HXT2R
AATCATGACGTTACCGGCAGCC
Real time
 67
PCR
HXT3F
GAAGCTAGAGCTGCTGGTTCAGC
Real time
 68
PCR
HXT3R
ACAACGACATAAGGAATTGGAGCC
Real time
 69
PCR
HXT4F
ATGGAGAGTTCCATTAGGTCTAGG
Real time
 70
PCR
HXT4R
ATAACAGCTGGATCGTCTGCGC
Real time
 71
PCR
HXT5F
TTGCTATGTCGTCTATGCCTCTG
Real time
 72
PCR
HXT5R
AGATAAGGACATAGGCAACGGG
Real time
 73
PCR
HXT7F
GGGTGCTGCATCCATGACTGC
Real time
 74
PCR
HXT7R
ACAACGACATAAGGAATTGGAGCC
Real time
 75
PCR
HXT8F
GTACTACTATCTTCAAATCTGTCGG
Real time
 76
PCR
HXT8R
CTTGTGACGCCAACGGAGGCG
Real time
 77
PCR
HXT9F
CCATTGAGAGGTTTGGACGCCG
Real time
 78
PCR
HXT9R
ACACAATCATACAGTTACCGGCG
Real time
 79
PCR
HXT10F
GGAATGCAAGACTCTTTCGAGAC
Real time
 80
PCR
HXT10R
CTAGTGACGCCAACGGTGGCG
Real time
 81
PCR
HXT11F
GCCACTCAATGGAGAGTCGGC
Real time
 82
PCR
HXT11R
CAACTAGCAAGGCTGGATCGTC
Real time
 83
PCR
HXT12F
CACCATCTTCAAATCTGTCGGTC
Real time
 84
PCR
HXT12R
CAATCATACAGTTACCGGCACCC
Real time
 85
PCR
HXT13F
CCCTCATGGCCAGGACGGTC
Real time
 86
PCR
HXT13R
TTGCCATAACCAGTTGCATGCAG
Real time
 87
PCR
HXT14F
GCCTTAGTAGTGTACTGCATCGGT
Real time
 88
PCR
HXT14R
TGATACGTAGATACCATGGAGCC
Real time
 89
PCR
HXT15F
GAGGCCTGTGTCTCCATCGCC
Real time
 90
PCR
HXT15R
CACAAGAATACCTGTGATCAAACG
Real time
 91
PCR
HXT16F
CAAGGAAGTATAGTAATACTGCGC
Real time
 92
PCR
HXT16R
TTGGCGATGGAGACACAGGCC
Real time
 93
PCR
HXT17F
TAACACTGCACAATGGAGAGTCC
Real time
 94
PCR
HXT17R
TGAGTACCCATGGATCCTCTGG
Real time
 95
PCR
GAL2F
TCAATGGAGAGTTCCATTAGGGC
Real time
 96
PCR
GAL2R
CTGGACGGCAGGATCCTCTGG
Real time
 97
PCR
KOP11*
AATAATCATTGCACAATTTAGTTCTAAACGCTTTTGTTA
KO
 98
TTACTCAATATCCGTTTTAAGAGCTTGGTGAGCGCTAG
HXT11
KOT11*
TCGTCAATTTTTTTTTTTGCTTTTTTACCAATTTACCGA
KO
 99
AAACTAGAAGAGAGTTCAAGAGAAAAAAAAAGAAAAA
HXT11
iHXT11F
GGCCTCTAGATCAGCTGGAAAAGAACCTCTTGTAAAT
Inverse
100
TG
HXT11
iHXT11R
GCTAGGATCCATGTCAGGTGTTAATAATACATCCGCA
Inverse
101
AATG
HXT11
HXT11F
GGCCTCTAGAATGTCAGGTGTTAATAATACATCCGC
Cloning
102
HXT12F
GGCCTCTAGAATGGGTTTGATTGTCTCAATATTCAAC
Cloning
103
HXT11/12R
CGATGGATCCTCAGCTGGAAAAGAACCTCTTGTAAAT
cloning
104
TG
HXT1
GCATTCTAGAATGAATTCAACTCCCGATCTAATATC
cloning
105
XbaI
R HXT1
TGCATCCCGGGTTATTTCCTGCTAAACAAACTCTTGTA
cloning
106
Cfr9i
F HXT2
GTCCTCTAGAATGTCTGAATTCGCTACTAGCCG
cloning
107
Xbai
R HXT2
CATCGCCCGGGTTATTCCTCGGAAACTCTTTTTTCTTT
cloning
108
Cfr9i
TG
F HXT3
GCATTCTAGAATGAATTCAACTCCAGATTTAATATCTC
cloning
109
XbaI
R HXT6
CATCGCCCGGGTTATTTGGTGCTGAACATTCTCTTG
cloning
110
Cfr9I
F HXT4
GTCCTCTAGAATGTCTGAAGAAGCTGCCTATCAAG
cloning
111
XbaI
R
TATCGCCCGGGTTAATTAACTGACCTACTTTTTTCCGA
cloning
112
HXT4RN
Cfr9I
F HXT5
GTCCTCTAGAATGTCGGAACTTGAAAACGCTCATC
cloning
113
XbaI
R HXT5
GCATCCCGGGTTATTTTTCTTTAGTGAACATCCTTTTA
cloning
114
Cfr9I
TA
F HXT7
GTCCTCTAGAATGTCACAAGACGCTGCTATTGCA
cloning
115
XbaI
R HXT7
CATCGCCCGGGTTATTTGGTGCTGAACATTCTCTTG
cloning
116
Cfr9I
*In italics the HXT11 flanking sequence, and underlined the HIS3 sequence

RNA Extraction and cDNA Synthesis.

Total RNA was isolated from yeast cells in exponential phase by a glass-bead disruption/Trizol extraction procedure. Yeast pellets from 2 ml of cell culture were mixed with 0.2 ml of glass beads (diameter, 0.45 mm) and 0.9 ml of Trizol with 125 μl chloroform, and disrupted in a Fastprep FP120 (Bio-101, Thermo Savant, Calif., USA) by a 45-second burst at speed 6. 1 μg of total RNA was used to synthesize cDNA using the iScript Kit (Bio-Rad, Veenendaal, the Netherlands).

Real-Time PCR.

The HXT1-HXT17 and GAL2-specific real-time PCRs were performed, respectively, using SensiMix SYBR & Fluorescein kit (GC Biotech, Alphen aan den Rijn, the Netherlands) and the MyiQ iCYCLER Real Time PCR instrument (BIO-Rad, Veenendaal, the Netherlands). Each 25-μl reaction contained 12.5 μl of SYBR green Master Mix, 4 μl cDNA, 0.5 μl of each primer (10 nM) and 7.5 μl of sterile deionized water. The PCR conditions were 10 min at 95° C. followed by 39 cycles of amplification (15 sec at 95° C., 30 sec at 60° C., 30 sec at 72° C.). The primers shown in Table 11 were utilized to amplify the cDNA fragments by PCR amplification (SEQ ID NO's 1-36).

Error Prone PCR.

Error-prone PCR experiments were performed following the indications provided by the DNA Taq polymerase (Thermo Fischer) using 10 ng of template in 100 μl of PCR mix containing 5.5 mM MgCl2 and 0.15 mM MnCl2.

Strain Maintenance, Cultivation and Evolutionary Engineering.

Strains generated in these studies are listed in Table 13. For storage of the strains used in this work (Table 2), shake flask cultures were performed in rich medium (YP), consisting of 10 g l−1 yeast extract (Oxoid) and 20 g l−1 peptone (BD Difco), supplemented with either 2% glucose (YPD), 2% maltose (YPM; in case of RN1053-derivatives), or 3% xylose (YPX; in case of YD01227-derivatives). Cultures were maintained at 30° C. in an orbital shaker until cultures reached stationary growth phase. After adding glycerol to 30% (v/v), samples from shake-flask cultures were stored in 2 ml aliquots at −80° C.

For strain characterizations and evolutionary engineering, cultivations were conducted using mineral medium according to Verduyn using urea as nitrogen source (Verduyn-urea Luttik et al, 2001, J Bacteriol, 182:501-517) at pH 4.5 supplemented with the desired sugar (mixtures). In cultures of the model strains RN1053 or YD01227, Verduyn-urea was supplemented with 0.2 g l−1 histidine (Sigma-Aldrich; Verduyn-urea-his) to complement for the histidine auxotrophy.

Cultivations of strains for characterization of growth and sugar consumption profiles were conducted in shake flasks, a Bioscreen C reader using honeycomb well plates (Growth Curves Ltd, represented by Thermo Fisher Scientific BV, Breda, the Netherlands). Cultures were maintained at a temperature of 30° C. Specifically for the purpose of evolutionary engineering, chemostat cultures were grown in a 3 L stirred tank bioreactor (Applikon, Schiedam, the Netherlands) filled with 500 ml of Verduyn-urea-his supplemented with the required carbon sources at a temperature of 30° C. Starting Dissolved Oxygen (DO) setpoint was 5%, stirring was performed at 400 rpm and the starting OD600 was 0.2.


TABLE 12
plasmids and gene/protein sequences
Sequence
SEQ ID NO or
Plasmid/gene/protein
type
reference
Example
pRS313-P7T7 (empty vector
Artificial
117
7, 8, 9, 10, 11,
control)
DNA
13, 15 
pRS313-P7TA-GAL2
Articifial
12
(pDB1250)
DNA
pRS313-P7T7-iHXT11
Articifial
 7
DNA
pRS313-P7T7-HXT11
Articifial
8, 9, 10
DNA
pRS313-P7T7-HXT12
Articifial
 8
DNA
pRS313-P7T7-HXT2
Articifial
9, 10
DNA
pRS313-P7T7-HXT11-GFP
Articifial
118
10
DNA
pRS313-P7T7-
Articifial
11
mHXT11(N366D)
DNA
pRS313-P7T7-HXT36
Articifial
15
DNA
pRS313-P7T7-mHXT36(N367I)
Articifial
15
DNA
HXT11
DNA S. cerevisiae
119
7, 8, 9, 10, 11,
12
HXT2
DNA S. cerevisiae
120
9, 10
GAL2
DNA S. cerevisiae
121
12
HXT3-6
DNA S. cerevisiae
122
15
Hxt11p
Protein, S. Cerevisiae
123
7, 8, 9, 10, 11,
12
Hxt2p
Protein, S. Cerevisiae
124
 9
Gal2p
Protein, S. Cerevisiae
125
10
Hxt36p
Protein, S. Cerevisiae
126
15


TABLE 13
Strains used or prepared herein
Strain
Genotype
Example
RN1001
Mat a, ura3-52, leu2-112, gre3::loxP, loxP-
10
Ptpi:TAL1, loxP-Ptpi::RKI1, loxP-Ptpi-TKL1,
loxP-Ptpi-RPE1, delta::Padh1XKS1Tcyc1-
LEU2, delta::URA3-Ptpi-xylA-Tcyc1
RN1014
RN1001 + in vivo engineering on xylose and
Reference
acetic acid
RN1041
RN1001 his3::loxP
WO2013081456
RN1041-empty
RN1041, pRS313-P7T7 (empty vector control)
 8, 11
RN1053
RN1041 hxt2::loxP-kanMX-loxP, hxt367::loxP-
6, 7
hphMX-loxP, hxt145::loxP-natMX-loxP,
gal2::loxP-zeoMX-loxP
RN1053-X2
RN1053 single colony selected on YPX after
6, 7
chemostat evolutionary engineering on 2%
xylose
RN1053-X2-
RN1053-X2, hxt11::HIS3
 7
hxt11Δ
RN1053-empty
RN1053, pRS313-P7T7 (empty vector control)
8, 9, 10, 15
RN1053-HXT2
RN1053, pRS313-P7T7-HXT2
 9
RN1053-HXT3-6
RN1053, pRS13-P7T7-HXT3-6
15
RN1053-mHXT3-
RN1053, pRS13-P7T7-mHXT3-6(N367I)
15
6(N367I)
RN1053-HXT11
RN1053, pRS13-P7T7-HXT11
8, 9, 10, 11, 13
RN1053-mHXT11-
RN1053, pRS313-P7T7-mHXT11(N366D)
13
N366D
RN1053-iHXT11
RN1053-pRS313-P7T7-iHXT11
 7
RN1053-HXT11-
RN1053, pRS313-P7T7-HXT11-GFP
10
GFP
RN1053-HXT12
RN1053, pRS13-P7T7-HXT12
 8
YD01227 (ori)
RN1014 glk1::lox72; hxk1::loxP; hxk2::lox72;
14
gal1::loxP; his3::loxPnatMXlox P
YD01227-evoA, -
YD01227, three single colonies selected on
14
B, and -C
plates with 1% xylose + 10% glucose after
chemostat evolutionary engineering runs (see
Example 14)
YD01227-empty
YD01227, pRS313-P7T7 (empty vector control)
13
YD01227-HXT2
YD01227, pDB1162 (pRS313-P7T7-HXT2)
12
YD01227-GAL2
YD01227, pDB1250 (pRS313-P7TA-GAL2)
12
YD01227-HXT11
YD01227, pDB1152 (pRS313-P7T7-HXT11)
12, 13
YD01227-
YD01227, pRS313-P7T7-mHXT11(N366D)
13
mHXT11(N366D)

Analytical Methods.

Cell growth was monitored by optical density (OD) at 600 nm using UV-visible spectrophotometer (Novaspec PLUS). The concentrations of glucose, xylose, ethanol were measured in supernatant of cultures (separated from cell pellet after centrifugation at 4000 rpm for 5 min) by High Performance Liquid Chromatography (Shimadzu, Kyoto, Japan) using an Aminex HPX-87H column (Bio-Rad) and a refractive index detector (Shimadzu, Kyoto, Japan). The temperature of the column and detector was maintained at 65° C. The mobile phase was 0.005 N H2SO4 at a flow rate of 0.55 ml/min.

Sugar Uptake Measurement.

The uptake of radio-labeled xylose was measured as follows: the cells were grown for 24 hours in shake flasks in Verduyn-urea supplemented with 2% xylose and 0.05% maltose and were collected by centrifugation (3,000 rpm, 3 min, 20° C.), washed and re-suspended in Verduyn-urea. [14C] xylose or [14C] glucose (CAMPRO scientific, Veenendaal, the Netherlands stocks were added to the cell suspension. The reaction was stopped, for xylose after 1 minute and for glucose after 15 seconds, by addition of 5 ml of 0.1M lithium chloride, and the cell suspension was filtered (0.45 μm HV membrane filter, Millipore, France). The filters were washed with another 5 ml of lithium chloride and counted with Liquid Scintillation Counter in the emulsifier scintillator plus (Perkin-Elmer, USA). Uptake experiments for YD01227-ori and YD01227-evo were done with 0.5, 2, 6, 20, 40 mM xylose or 0.1, 0.4, 1.5, 6, 20, 80 mM glucose. Glucose competition studies for RN1053-HXT3-6 and RN1053-mHXT3-6(N367I), RN1053-HXT11 and RN1053-mHXT11 (N366D) were performed with [14C] xylose stock and with unlabeled glucose. The final xylose and glucose concentrations were 50 mM and 50-500 mM, respectively.

Fluorescence Microscopy.

Plasmid pRS313-P7T7-HXT11-GFP (SEQ ID NO 57) was transformed into strain RN1053 and RN1041. Fresh colonies were inoculated into minimal medium with xylose or glucose. A fresh liquid cell culture taken in exponential growth phase (at an optical density of 10 at 600 nm) was subjected to fluorescence microscopy under a Nikon Eclipse-Ti microscope equipped with a 100× oil immersion objective, a filter set for GFP, and a Nikon DS-5Mc cooled camera. We routinely examined at least 100 cells per sample, and each experiment was replicated at least three times.

Automated Transformation and Colony Picking.

For the generation of transformation of a saturation mutagenesis library into YD01227, shake-flask cultures were performed in either YPM for RN1053, or YPX for YD01227 (see below). Yeast cells were pelleted and, subsequently, used in an automated transformation protocol based on Gietz, R. D. and Woods, R. A. (Gietz, R. D. and Woods, R. A. 2006, Yeast transformation by the LiAc/SS Carrier DNA/PEG method. Methods Mol. Biol., 313:107-120). Transformation mixtures were plated on selection medium consisting of yeast nitrogen base (Sigma-Aldrich; 6.7 g l-1), agar (BD Biosciences; 15 g l−1), supplemented with either 2% maltose (RN1053 transformations) or 3% xylose (YD01227 transformations). Transformation plates were incubated at 30° C., and after colony formation, colonies were re-plated using an automated process transferring colonies to 96 well microtiter plates (MTP) containing the above-referred selection media. MTPs with transformants were incubated at 30° C. until clear growth was observed.

NMR Analysis.

For the quantification of glucose, xylose, glycerol, acetic acid and ethanol in the sample, 100 μl sample is transferred accurately into a suitable vial. Subsequently 100 μl internal standard solution, containing maleic acid (20 g/l), EDTA (40 g/l) and trace amounts of DSS (4,4-dimethyl-4-silapentane-1-sulfonic acid) in D2O, and 450 μL D2O is added.

1D 1H NMR spectra are recorded on a Bruker Avance III 700 MHz, equipped with a cryo-probe, using a pulse program with water suppression (power corresponding to 3 Hz) at a temperature of 27° C.

The analyte concentrations are calculated based on the following signals (δ relative to DSS):

    • α-glucose peak at 5.22 ppm (d, 0.38 H, J=4 Hz),
    • α-xylose peak at 5.18 ppm (d, 0.37 H, J=4 Hz),
    • glycerol peak at 3.55 ppm (dd, 2H, J1,2=6 Hz and 0.1 J1a,1b=12 Hz)
    • acetic acid peak at 1.91 ppm (s, 3H)
    • ethanol peak at 1.17 ppm (t, 3H, J=7 Hz)
    • The signal user for the standard:
    • Maleic acid peak at 6.05 ppm (s, 2H)

Example 6

Elevated Expression of S. Cerevisiae Hxt11 in Evolved Xylose Transport-Negative Strain with Restored Ability to Grow on Xylose

RN1053 Chemostat Culture.

Uptake of xylose in Saccharomyces cerevisiae is facilitated by a distinct subgroup of hexose transporters (Hamacher et al, 2002, Characterization of the xylose-transporting properties of yeast hexose transporters and their influence on xylose utilization. Microbiology, 148: 2783-2788). We have constructed a deletion mutant with xylose-fermenting capabilities (RN1053) which lacks the major hexose transporters HXT1-HXT7 and GAL2. As a result of the deletions, RN1053 is not able to utilize xylose (as described in Example 1). Saccharomyces cerevisiae possesses more HXT genes than the eight major ones (HXT8-17) of which not much is known rather than their expression is low or negligible (Sedlak & Ho, 2004, Characterization of the effectiveness of hexose transporters for transporting xylose during glucose and xylose co-fermentation by a recombinant Saccharomyces yeast. Yeast, 21, pp. 671-684) or that they have been connected to physiological roles other than sugar transport (Nourani et al 1997 Multiple-drug-resistance phenomenon in the yeast Saccharomyces cerevisiae: involvement of two hexose transporters. Mol Cell Biol, 17: 5453-5460). Therefore we refer to them as the cryptic HXT genes. An attempt was made to select for possible spontaneous mutations in cryptic HXT loci resulting in improved expression or possibly improved affinity for xylose. In order to do so, strain RN1053 was grown in an anaerobic, xylose-limited chemostat culture at a dilution rate of 0.05 h-1. The evolved strains by chemostat cultivation, RN1053-X2, was isolated on 2% xylose plate. A single colony was selected for cultivation in aerobic shake-flask on Verduyn-urea-his supplemented with 2% xylose for 96 h for comparison to the original RN1053 strain. The growth curves of RN1053-X2 and RN1053 strain were represented in FIG. 12A. The evolved strain RN1053-X2 was able to grow on 2% xylose, whereas the original strain RN1053 did not grow on the xylose medium. A reason could be that one or more of the cryptic HXT-genes (HXT8-HXT17) was up-regulated on xylose medium during the chemostat culture facilitating the uptake of xylose.

Expression Profiling Evolved RN1053-X2.

The expression patterns of HXT8-HXT17 in the evolved strain RN1053-X2 and original strain RN1053 were compared during batch cultivations on 2% xylose medium. The transcription level of HXT11 and HXT12 were dramatically increased by up to 8-fold in the evolved strain RN1053-X2 from the beginning of exponential phase (FIG. 12B) and reached a maximum level at day 3, compared to original strain RN1053. The chemostat was effective for the evolution of mutants to enhance xylose consumption by expressing HXT11 and/or HXT12 transporter genes in strain RN1053. However, expression level of other HXT-genes (i.e. HXT8-HXT10, and HXT13-HXT17) were repressed on xylose medium, compared to wild-type of RN1053.

The first limiting step of xylose metabolism is its transport across the plasma membrane (Kahar P, Taku K, Tanaka S, 2011. Enhancement of xylose uptake in 2-deoxyglucose tolerant mutant of Saccharomyces cerevisiae. J. Biosci. Bioeng. 111:557-63). It was reported that expression of HXT transporter genes of S. cerevisiae was regulated in response to different levels of extracellular glucose (Ozcan & Johnston, 1999. Function and regulation of yeast hexose transporters. Microbiol. Mol. Biol. Rev. 63:554-569). Possibly, mutations in the promoters or regulatory genes are the basis of enhanced expression of the cryptic HXT genes in the RN1053-X2 strain evolved in the chemostat culture on xylose.

Example 7

Knocking Out/Down Hxt11 in Evolved Rn1053 Abolishes Newly Acquired Ability to Grow on Xylose

Knockout and silencing of HXT11 in the strain RN1053-X2. For the deletion construct of HXT11, PHIS3-HIS3-THIS3 expression cassette was amplified from the plasmid template pRS313-P7T7 (SEQ ID NO 117) using oligonucleotides KOP11 (SEQ ID NO 98) and KOT11 (SEQ ID NO 99) consisting of HXT11 flanking sequences for integration at HXT11 locus and HIS3 sequence to amplify the expression cassette.

In order to determine whether Hxt11p was responsible for the spontaneous growth on xylose, we deleted HXT11 in the evolved strain RN1053-X2 by succession of one-step gene deletion complementing for the HIS3 marker upon deletion of HXT11. HXT11 mRNA levels decreased considerably after knockout construct was introduced (FIG. 13a). When HXT11 was disrupted in the strain RN1053-X2, the strain lost its newly acquired ability to grow on xylose medium (FIG. 13b). In addition, the HXT11 expression level of knockout strains decreased to 60%. Most probably, still HXT11 levels were measured since also expressed HXT12 transcripts in the RN1053-X2 strain are about 98% homologous to HXT11 (FIG. 13a).

Antisense RNA technique is very useful for the repression of translation of a target protein by scavenging target mRNA in microorganisms. Translation repression can be promoted by antisense sequences that hybridize to messenger RNA. The antisense mechanism involves ribosome interference, in which the ribosome cannot bind to the nucleotides of the mRNA (Park et al 2001. Antisense-mediated inhibition of arginase [CAR1] gene expression in Saccharomyces cerevisiae. J. Biosci. Bioeng. 92:481-484). This method is more convenient for inhibiting gene expression than the gene disruption method. For expression of inverse HXT11 (iHXT11), iHXT11 was amplified using primers iHXT11F (SEQ ID NO: 100) and iHXT11R (SEQ ID NO: 101) and cloned as BamHI-XbaI fragment inversely between the truncated HXT7 promoter and HXT7 terminator in the pRS313-P7T7 vector (FIG. 13c; SEQ ID NO: 117). The construct was introduced into RN1053-X2 to express antisense HXT11 RNA which hinders the translation of HXT11 mRNA into protein. The iHXT11 was overexpressed in the strain RN1053-X2, and the strain lost its ability to grow on xylose medium (FIG. 13d).

These knock-out/knock-down experiments clearly indicate that the evolved strain RN1053-X2 started to consume xylose due to the increase in HXT11 expression and the probable functional expression of Hxt11p on the yeast membrane.

Example 8

Overexpressing Hxt11 in Rn1053 Restores Growth on Xylose

Over-Expression HXT11 and HXT12 in RN1053.

To determine whether strains expressing HXT11 or HXT12 are capable of growth on xylose, both HXT-genes were expressed individually in the original RN1053 strain which is incapable to grow on xylose because of the deletion of the eight major hexose transporters (HXT1-HXT7 and GAL2). For these experiments RN1041-empty, RN1053-empty, RN1053-HXT11 and RN1053-HXT12 were used (see Table 13). RN1053-HXT11 and RN1053 HXT12 were constructed in the following manner: the open-reading frames for the HXT11 and HXT12 genes were PCR-amplified from cDNA of the wild-type RN1053 using primers HXT11F (SEQ ID NO: 102), HXT12F (SEQ ID NO: 103) and HXT11/12R (SEQ ID NO: 104); PCR fragments were sequenced and were found 100% homologous to the respective CEN.PK113-7D gene sequences (Saccharomyces Genome Database, www.yeastgenome.org; HXT11 sequence SEQ ID NO; 119); the PCR fragments were cut using restriction enzymes XbaI and BamHI and cloned in yeast expression vector pRS313-P7T7 (SEQ ID NO: 117; FIG. 13C; Table 12). The HXT11 and HXT12 expression construct of the transporters were transformed into RN1053 using a standard yeast genetic technique according to the Gietz method (Gietz and Woods 2006, Yeast transformation by the LiAc/SS Carrier DNA/PEG method. Methods Mol. Biol 313 pp. 107-120). Transformants isolated from single colonies resulted in strains RN1053-HXT11 and RN1053-HXT12. Both strains were inoculated into maltose medium, followed by cultures in shake flask on liquid media containing 2% xylose and/or 2% glucose. Only RN1053-HXT11 and RN1041 displayed clear growth within 48 hours, whereas RN1053-empty and RN1053-HXT12 displayed hardly any growth in this period (FIG. 14a). The growth of RN1053-HXT11 started earlier and displayed faster growth than that of reference strain RN1041-empty (with wild-type HXT background) in xylose medium (FIG. 14b). However, the introduction of HXT12 sequence in RN1053 did not allow growth on xylose medium. In the Saccharomyces genome database reference strain S288C, HXT12 is considered a pseudogene because of a frame shift mutation (www.yeastgenome.org; ORFs YIL170W and YIL171W).

This experiment showed clearly that the spontaneous growth on xylose of RN1053-X2 was caused by higher expression of HXT11 and that HXT11 is an efficient xylose transporter, if expressed.

Example 9

Hxt11p Facilitates Xylose Transport with Intrinsic Higher Level of Xylose Specificity than Hxt2p

Xylose Uptake by Hxt11p.

To determine whether HXT11 is capable of xylose transport in the absence and presence of glucose, uptake studies using radiolabeled 14C-xylose were performed. For these experiments the strains RN1053-empty, RN1053-HXT11 and RN1053-HXT2 were used (see Table 13). HXT2 is known for its xylose transport capabilities (Saloheimo et al, 2007, Xylose transport studies with xylose-utilizing Saccharomyces cerevisiae strains expressing heterologous and homologous permeases. Appl Microbiol Biotechnol. 74:1041-1052; Sedlak and Ho, 2004, Characterization of the effectiveness of hexose transporters for transporting xylose during glucose and xylose co-fermentation by a recombinant Saccharomyces yeast. Yeast, 21:671-684). Construction of RN1053-HXT11 was described in the previous example. RN1053-HXT2 was constructed in the following manner: HXT2 (SEQ ID NO: 120) was PCR-amplified from RN1001 genome (Table 12) using primers F HXT2 XbaI (SEQ ID NO:107) and R HXT2 Cfr9I (SEQ ID NO: 108). Resulting PCR fragment was sequence-verified and cloned into pRS313-P7-T7 (SEQ ID NO: 117) as XbaI-Cfr9I fragment. RN1053 was transformed with resulting construct pRS313-P7T7-HXT2 (see Table 12) generating a transformant derived from a single colony named strain RN1053-HXT2 (Table 13). To determine if Hxt11p increased xylose uptake in the strain RN1053, xylose uptake was measured using 14C in the cells expressing the transporters. In the presence of glucose, strains expressing HXT11 accumulated up to 50% more xylose compared to strains expressing HXT2 in the presence of glucose (FIG. 15). In addition, xylose uptake of RN1053-HXT11 was increased up to 4.5-fold, compared to RN1053-HXT2 (FIG. 15). These experiments show that Hxt11p is capable of transporting xylose across the yeast plasma membrane. Even more, Hxt11p harnesses an intrinsic higher specificity towards xylose that could not be easily competed by glucose as compared to previously identified xylose transporters within the yeast genome such as Hxt2p.

Example 10

Hxt11p is Functionally Expressed in the Yeast Plasma Membrane

Functional Expression of HXT11 in RN1053.

Detection of the Hxt11p by immunoblot analysis will not completely demonstrate the functional expression of the protein. For functional expression of a hexose transporter protein, it must reside in the plasma membrane. In order to monitor the expression and targeting of Hxt11p, a chimeric Hxt11p-GFP protein was engineered and examined by fluorometry and fluorescence microscopy. For these studies RN1053-HXT11-GFP, RN1041-HXT11-GFP, RN1053-HXT11 and RN1053-empty were used (Table 13). For the construction of the HXT11-GFP expressing strains, RN1053 and RN1041 were transformed with the expression vector bearing this chimeric Hxt11-GFP protein (pRS313-P7T7-HXT11-GFP; SEQ ID NO: 118; Table 12). The Hxt11p+GFP fusion protein is a functional hexose transporter: it restored growth on 2% xylose to the strain RN1053 (FIG. 16a). In addition, Hxt11p+GFP fluorescence of RN1053-HXT11-GFP and RN1041-HXT11-GFP was localized to the plasma membrane on xylose or glucose medium (FIG. 16b). These experiments show that Hxt11p-GFP is functional as xylose transporter and that Hxt11p is expressed functionally in the plasma membrane.

Example 11

HXT11 Expression in Rn1053 Facilitates Faster Co-Fermentation of Glucose and Xylose in Industrially Relevant Concentrations

Fermentation Profile of RN1053-HXT11 in Glucose-Xylose Mixtures.

To determine the fermentation behavior on a glucose-xylose mixture of a strain functionally expressing HXT11 in a HXT deletion background (hxt1-7, gal2) in comparison to a strain expressing the wild-type HXT landscape, fermentations were conducted on Verduyn-urea supplemented with industrially relevant glucose-xylose concentrations (80 and 40 g l−1 respectively). For these fermentations RN1053-HXT11 and RN1041-empty were used (see Table 13).

As shown in FIG. 17a, xylose of RN1041 was not co-fermented with glucose; whereas the degree of glucose-xylose co-fermentation was enhanced in strain RN1053-HXT11 as shown in FIG. 17b. Furthermore, xylose fermentation was completely exhausted in HXT11-RN1053, whereas 10 g/L of xylose was still remaining in RN1041 at 40 h; in addition, the xylose consumption of RN1053-HXT11 was dramatically increased at 2% residual glucose, and ethanol concentration was increased from 63.92 g/L to 72.33 g/L at the end of the fermentation (FIG. 17ab).

This example shows that a strain in which the major hexose transporters are deleted but expressing HXT11 displays faster xylose utilization than a strain with a wild-type hexose transporter background without HXT11.

Example 12

Wild-Type Hxt11 Expression Supports Growth on Xylose in Glucose Transport Counter-Activity Screen

Aim.

Using the Glucose Transport Activity Counter (GTAC)-screen, i.e. transforming hexokinase-mutant strain YD01227 as host to introduce transporters and screening the resulting transformants on medium for growth on and consumption of xylose in the presence of a 5 times higher amount of glucose, xylose transporters can be identified that exhibit an improved ability to transport xylose in the presence of a surplus of glucose (i.e. a higher affinity for xylose than for glucose; a reduction or more preferably full removal of glucose transport capability, while keeping xylose transport capability at least at the same level).

Transformation and Colony Picking.

YD01227 was transformed with constructs bearing wild-type GAL2 (pDB1250, EPA-29355), HXT2 (pDB1162; see Example 9 for construction plasmid) and HXT11 (pRS313-P7T7-HXT11, see for construction Example 8) constructs. For each transformation, 3 colonies, when available, were re-plated using automated colony picking to YNB+3% xylose agar medium MTPs and grown at 30° C. until visible colony growth was visible in the agar puncture.

Pre-Culture and Screen.

For pre-culture, transformants were transferred by automated process from selection agar medium MTPs to 96 well half-deepwell plates (96HDWP) containing liquid selection medium consisting of mineral medium (according to Verduyn, with urea as nitrogen source) supplemented with 3% xylose. The 96 well HDWPs were incubated for 3 days (pre-culture) in an orbital shaker at 30° C. and 750 rpm. Subsequently, for each sample, 20 μl of culture was transferred to 24 well deepwell plates (24 DWPs) containing 2.5 ml Verduyn-urea supplemented with the sugar mixture glucose:xylose in a ratio 5:1 with the following concentrations: 10 g l−1 glucose and 2 g l−1 xylose (YD10-medium). For each of the three sampling points a series of 24 well DWPs was inoculated. On each 24DWP, one RN1001 growth control was inoculated to have an indication of plate variation effects between different 24DWPs. After 24 hours, 72 hours and 96 hours automatic sampling, transfer to 96HDWP was conducted for automated OD-measurement at 600 nm wavelength. After the last OD measurement after 96 hours, cells were pelleted after centrifugation and 100 μl supernatant was collected for flow-NMR analysis of residual sugars and ethanol formation in the medium, after incubation (see above for method description).

Results.

Whereas RN1001 displayed growth from 24 hours onward (FIG. 18a) and complete consumption of both glucose and xylose (FIG. 18b, 18c), YD01227 transformants expressing GAL2, HXT2 and HXT11 constructs did not consume glucose (FIG. 18c) due to the deletion of hexo- and glucokinase activities. The latter strains also displayed diverse growth profiles (FIG. 18a) over time and diverse residual xylose concentrations representing their individual ability to consume xylose (FIG. 18b) in the presence of glucose. YD01227 expressing the HXT11 construct (YD01227-HXT11) displayed clear growth at 72 hours (FIG. 18a) and substantial xylose consumption with 4.83±1.26 g l−1 (n=3) xylose residing in the medium after 96 hours from the 22.7±0.12 g l−1 (n=43) present in the medium at the beginning of the experiment; YD01227-GAL2 and YD01227-HXT2 displayed hardly any growth and not much xylose was consumed in comparison to YD01227-HXT11, with respectively 18.34±0.39 and 21.29±0.32 g l−1 xylose residing in the medium after 96 hours of incubation (FIG. 18b).

This example shows that HXT11 supports considerable biomass formation and xylose consumption in the presence of glucose indicating that HXT11 expression in the hexokinase mutant YD01227 enables a more xylose-specific component in the sugar transport than exerted by GAL2 or HXT2 expression, both proven xylose transporters in the S. cerevisiae transportome (Saloheimo et al, 2007, Xylose transport studies with xylose-utilizing Saccharomyces cerevisiae strains expressing heterologous and homologous permeases. Appl Microbiol Biotechnol., 74:1041-1052; Sedlak and Ho, 2004, Characterization of the effectiveness of hexose transporters for transporting xylose during glucose and xylose co-fermentation by a recombinant Saccharomyces yeast. Yeast 21:671-684; Hamacher et al, 2002, Characterization of the xylose-transporting properties of yeast hexose transporters and their influence on xylose utilization. Microbiology, 148:2783-2788).

Example 13

Improved Hxt11 Mutant Obtained from Hxt11 Error Prone Library Screened in YD01227

To improve xylose uptake in the presence of glucose, error-prone PCR was conducted to generate a HXT11 mutant library encoding variants of Hxt11p which were screened for competitive xylose transport in the presence of glucose in the YD01227 strain (see Table 3 herein). The concentration of Mn2+ in the PCR reaction mixture was 0.15 mM, and it was added following the standard error-prone PCR protocol (Cirino, P. C et al. 2003. Generating mutant libraries using error-prone PCR. Methods Mol. Biol., 231, pp. 3-9) using primers HXT11F (SEQ ID NO: 41), and HXT11/12R (SEQ ID NO: 43). The library was cloned into pRS313-P7T7 as XbaI-BamHI fragments. Strain YD01227 was transformed with the HXT11-library and three thousand transformants were screened on Verduyn-urea medium supplemented with a 1:15 ratio of xylose (1%) and glucose (15%) in 96-well plate format using Synergy MX (BioTek Instruments, Inc, USA). From these 3000 mutants, eight mutants were obtained out-performing wild-type Hxt11p on screening medium. A representative clone was shown in FIG. 19a. The plasmids were isolated from YD01227 by using protocol according to Chowdhury (Chowdhury, K. 1991. One step ‘miniprep’ method for the isolation of plasmid DNA. Nucl. Acids Res 19, pp. 2792), and re-sequenced. All eight mutants were found to carry a plasmid bearing mutant sequences which translated into a protein containing the same mutation in Hxt11 (wild-type amino acid sequence Hxt11p SEQ ID NO: 62) leading to amino acid change at position 366 Asn (N) into Asp (D). In shake flask experiments the N366D mutant (YD01227-mHXT11[N366D]; see Table 13) also displayed faster growth in the screening medium compared to YD01227-HXT11, as shown in FIG. 19a. pRS313-P7T7-mHXT11(N366D) construct was re-transformed to RN1053 resulting in RN1053-mHXT11(N366D). The RN1053 expressing HXT11-N366D mutant was not affected with respect to xylose utilization on 2% xylose medium, compared to RN1053 expressing the wild-type HXT11 gene, since similar growth curves were observed (FIG. 19b).

Sugar Uptake of Strain RN1053 with Hxt11 and N366D Mutant.

Xylose and glucose transport kinetics were determined in the xylose utilizing S. cerevisiae strain RN1053 expressing the transporters Hxt11 and mHxt11p-(N366D). The measured xylose transport rate was plotted against glucose or xylose concentration. The affinity for glucose of RN1053-mHXT11(N366D) was strongly decreased up to 2-fold compared to RN1053-HXT11, whereas the affinity for xylose of RN1053-mHXT11(N366D) was also slightly decreased up to 1.2-fold, compared to RN1053-HXT11 (FIGS. 19c, 19d). In addition, in the presence of increasing concentrations of glucose strains expressing the N366D mutant accumulated up to 75% more xylose compared to strains expressing Hxt11 (FIG. 19e).

Fermentation of Xylose in the Presence of Glucose.

Fermentation experiments of sugar mixtures were performed comparing RN1053-mHXT11(N366D) to RN1053-HXT11 and RN1041-empty.

In a first experiment on Verduyn-urea supplemented with 100 g/L of glucose and 60 g/L of xylose, as shown in FIGS. 19f, 19g, 19h, and 19i glucose utilization, biomass formation (OD600), and ethanol production of RN1053-mHXT11(N366D) were delayed during the fermentation, compared to RN1041 and RN1053-HXT11. It seems that glucose consumption by RN1053-mHXT11(N366D) was strongly decreased at early exponential phase compared to RN1053-HXT11 (FIG. 19g). In addition, xylose consumption of RN1053-mHXT11(N366D) was not decreased (FIG. 19h) although the cell density of RN1053-mHXT11(N366D) was lower than that of RN1041, and RN1053-HXT11 (FIG. 19f).

In a second fermentation experiment on Verduyn-urea supplemented with lower sugar concentrations (80 g l−1 of glucose and 40 g l−1 of xylose) comparing RN1053-mHXT11(N366D) to RN1053-HXT11, a clear difference in sugar consumption profile was observed (FIGS. 19j, 19k, 19l). Whereas the glucose consumption profile displayed a faster glucose consumption rate during the phase that the glucose is declining rapidly (between 0 and 35 hours; qgluc(RN1053-HXT11) 2.22 g/l/h vs. g/l/h vs. qgluc(RN1053-mHXT11[N366D])) 2.04 g/l/h/, 8.5% decline in qgluc), whereas the xylose consumption rate has greatly increased during that same time window (qxyl(RN1053-HXT11) of 0.23 g/l/h vs. qxyl(RN1053-mHXT11[N366D]) of 0.38 g/l/h, 65% incline in qxyl). During the phase that mainly xylose was fermented (35-73 hrs) the xylose consumption rates were almost identical (qxyl(RN1053-HXT11) of 0.36 g/l/h vs. qxyl(RN1053-mHXT11[N366D]) of 0.37 g/l/h). The maximal xylose consumption rate was higher and reached earlier in the fermentation for RN1053-mHXT11(N366D) (0.65 g/l/h at 23 hrs) than for RN1053-HXT11 (0.50 g/l/h at 35 hrs). At the end of the fermentation run (period of 72 hrs typical for industrial fermentations) the RN1053-HXT11 consumed 51% of the xylose whereas RN1053-mHXT11(N366D) consumed 63%. The ethanol titers measured at the end of the fermentation were 4.4% higher for the RN1053 expressing the N366D mutant than for RN1053 expressing wild-type HXT11. Considering that the input of sugars into the fermentation was almost identical, one could imagine that higher yields were obtained from this glucose-xylose mixture with sugar concentrations typical for industrially relevant batch fermentations, and more specifically higher yields from the xylose fraction.

These fermentation experiments indicate that compared to its wild-type reference sequence the presence of a xylose-specific transporter variant engineered from S. cerevisiae hexose transporter HXT11 on the membrane increases the xylose consumption rate during the glucose phase, where the glucose consumption rate declined somewhat, and that in the end higher ethanol yields were obtained on a typical glucose-xylose mixture typical for relevant industrially relevant hydrolysates.

Example 14

Evolved Hexokinase Mutant Consumes Xylose in Presence of Glucose

Evolutionary Engineering of Strain YD01227.

For the evolutionary engineering, strain YD01227 was used for evolutionary engineering on glucose-xylose mixtures to evolve for xylose assimilation in the presence of glucose aiming at isolating spontaneous mutants in hexose transport or the regulation of the expression and/or activity of hexose transport.

YD01227 was inoculated for 16 hours in shake flask with Verduyn-urea-his supplemented with 2% xylose. At the start of the evolutionary engineering, YD01227 was diluted to an OD600 of 0.2 and DO setpoint at 5% in Verduyn-urea-his containing 1% xylose, 3% glucose. Carbondioxide outflow was monitored. At various time points samples were taken for analysis of glucose and xylose concentrations. It was determined whether strain YD01227 was growing solely on xylose or on both glucose and xylose. The glucose to xylose ratio, at the start of the evolutionary engineering, was kept to low to a ratio (glucose 3%, xylose 1%), which still allowed YD01227 growth at the beginning of the experiment. However, this was at significantly lower growth rates if compared to growth on only 1% xylose. In this setup the strain consumes the xylose which leads to higher glucose:xylose ratios and, therefore, a drop in growth rate. When the CO2 production dropped, additional xylose (5 ml of 50% xylose to 500 ml fermentor volume) was added to maintain growth. At an OD600 of 20, which was reached on average after 5-6 days, the culture was diluted into fresh Verduyn-urea-his in a higher glucose to xylose ratio, if growth rates had significantly improved in the previous cycle. In total, in a time frame of 27 days, the strain was serial diluted 5 times in 1% Xyl/3% Glc (1:3), 1.5% Xyl/9% Glc (1:6), 1% Xyl/8% Glc (1:8), 1% Xyl/10% Glc (1:10) and 0.57% Xyl/10% Glc (1:15), respectively. Before inoculation in 1% xylose and 8% glucose the setpoint for DO was lowered into 0% (anaerobic growth) in order to maintain a lower growth rate. In FIG. 20 the scheme for the glucose/xylose ratio in the Verduyn-urea-his medium during chemostat cultivation (days) of YD01227 is given. After 27 days samples were taken of the evolved YD01227 strain and plated 1% xylose and 10% glucose with the original YD01227 as negative control. Whereas the original YD01227 showed only small colonies the colonies of the evolved YD01227 strain were 10-15 times larger.

Xylose Growth and Xylose Uptake with/without Glucose Competition.

After re-streaking the evolved YD01227 strain on a 1% xylose and 10% glucose plate, three colonies (EvoA, EvoB and EvoC) were analyzed for growth in shake flasks on 1% xylose in the presence of respectively 0%, 3%, 6% and 10% glucose. YD01227 EvoB had the highest growth rate on xylose at 6% en 10% glucose and was compared with the original YD01227 strain (FIG. 21a, 21b). In the original YD01227 strain (YD01227 ORI in FIG. 21b) the growth rate is already partly inhibited at 3% glucose and completely inhibited at 6% and 10% glucose however the YD01227 EvoB strain shows only minor inhibition in growth rate at all glucose concentrations and this seems unrelated to the amount of glucose added (FIG. 21a). The same two strains were used in a 14C xylose (50 mM) uptake experiment in which the xylose uptake is inhibited by glucose (FIG. 21c). The uptake of xylose without the addition of glucose in both strains is the same however as soon as glucose was added to both strains the uptake of xylose in the YD01227 EvoB strain was not as inhibited as the uptake in the original YD01227 strain. In a 1:10 ratio the xylose uptake in the original YD01227 strain is completely abolished whereas in the YD01227 EvoB strain still 5 nmol/mgDW·min is taken up.

Example 15

Single Nucleotide Polymorphism in Hxt3-6 Chimera Allows for Xylose Consumption in the Presence of Glucose in Evolved Hexokinase Mutant

Expression of the HXTs in the Evolved YD01227 Strain.

The expression levels of HXT1-17 and GAL2 in the evolved YD01227 EvoB and original YD01227 strains were compared during batch cultivations on Verduyn-urea-his containing 1% xylose and 3% glucose (FIG. 22a). Primers (SEQ ID NO: 2-37) were used in the real time PCR characterization of the expression of HXTs in YD01227 and evolved derivative. Furthermore, the expression levels in the YD01227 EvoB strain were also analyzed on Verduyn-urea-his containing 1% xylose and 10% glucose. The absolute C(t) values (data not shown) show that the HXT1-7 genes are the only HXT genes that are intermediately or highly expressed of which the HXT3-6 chimera (specific deletion in strain lineage intragenic and intergenic HXT3 and HXT6 sequences resulting in one HXT36 chimeric sequence) has the highest expression levels. None of the analyzed sugar transporters is up-regulated in the YD01227 EvoB strain compared to the original YD01227 strain. The up-regulation seen in the HXT1 gene in YD01227 EvoB 1% xylose and 10% glucose is caused by the high glucose concentration in this sample which is quite well known (Ozcan & Johnston, 1995, Three different regulatory mechanisms enable yeast hexose transporter (HXT) genes to be induced by different levels of glucose. Mol Cell Biol 15, pp. 1564-1572). This high glucose concentration also leads to the down-regulation of HXT2 and HXT7 in YD01227 EvoB. Both the up-regulation in HXT1 and down-regulation of HXT2 and HXT7, are described in literature (Boles & Hollenberger 1997, Kinetic characterization of individual hexose transporters of Saccharomyces cerevisiae and their relation to the triggering mechanisms of glucose repression, FEMS Microbiol Rev 21, pp. 85-111).

Sequencing of the Highly Expressed HXT Genes.

HXT1-7 were amplified from cDNA which was isolated from the YD01227 EvoB culture on 1% xylose and 3% glucose using the primers SEQ ID NO: 49-60. The PCR products from these genes were sequenced. No mutations were revealed in HXT1, HXT2 and HXT4, one silent mutation in HXT5 and HXT7 and a mutation leading to amino acid change at position 367 (Asn into Ile; N367I) in chimera HXT3-6. Somewhere in the YD01227 strain lineage a deletion occurred between the neighboring loci of HXT3 and HXT6 in which intragenic and intergenic sequences were deleted (part of 3′ part of HXT3 ORF, HXT3 terminator, HXT6 promoter, HXT6 ORF) resulting in one HXT36 chimeric sequence which is in frame and can be expressed as mRNA and translated into functional protein. The translated chimeric protein Hxt3-6p of which the first 438 amino acids are identical to the CEN.PK Hxt3p amino acid sequence, whereas the 130 amino acids towards the C-terminus are identical to Hxt6p in CEN.PK. Genomic rearrangements in the HXT3-6-7 locus have been documented in the past, e.g. HXT6/7 chimeric sequences resulting from chemostat cultures on low glucose concentrations, and are proposed to be caused by homologous recombination due to the highly homologous stretches of sequences in this cluster of hexose transporters (Brown et al 1998. Multiple duplications of yeast hexose transport genes in response to selection in a glucose-limited environment. Mol Biol Evol 15:931-942). The N367I point mutation is located in trans membrane domain (TMD) 8 which is known to contain residues responsible for the affinity for glucose (Kasahara & Kasahara, 2003. Transmembrane segments 1, 5, 7 and 8 are required for high-affinity glucose transport by S. cerevisiae Hxt2 transporter. Biochem J. 372:247-252, reconfirmed by this patent application).

Examples 16-18

Methods

Methods not mentioned in the section of Examples 16 and 17 were already described in section Examples 6-15. Oligonucleotides used in the studies described in Example 16 and 17 are depicted in Table 14. The saturated mutagenesis of position N367 in HXT36 was done using PCR with Phusion® High-Fidelity PCR Master Mix with HF buffer using primer pairs F HXT36 BcuI (SEQ ID NO 127)/R HXT36 367NNN (SEQ ID NO 128) and F HXT36 367NNN (SEQ ID NO 129)/R HXT36 BamHI (SEQ ID NO 130). The fragments of 1119 and 623 base pairs were subsequently used in an overlap PCR using the outside primers F HXT36 BcuI and R HXT36 BamHI and cloned into pRS313P7T7 using BcuI and BamHI. Sequencing of 48 E. coli clones yielded N367S (tcc), N367P (ccc), N367G (ggg), N367Y (tac), N367A (gcc), N367H (cac), N367R (agg), N367F (ttt), N367E (gag), and N367V (gtg). The remaining 8 amino acids at position 367 were amplified and cloned with overlap PCR using specific primers in which the NNN was replaced by tta (L), tgt (C), tgg (W), atg (M), act (T), aag (K), gat (D) and cag (Q).

The carboxyl-terminal GFP fusions with HXT36 and HXT36-N367I mutant were made by amplification of the corresponding genes with the Phusion® High-Fidelity PCR Master Mix (HF buffer) using primers F HXT36 BcuI (SEQ ID NO 127) and R HXT36 BamHI-stop (SEQ ID NO 131). The GFP gene itself was amplified with F GFP BamHI (SEQ ID NO 132) and R GFP C/al (SEQ ID NO 133). HXT36 and HXT36-N367I were digested with the restriction enzymes BcuI and BamHI and GFP was digested with BamHI and ClaI. The HXT36 genes were separately ligated in a two-fragment ligation together with GFP into pRS313-P7T7 which was cut with BcuI and ClaI.

For the fermentations of Example 18, strains were grown, in duplo, in 50 ml Schott bottles filled to the rim with 68 ml fermentation medium containing 0.5% D-glucose and 0.5% D-xylose and kept completely closed at 30° C. in a water bath. Stirring speed, with a magnet stirrer, was 200 rpm and the strains were inoculated at a starting OD600 of approximately 8.0. At regular intervals samples were taken for OD600 measurements and HPLC analysis.


TABLE 14
Oligonucleotides used in cloning and sequencing.
SEQ
ID
NO
Name
Sequence (5'→3')
127
F HXT36 Bcui
GCATACTAGTATGAATTCAACTCCAGATTT
AATATCC
128
R HXT36 367NNN
CAACAAGTAGAGAAGAAnnnGACGACACCG
129
F HXT36 367NNN
CGGTGTCGTCnnnTTCTTCTCTACTTGTTG
130
R HXT36 BamHi
ACGTGGATCCTTATTTGGTGCTGAACATTC
TCTTGT
131
R HXT36 BamHI-
CCATGGATCCTTTGGTGCTGAACATTCTCT
stop
TGTAC
132
F GFP BamHI
AAAGGATCCATGGTGAGCAAGGGCGAGGAGC
133
R GFP ClaI
AAAATCGATTTACTTGTACAGCTCGTCC

Example 16

Decrease in Vmax(of Hxt3-6 N367I is not the Result of Decreased Expression of Mutant as Shown by Gfp-Tagging Studies

To ensure that this lower Vmax is not due to a decrease in expression, chimers were made in which GFP was fused to the C-terminus of the HXT36 and the HXT36-N367I mutant. Both fusions were transformed to the RN1053 strain, and fluorescence imaging revealed that the proteins are uniformly distributed over the plasma membrane (FIGS. 23A and 23B). Since the same levels of GFP were recorded, Hxt36p and Hxt36p-N367I are expressed to similar extents. (FIG. 23C).

Example 17

Saturation Mutagenesis on Position Asparagin-367 in Hxt3-6 Chimera for the Exploration of the Sequence Space Reveals Alanine as Potent Residue in Enhanced Transporter with Enhanced Xylose Transport Capacity

To explore the sequence space of position N367 (corresponding to position N376 in SEQ ID NO: 59), all amino acid substitutions were individually introduced into the HXT36 gene. The individual HXT36-N367X mutants were transformed to the YD01227 hexokinase deletion strain and tested for growth on minimal medium containing 1% D-xylose and 10% D-glucose. The transformant bearing the original HXT36-N367I mutant showed an OD600 of 0.56 after 24 hrs whereas the HXT36 wild-type was unable to grow under these conditions (FIG. 24). The fastest growing transformant beared the Hxt36p N367A mutant, which reached an OD600 of almost 2. Also the transformants expressing the HXT36 mutants the other nonpolar aliphatic amino acid substitutions (glycine, valine, leucine and methionine) where able to grow on D-xylose in the presence of 10% D-glucose. On the other hand, the phenylalanine and histidine mutants showed a reduced growth rate whereas strong polar and charged amino acid substitutions did not support growth (FIG. 24). These data show that the N367 (corresponding to N376 in Gal2p and N366 in Hxt11p) is a critical residue in determining the specificity of Hxt36p for glucose versus xylose.

The Hxt36p N367A and N367I mutants were analyzed further to determine their transporter kinetics. Herein, the transporters were expressed in strain RN1053 that is equipped with a low background glucose transport activity. The Km and Vmax for D-glucose uptake by HXT36 was about 6 mM and 32 nmol/mgDW·min, respectively (Table 15 and FIG. 25). Remarkably, the Hxt36p N367I mutant was completely defective in D-glucose uptake, while the affinity for D-xylose uptake was improved 2.7-fold (i.e., from 108 to 40 mM) compared to Hxt36p (Table 15). The mutation, however, also caused a near to 3-fold decrease in the Vmax for D-xylose uptake.

Also the transport activity of the Hxt36p-N367A mutant was examined which showed the fastest growth on D-xylose. This transporter still showed some glucose uptake although with a very poor Km (171 mM versus 6 mM). Compared to the N367I mutant, the N367A mutation caused both an improvement of the Km and Vmax values for D-xylose uptake to 25 mM and 15.3 nmol/mgDW·min, respectively.

Example 18

Co-Fermentation of D-Glucose and D-Xylose by an Engineered S. Cerevisiae Strain with Altered Transport Characteristics

In order to investigate co-fermentation of D-glucose and D-xylose, the RN1053 strain harboring the wild-type Hxt36, Hxt36-N367I and Hxt36p-N367A, were grown on 5 g L−1 D-glucose/5 g L−1 D-xylose at a higher industrially relevant starting OD600 of approximately 8.0. Sugar consumption and ethanol concentrations were followed through time (FIG. 26). The strain containing the Hxt36-N367I transporter grows on D-xylose but because of the severe D-glucose uptake defect (FIG. 26B), it only shows some background level of D-glucose consumption that is similar to that of the original RN1053 strain without any re-introduced transporter (data not shown). The strain harboring the Hxt36-N367A mutant showed an improved D-glucose and D-xylose co-consumption (FIG. 26C) as compared to the strain containing the Hxt36 wild-type transporter (FIG. 26A). Moreover, also the total sugar consumption increased because of the co-consumption of glucose and xylose by the Hxt36p-N367A-expressing RN1053 yielding a higher ethanol concentration (2.83 g L−1) than wild-type Hxt36p-expressing RN1053 (2.67 g L−1) after 9 hours of fermentation.


TABLE 15
Km and Vmax values for D-glucose and D-xylose uptake by Hxt36p
transporters expressed in strain RN1053.
Km
Vmax
(mM)
(nmol/mgDW · min)
Glucose
Xylose
Glucose
Xylose
HXT36
 6.13 ± 0.02
107.9 ± 12.1
31.7 ± 0.07
32.9 ± 3.1
HXT36-N367I
a
39.8 ± 5.6
a
 12.1 ± 1.63
HXT36-N367A
170.7 ± 37.8
24.9 ± 3.4
37.2 ± 4.4 
15.3 ± 0.2
aCould not be determined

Examples 19 and 20

Material and Methods

Methods not mentioned in the section of Examples 19 and 20 were already described in sections of Examples 6-18. Oligonucleotides used in the studies described in Example 19 and 20 are depicted in Table 16.

Mutagenesis of N366X.

The saturated mutagenesis of position N366 in HXT11 was done using PCR with Phusion® High-Fidelity PCR Master Mix with HF buffer using primer pairs F HXT11 XbaI/R HXT11 366NNN and F HXT11 366NNN/R HXT11 BamHI (see Table 16). The fragments of 1113 and 591 base pairs were subsequently used in an overlap PCR using the outside primers F HXT11 XbaI and R HXT11 BamHI and cloned into pRS313P7T7 using XbaI and BamHI. Sequencing of 48 E. coli clones yielded N367S (tct), N367P (cca), N367G (ggt), N367A (gcc), N367H (cac), N367R (cgc), N367L (ttg), N367C (tgt), N367T (acg), N367D (gat), N367Q (caa), and N367V (gtg). The remaining 6 amino acids at position 366 were amplified and cloned as mentioned above with overlap PCR using specific primers in which the NNN was replaced by ttt (F), gag (E), tgg (W), atg (M), aaa (K), and N367Y (tat).

Using the generated HXT11 variant sequences generated by the saturation mutagenesis PCR, HXT11-N366x-GFP-fusion constructs to study cellular localization of HXT11 variants were prepared similarly (with oligonucleotides, restriction sites and pRS313-P7T7-GFP backbone vector) as described in the methods for Example 10 (p. 96).

Fermentation Experiments.

Yeast cultures were pre-cultured in mineral medium containing 2% maltose. Cells at mid-exponential phase were harvested and inoculated after washing twice with sterilized water. Fermentation experiments were performed using 100 ml of mineral medium containing 7% glucose and 4% xylose in 120 ml bottle at 30° C. with an initial OD600 of 5 under oxygen limited conditions. Stirring speed, with a magnetic stirrer, was 200 rpm. All of the bottle fermentation experiments were repeated independently.


TABLE 16 
Primers used for saturation mutagenesis of
S. cerevisiae HXT11.
SEQ ID
Name
NO
Sequence (5'→3')
F HXT11 XbaI
134
GGCCTCTAGAATGTCAGGTGTTAATA
ATACATCCGC
R HXT11 Bam HI
135
CGATGGATCCTCAGCTGGAAAAGAAC
CTCTTGTAAATTG
F HXT11 366NNN
136
CGGTGTGGTTnnnTTTTTCTCTTCAT
TC
R HXT11 366NNN
137
GAATGAAGAGAAAAAnnnAACCACAC
CG
F HXT11 N366F
138
CGGTGTGGTTtttTTTTTCTCTTCAT
TC
R HXT11 N366F
139
GAATGAAGAGAAAAAaaaAACCACAC
CG
F HXT11 N366E
140
CGGTGTGGTTgagTTTTTCTCTTCAT
TC
R HXT11 N366E
141
GAATGAAGAGAAAAActcAACCACAC
CG
F HXT11 N366K
142
CGGTGTGGTTaaaTTTTTCTCTTCAT
TC
R HXT11 N366K
143
GAATGAAGAGAAAAAtttAACCACAC
CG
F HXT11 N366M
144
CGGTGTGGTTatgTTTTTCTCTTCAT
TC
R HXT11 N366M
145
GAATGAAGAGAAAAAcatAACCACAC
CG
F HXT11 N366W
146
CGGTGTGGTTtggTTTTTCTCTTCAT
TC
R HXT11 N366W
147
GAATGAAGAGAAAAAccaAACCACAC
CG
F HXT11 N366Y
148
CGGTGTGGTTtatTTTTTCTCTTCAT
TC
R HXT11 N366Y
149
GAATGAAGAGAAAAAataAACCACAC
CG
n is any nucleotide

Example 19

N366 Mutations in Hxt11 Improve Xylose Utilization in the Presence of Glucose

The N366D mutation in Hxt11 improved xylose uptake in the presence of glucose because of a reduction in the glucose transport affinity. In order to assess the importance of this position, N366 was replaced with each of the other 19 amino acids to generate a series of N366X mutants. The corresponding genes were expressed in strain YD01227 and evaluated for their ability to utilize 1% xylose in the presence of 10 glucose using 96-well plates. Here, 10% glucose was used instead of 15% to increase the sensitivity of the assay in order to discriminate between the performance of the various mutants. Growth rates on xylose in the presence of a 10-fold excess glucose was improved when N366 was substituted by a methionine (M) or threonine (T) residue (FIG. 27A), and was up to 3-fold higher than the N366D substitution. Amino acids with a positive charged or bulky hydrophobic side chain did not support growth on xylose under the screening condition. The mutants were also tested for growth on glucose and expressed in strain RN1053. The N366M and N366T Hxt11 mutants showed similar growth on glucose or as compared to the wild-type Hxt11 (FIGS. 27B and 27C). In addition, the expression level of all individual mutants was determined using GFP-tagged Hxt11 proteins (FIG. 28). All of the Hxt11-GFP proteins were highly expressed on membrane, except that with the GFP-tagged N366W and N366Y Hxt11 proteins, a cytosolic and likely vacuolar localization seems apparent. This suggests protein-misfolding and faulty targeting to the membrane by these mutants explaining the low activity in the growth experiments with xylose and glucose. However, the wild-type and N366M and N366T Hxt11 mutant protein localized to the plasma membrane. Overall, these data indicate that N366 is a critical residue in determining the specificity of Hxt11 for xylose versus glucose.

The xylose and glucose transport kinetics via Hxt11 and the N366T and N366M Hxt11 mutants were determined for the genes expressed in the xylose utilizing S. cerevisiae strain RN1053. Compared to the wild-type Hxt11, the affinity for glucose transport by N366T and N366M Hxt11 was reduced up to 5 and 4-fold, respectively. In contrast, the affinity for xylose by these mutants was improved by up to 2-fold (Table 17) relative to Hxt11. The Vmax for glucose uptake by the N366T Hxt11 mutant was increased by about 40% as compared to wild-type Hxt11, while the Vmax was unchanged for the N366M Hxt11 protein. Importantly, the Vmax for xylose of the mutants remained largely unchanged compared to Hxt11.


TABLE 17
Km and Vmax values for D-glucose and D-xylose uptake by Hxt11
transporters expressed in strain RN1053.
Km
Vmax
(mM)
(nmol/mg DW · min)
Glucose
Xylose
Glucose
Xylose
Hxt11
33.4 ± 2.1
 84.2 ± 10.0
82.3 ± 3.8
44.5 ± 1.7
Hxt11-N366D
87.0 ± 6.4
106.7 ± 21.7
98.9 ± 5.7
45.5 ± 1.0
Hxt11-N366T
194.4 ± 47.9
46.7 ± 2.7
125.6 ± 3.7 
40.1 ± 2.4
Hxt11-N366M
144.9 ± 36.0
50.1 ± 9.7
75.3 ± 8.6
34.2 ± 3.4
Hxt2
n.d.
51.2 ± 0.1
n.d.
12.5 ± 0.2
n.d., not determined

Example 20

Co-Fermentation of D-Glucose and D-Xylose by Engineered S. Cerevisiae Strains Expressing Hxt11 Variants

Because of the marked effects of the N366 mutations in Hxt11 on glucose transport without interfering with xylose transport, the mutants were further examined for their ability to co-metabolize xylose and glucose under industrial conditions, i.e., 7% glucose and 4% xylose, respectively. Herein, the mutants were expressed in strain RN1053, and growth was compared to the Hxt11 wild-type and strain RN1001 containing a full complement of endogenous transporters. The two mutants supported a near to perfect co-consumption of glucose and xylose (FIGS. 29A and 29B) in contrast to the RN1001 strain (FIG. 29C) and RN1053 wild-type Hxt11 (FIG. 29D) and that showed delayed consumption of xylose. These data demonstrate that the mutagenesis of the N366 position of Hxt11 yields mutants that mediate a balanced uptake of glucose and xylose thereby supporting co-consumption of the hexose and pentose sugars. Best results were obtained for mutant N366T HXT11.

Co-Consumption

Co-consumption of a cell is herein quantified and expressed as co-consumption index. The co-consumption index was herein the co-consumption index for glucose and xylose and was calculated as the sum over the time interval of 0-24 hours (it was measured at 0, 8, 12, 14, 16, 18, 20, 22 and 24 hours) of the absolute difference of the glucose uptake rate (Qg) and the xylose uptake rate (Qx), expressed as grams of sugar consumed per time unit. The fermentation was an anaerobic batch culture fermentation at 1.0 g/l dry yeast pitch, 30 degrees C. temperature and wherein the fermentation medium contains 71.8 grams of glucose per liter and 40.0 grams xylose per liter, at the start of the fermentation. A low value for co-consumption index indicates high co-consumption, a high value less co-consumption.

These fermentation data and calculations for the strains RN1001, RN1053 HXT11, RN1053 HXT11 (N366M) and RN1053 HXT11 (N366T) are given in table 18.


TABLE 18
Fermentation data and calculation of co-consumption index for the the strains
RN1001, RN1053 HXT11, RN1053 HXT11 (N366M) and RN1053 HXT11 (N366T)
Average
Qg
Qx
abs(Qg −
sum(abs(Qg −
corr(glucose,
Time
Glucose
Xylose
(g/h)
(g/h)
Qx)
Qx))
xylose)
DS68616
0
71.8
39.9
8
46.9
39.8
3.12
0.02
3.10
29.1
0.69
12
31.0
38.7
3.97
0.27
3.70
14
18.4
37.8
6.31
0.46
5.85
16
5.42
35.9
6.47
0.94
5.53
18
0
29.1
2.71
3.39
0.68
20
0
20.7
0
4.25
4.25
22
0
15.4
0
2.632
2.63
24
0
8.60
0
3.40
3.40
HXT11
0
71.8
39.9
8
55.4
40.0
2.06
0.00
2.06
25.0
0.84
12
41.1
38.6
3.55
0.345
3.21
14
25.5
35.2
7.84
1.70
6.15
16
12.5
32.3
6.49
1.47
5.02
18
2.85
26.0
4.82
3.12
1.70
20
0
19.4
1.42
3.34
1.91
22
0
14.3
0
2.51
2.51
24
0
9.44
0
2.45
2.45
HXT11 (N366M)
0
71.8
39.9
8
60.2
38.2
1.45
0.220
1.23
11.2
0.977
12
52.5
35.6
1.93
0.644
1.29
14
42.7
31.3
4.87
2.15
2.72
16
35.6
28.8
3.55
1.23
2.32
18
29.4
26.0
3.09
1.44
1.66
20
23.3
22.3
3.05
1.82
1.24
22
18.5
18.7
2.42
1.83
0.592
24
14.1
14.5
2.18
2.07
0.117
HXT11(N366T)
0
71.8
39.9
8
59.1
36.7
1.59
0.409
1.18
11.8
0.977
12
47.7
33.5
2.84
0.798
2.05
14
37.5
28.6
5.13
2.41
2.71
16
28.6
24.7
4.42
1.99
2.43
18
21.3
20.7
3.68
1.97
1.72
20
14.2
15.9
3.55
2.44
1.11
22
8.87
11.1
2.65
2.38
0.268
24
4.94
6.56
1.96
2.26
0.3

The co-consumption index of the strains RN1001, RN1053 HXT11, RN1053 HXT11 (N366M) and RN1053 HXT11 (N366T) was determined as in table 18. Summarizing, the results for co-consumption index are given in table 19.


TABLE 19
Co-consumption index of strains
Co-consumption index (sum
Strain
abs (Qg*-Qx*) (g/h))
RN1001
29.1
RN1053 HXT11
25.0
RN1053 HXT11 (N366M)
11.2
RN1053 HXT11 (N366T)
11.8

REFERENCES

  • Ausubel et al. 1995 Current Protocols in Molecular Biology, John Wiley & Sons, Inc.
  • Becker J, Boles E. 2003 A modified Saccharomyces cerevisiae strain that consumes L-Arabinose and produces ethanol. Appl Environ Microbiol. 69: 4144-4150.
  • Hamacher T, Becker J, Gárdonyi M, Hahn-Hägerdal B, Boles E. 2002 Characterization of the xylose-transporting properties of yeast hexose transporters and their influence on xylose utilization. Microbiology 148: 2783-2788.
  • Kasahara T, Kasahara M. 2000 Three aromatic amino acid residues critical for galactose transport in yeast Gal2 transporter. J Biol Chem. 275: 4422-4428.
  • Kasahara T, Maeda M, Boles E, Kasahara M. 2009 Identification of a key residue determining substrate affinity in the human glucose transporter GLUT1. Biochim Biophys Acta. 1788: 1051-1055.
  • Kasahara T, Kasahara M. 2010 Identification of a key residue determining substrate affinity in the yeast glucose transporter Hxt7: a two-dimensional comprehensive study. J Biol Chem. 285: 26263-26268.
  • Kuyper M, Hartog M M, Toirkens M J, Almering M J, Winkler A A, van Dijken J P, Pronk J T 2005 Metabolic engineering of a xylose-isomerase-expressing Saccharomyces cerevisiae strain for rapid anaerobic xylose fermentation. FEMS Yeast Research 5: 399-409.
  • Luttik M A, Kötter P, Salomons F A, van der Klei I J, van Dijken J P, Pronk J T 2000 The Saccharomyces cerevisiae ICL2 gene encodes a mitochondrial 2-methylisocitrate lyase involved in propionyl-coenzyme A metabolism. Journal of Bacteriology 182: 7007-7013.
  • Nelissen B, De Wachter R, Goffeau A. 1997 Classification of all putative permeases and other membrane plurispanners of the major facilitator superfamily encoded by the complete genome ofSaccharomyces cerevisiae. FEMS Microbiol Rev. 21: 113-134.
  • Sambrook et al. 1989 Molecular Cloning, a Laboratory Manual
  • Schiestl R H and Gietz R D 1989 High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Current Genetics 16: 339-346.
  • Wieczorke R, Krampe S, Weierstall T, Freidel K, Hollenberg C P, Boles E 1999 Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS Letters 464: 123-128.
  • Young E, Poucher A, Corner A, Bailey A, Alper H. 2011 Functional survey for heterologous sugar transport proteins, using Saccharomyces cerevisiae as a host. Appl Environ Microbiol. 77: 3311-3319

<160> NUMBER OF SEQ ID NOS: 167

<210> SEQ ID NO: 1

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 5034-kanf

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(20)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 5034-kanf” /mol_type=“unassigned DNA”

<400> SEQENCE: 1

aagcttgcct cgtccccgcc 20

<210> SEQ ID NO: 2

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 5035-kanr

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(20)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 5035-kanr” /mol_type=“unassigned DNA”

<400> SEQENCE: 2

gtcgacactg gatggcggcg 20

<210> SEQ ID NO: 3

<211> LENGTH: 60

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: note=“primer 5116-lf2

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(60)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 5116-lf2“ /mol_type=”unassigned DNA“

<400> SEQENCE: 3

attctagtaa cggccgccag tgtgctggaa ttcgccctta agcttgcctc gtccccgccg 60

<210> SEQ ID NO: 4

<211> LENGTH: 56

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 5118-lr2

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(56)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 5118-lr2“ /mol_type=”unassigned DNA“

<400> SEQENCE: 4

catacattat acgaagttat gcgcgctcta gatatcgtcg acactggatg gcggcg 56

<210> SEQ ID NO: 5

<211> LENGTH: 65

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 5115-lf1

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(65)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 5115-lf1“ /mol_type=”unassigned DNA“

<400> SEQENCE: 5

atccggacgt acgtataact tcgtatagca tacattatac gaagttattc tagtaacggc 60

cgcca 65

<210> SEQ ID NO: 6

<211> LENGTH: 60

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 5117-lr1

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(60)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 5117-lr1“ /mol_type=”unassigned DNA“

<400> SEQENCE: 6

tcatgacgtc tcgaggccta taacttcgta tagcatacat tatacgaagt tatgcgcgct 60

<210> SEQ ID NO: 7

<211> LENGTH: 5082

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN201; TOPO-BLUNT-loxP-kanMX-loxP

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(5082)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“ /note=”pRN201;

TOPO-BLUNT-loxP-kanMX-loxP“ /mol_type=”unassigned DNA“

<400> SEQENCE: 7

agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 60

acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 120

tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 180

ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctat 240

ttaggtgaca ctatagaata ctcaagctat gcatcaagct tggtaccgag ctcggatcca 300

ctagtaacgg ccgccagtgt gctggaattc gcccttatcc ggacgtacgt ataacttcgt 360

atagcataca ttatacgaag ttattctagt aacggccgcc agtgtgctgg aattcgccct 420

taagcttgcc tcgtccccgc cgggtcaccc ggccagcgac atggaggccc agaataccct 480

ccttgacagt cttgacgtgc gcagctcagg ggcatgatgt gactgtcgcc cgtacattta 540

gcccatacat ccccatgtat aatcatttgc atccatacat tttgatggcc gcacggcgcg 600

aagcaaaaat tacggctcct cgctgcagac ctgcgagcag ggaaacgctc ccctcacaga 660

cgcgttgaat tgtccccacg ccgcgcccct gtagagaaat ataaaaggtt aggatttgcc 720

actgaggttc ttctttcata tacttccttt taaaatcttg ctaggataca gttctcacat 780

cacatccgaa cataaacaac catgggtaag gaaaagactc acgtttcgag gccgcgatta 840

aattccaaca tggatgctga tttatatggg tataaatggg ctcgcgataa tgtcgggcaa 900

tcaggtgcga caatctatcg attgtatggg aagcccgatg cgccagagtt gtttctgaaa 960

catggcaaag gtagcgttgc caatgatgtt acagatgaga tggtcagact aaactggctg 1020

acggaattta tgcctcttcc gaccatcaag cattttatcc gtactcctga tgatgcatgg 1080

ttactcacca ctgcgatccc cggcaaaaca gcattccagg tattagaaga atatcctgat 1140

tcaggtgaaa atattgttga tgcgctggca gtgttcctgc gccggttgca ttcgattcct 1200

gtttgtaatt gtccttttaa cagcgatcgc gtatttcgtc tcgctcaggc gcaatcacga 1260

atgaataacg gtttggttga tgcgagtgat tttgatgacg agcgtaatgg ctggcctgtt 1320

gaacaagtct ggaaagaaat gcataagctt ttgccattct caccggattc agtcgtcact 1380

catggtgatt tctcacttga taaccttatt tttgacgagg ggaaattaat aggttgtatt 1440

gatgttggac gagtcggaat cgcagaccga taccaggatc ttgccatcct atggaactgc 1500

ctcggtgagt tttctccttc attacagaaa cggctttttc aaaaatatgg tattgataat 1560

cctgatatga ataaattgca gtttcatttg atgctcgatg agtttttcta atcagtactg 1620

acaataaaaa gattcttgtt ttcaagaact tgtcatttgt atagtttttt tatattgtag 1680

ttgttctatt ttaatcaaat gttagcgtga tttatatttt ttttcgcctc gacatcatct 1740

gcccagatgc agttaagtgc gcagaaagta atatcatgcg tcaatcgtat gtgaatgctg 1800

gtcgctatac tgctgtcgat tcgatactaa cgccgccatc cagtgtcgac gatatctaga 1860

gcgcgcataa cttcgtataa tgtatgctat acgaagttat aggcctcgag acgtcatgaa 1920

agggcgaatt ctgagatatc catcacactg gcggccgctc gagcatgcat ctagagggcc 1980

caattcgccc tatagtgagt cgtattacaa ttcactggcc gtcgttttac aacgtcgtga 2040

ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag 2100

ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctata 2160

cgtacggcag tttaaggttt acacctataa aagagagagc cgttatcgtc tgtttgtgga 2220

tgtacagagt gatattattg acacgccggg gcgacggatg gtgatccccc tggccagtgc 2280

acgtctgctg tcagataaag tctcccgtga actttacccg gtggtgcata tcggggatga 2340

aagctggcgc atgatgacca ccgatatggc cagtgtgccg gtctccgtta tcggggaaga 2400

agtggctgat ctcagccacc gcgaaaatga catcaaaaac gccattaacc tgatgttctg 2460

gggaatataa atgtcaggca tgagattatc aaaaaggatc ttcacctaga tccttttcac 2520

gtagaaagcc agtccgcaga aacggtgctg accccggatg aatgtcagct actgggctat 2580

ctggacaagg gaaaacgcaa gcgcaaagag aaagcaggta gcttgcagtg ggcttacatg 2640

gcgatagcta gactgggcgg ttttatggac agcaagcgaa ccggaattgc cagctggggc 2700

gccctctggt aaggttggga agccctgcaa agtaaactgg atggctttct cgccgccaag 2760

gatctgatgg cgcaggggat caagctctga tcaagagaca ggatgaggat cgtttcgcat 2820

gattgaacaa gatggattgc acgcaggttc tccggccgct tgggtggaga ggctattcgg 2880

ctatgactgg gcacaacaga caatcggctg ctctgatgcc gccgtgttcc ggctgtcagc 2940

gcaggggcgc ccggttcttt ttgtcaagac cgacctgtcc ggtgccctga atgaactgca 3000

agacgaggca gcgcggctat cgtggctggc cacgacgggc gttccttgcg cagctgtgct 3060

cgacgttgtc actgaagcgg gaagggactg gctgctattg ggcgaagtgc cggggcagga 3120

tctcctgtca tctcaccttg ctcctgccga gaaagtatcc atcatggctg atgcaatgcg 3180

gcggctgcat acgcttgatc cggctacctg cccattcgac caccaagcga aacatcgcat 3240

cgagcgagca cgtactcgga tggaagccgg tcttgtcgat caggatgatc tggacgaaga 3300

gcatcagggg ctcgcgccag ccgaactgtt cgccaggctc aaggcgagca tgcccgacgg 3360

cgaggatctc gtcgtgaccc atggcgatgc ctgcttgccg aatatcatgg tggaaaatgg 3420

ccgcttttct ggattcatcg actgtggccg gctgggtgtg gcggaccgct atcaggacat 3480

agcgttggct acccgtgata ttgctgaaga gcttggcggc gaatgggctg accgcttcct 3540

cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc gccttctatc gccttcttga 3600

cgagttcttc tgaattatta acgcttacaa tttcctgatg cggtattttc tccttacgca 3660

tctgtgcggt atttcacacc gcatacaggt ggcacttttc ggggaaatgt gcgcggaacc 3720

cctatttgtt tatttttcta aatacattca aatatgtatc cgctcatgag acaataaccc 3780

tgataaatgc ttcaataata gcacgtgagg agggccacca tggccaagtt gaccagtgcc 3840

gttccggtgc tcaccgcgcg cgacgtcgcc ggagcggtcg agttctggac cgaccggctc 3900

gggttctccc gggacttcgt ggaggacgac ttcgccggtg tggtccggga cgacgtgacc 3960

ctgttcatca gcgcggtcca ggaccaggtg gtgccggaca acaccctggc ctgggtgtgg 4020

gtgcgcggcc tggacgagct gtacgccgag tggtcggagg tcgtgtccac gaacttccgg 4080

gacgcctccg ggccggccat gaccgagatc ggcgagcagc cgtgggggcg ggagttcgcc 4140

ctgcgcgacc cggccggcaa ctgcgtgcac ttcgtggccg aggagcagga ctgacacgtg 4200

ctaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg 4260

accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc 4320

aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa 4380

ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag 4440

gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta 4500

ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta 4560

ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag 4620

ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg 4680

gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg 4740

cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag 4800

cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc 4860

cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa 4920

aacgccagca acgcggcctt tttacggttc ctgggctttt gctggccttt tgctcacatg 4980

ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct 5040

gataccgctc gccgcagccg aacgaccgag cgcagcgagt ca 5082

<210> SEQ ID NO: 8

<211> LENGTH: 5352

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN251; TOPO-BLUNT-loxP-hphMX-loxP

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(5352)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“ /note=”pRN251;

TOPO-BLUNT-loxP-hphMX-loxP“ /mol_type=”unassigned DNA“

<400> SEQENCE: 8

agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 60

acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 120

tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 180

ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctat 240

ttaggtgaca ctatagaata ctcaagctat gcatcaagct tggtaccgag ctcggatcca 300

ctagtaacgg ccgccagtgt gctggaattc gccctttcat gacgtctcga ggcctataac 360

ttcgtatagc atacattata cgaagttatg cgcgctctag atatcgtcga gcggccgcca 420

gtgtgatgga tatcatcgat gaattcgagc tcgttttcga cactggatgg cggcgttagt 480

atcgaatcga cagcagtata gcgaccagca ttcacatacg attgacgcat gatattactt 540

tctgcgcact taacttcgca tctgggcaga tgatgtcgag gcgaaaaaaa atataaatca 600

cgctaacatt tgattaaaat agaacaacta caatataaaa aaactataca aatgacaagt 660

tcttgaaaac aagaatcttt ttattgtcag tactgattat tcctttgccc tcggacgagt 720

gctggggcgt cggtttccac tatcggcgag tacttctaca cagccatcgg tccagacggc 780

cgcgcttctg cgggcgattt gtgtacgccc gacagtcccg gctccggatc ggacgattgc 840

gtcgcatcga ccctgcgccc aagctgcatc atcgaaattg ccgtcaacca agctctgata 900

gagttggtca agaccaatgc ggagcatata cgcccggagc cgcggcgatc ctgcaagctc 960

cggatgcctc cgctcgaagt agcgcgtctg ctgctccata caagccaacc acggcctcca 1020

gaagaagatg ttggcgacct cgtattggga atccccgaac atcgcctcgc tccagtcaat 1080

gaccgctgtt atgcggccat tgtccgtcag gacattgttg gagccgaaat ccgcgtgcac 1140

gaggtgccgg acttcggggc agtcctcggc ccaaagcatc agctcatcga gagcctgcgc 1200

gacggacgca ctgacggtgt cgtccatcac agtttgccag tgatacacat ggggatcagc 1260

aatcgcgcat atgaaatcac gccatgtagt gtattgaccg attccttgcg gtccgaatgg 1320

gccgaacccg ctcgtctggc taagatcggc cgcagcgatc gcatccatgg cctccgcgac 1380

cggctgcaga acagcgggca gttcggtttc aggcaggtct tgcaacgtga caccctgtgc 1440

acggcgggag atgcaatagg tcaggctctc gctgaattcc ccaatgtcaa gcacttccgg 1500

aatcgggagc gcggccgatg caaagtgccg ataaacataa cgatctttgt agaaaccatc 1560

ggcgcagcta tttacccgca ggacatatcc acgccctcct acatcgaagc tgaaagcacg 1620

agattcttcg ccctccgaga gctgcatcag gtcggagacg ctgtcgaact tttcgatcag 1680

aaacttctcg acagacgtcg cggtgagttc aggcttttta cccatggttg tttatgttcg 1740

gatgtgatgt gagaactgta tcctagcaag attttaaaag gaagtatatg aaagaagaac 1800

ctcagtggca aatcctaacc ttttatattt ctctacaggg gcgcggcgtg gggacaattc 1860

acgcgtctgt gaggggagcg tttccctgct cgcaggtctg cagcgaggag ccgtaatttt 1920

tgcttcgcgc cgtgcggcca tcaaaatgta tggatgcaaa tgattataca tggggatgta 1980

tgggctaaat gtacgggcga cagtcacatc atgcccctga gctgcgcacg tcaagactgt 2040

caaggagggt attctgggcc tccatgtcgc tggccgggtg acccggcggg gacgaggcaa 2100

gcttaagggc gaattccagc acactggcgg ccgttactag aataacttcg tataatgtat 2160

gctatacgaa gttatacgta cgtccggata agggcgaatt ctgagatatc catcacactg 2220

gcggccgctc gagcatgcat ctagagggcc caattcgccc tatagtgagt cgtattacaa 2280

ttcactggcc gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa 2340

tcgccttgca gcacatcccc ctttcgccag ctggcgtaat agcgaagagg cccgcaccga 2400

tcgcccttcc caacagttgc gcagcctata cgtacggcag tttaaggttt acacctataa 2460

aagagagagc cgttatcgtc tgtttgtgga tgtacagagt gatattattg acacgccggg 2520

gcgacggatg gtgatccccc tggccagtgc acgtctgctg tcagataaag tctcccgtga 2580

actttacccg gtggtgcata tcggggatga aagctggcgc atgatgacca ccgatatggc 2640

cagtgtgccg gtctccgtta tcggggaaga agtggctgat ctcagccacc gcgaaaatga 2700

catcaaaaac gccattaacc tgatgttctg gggaatataa atgtcaggca tgagattatc 2760

aaaaaggatc ttcacctaga tccttttcac gtagaaagcc agtccgcaga aacggtgctg 2820

accccggatg aatgtcagct actgggctat ctggacaagg gaaaacgcaa gcgcaaagag 2880

aaagcaggta gcttgcagtg ggcttacatg gcgatagcta gactgggcgg ttttatggac 2940

agcaagcgaa ccggaattgc cagctggggc gccctctggt aaggttggga agccctgcaa 3000

agtaaactgg atggctttct cgccgccaag gatctgatgg cgcaggggat caagctctga 3060

tcaagagaca ggatgaggat cgtttcgcat gattgaacaa gatggattgc acgcaggttc 3120

tccggccgct tgggtggaga ggctattcgg ctatgactgg gcacaacaga caatcggctg 3180

ctctgatgcc gccgtgttcc ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac 3240

cgacctgtcc ggtgccctga atgaactgca agacgaggca gcgcggctat cgtggctggc 3300

cacgacgggc gttccttgcg cagctgtgct cgacgttgtc actgaagcgg gaagggactg 3360

gctgctattg ggcgaagtgc cggggcagga tctcctgtca tctcaccttg ctcctgccga 3420

gaaagtatcc atcatggctg atgcaatgcg gcggctgcat acgcttgatc cggctacctg 3480

cccattcgac caccaagcga aacatcgcat cgagcgagca cgtactcgga tggaagccgg 3540

tcttgtcgat caggatgatc tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt 3600

cgccaggctc aaggcgagca tgcccgacgg cgaggatctc gtcgtgaccc atggcgatgc 3660

ctgcttgccg aatatcatgg tggaaaatgg ccgcttttct ggattcatcg actgtggccg 3720

gctgggtgtg gcggaccgct atcaggacat agcgttggct acccgtgata ttgctgaaga 3780

gcttggcggc gaatgggctg accgcttcct cgtgctttac ggtatcgccg ctcccgattc 3840

gcagcgcatc gccttctatc gccttcttga cgagttcttc tgaattatta acgcttacaa 3900

tttcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatacaggt 3960

ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca 4020

aatatgtatc cgctcatgag acaataaccc tgataaatgc ttcaataata gcacgtgagg 4080

agggccacca tggccaagtt gaccagtgcc gttccggtgc tcaccgcgcg cgacgtcgcc 4140

ggagcggtcg agttctggac cgaccggctc gggttctccc gggacttcgt ggaggacgac 4200

ttcgccggtg tggtccggga cgacgtgacc ctgttcatca gcgcggtcca ggaccaggtg 4260

gtgccggaca acaccctggc ctgggtgtgg gtgcgcggcc tggacgagct gtacgccgag 4320

tggtcggagg tcgtgtccac gaacttccgg gacgcctccg ggccggccat gaccgagatc 4380

ggcgagcagc cgtgggggcg ggagttcgcc ctgcgcgacc cggccggcaa ctgcgtgcac 4440

ttcgtggccg aggagcagga ctgacacgtg ctaaaacttc atttttaatt taaaaggatc 4500

taggtgaaga tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc 4560

cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg 4620

cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg 4680

gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca 4740

aatactgtcc ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg 4800

cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg 4860

tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga 4920

acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac 4980

ctacagcgtg agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat 5040

ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc 5100

tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga 5160

tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc 5220

ctgggctttt gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg 5280

gataaccgta ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag 5340

cgcagcgagt ca 5352

<210> SEQ ID NO: 9

<211> LENGTH: 4847

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN365; TOPO-BLUNT-loxP-natMX-loxP

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(4847)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“ /note=”pRN365;

TOPO-BLUNT-loxP-natMX-loxP“ /mol_type=”unassigned DNA“

<400> SEQENCE: 9

agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 60

acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 120

tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 180

ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctat 240

ttaggtgaca ctatagaata ctcaagctat gcatcaagct tggtaccgag ctcggatcca 300

ctagtaacgg ccgccagtgt gctggaattc gcccttatcc ggacgtacgt ataacttcgt 360

atagcataca ttatacgaag ttattctagt aacggccgcc agtgtgctgg aattcgccct 420

taagcttgcc tcgtccccgc cgggtcaccc ggccagcgac atggaggccc agaataccct 480

ccttgacagt cttgacgtgc gcagctcagg ggcatgatgt gactgtcgcc cgtacattta 540

gcccatacat ccccatgtat aatcatttgc atccatacat tttgatggcc gcacggcgcg 600

aagcaaaaat tacggctcct cgctgcagac ctgcgagcag ggaaacgctc ccctcacaga 660

cgcgttgaat tgtccccacg ccgcgcccct gtagagaaat ataaaaggtt aggatttgcc 720

actgaggttc ttctttcata tacttccttt taaaatcttg ctaggataca gttctcacat 780

cacatccgaa cataaacaac catgtaaaat gaccactctt gacgacacgg cttaccggta 840

ccgcaccagt gtcccggggg acgccgaggc catcgaggca ctggatgggt ccttcaccac 900

cgacaccgtc ttccgcgtca ccgccaccgg ggacggcttc accctgcggg aggtgccggt 960

ggacccgccc ctgaccaagg tgttccccga cgacgaatcg gacgacgaat cggacgccgg 1020

ggaggacggc gacccggact cccggacgtt cgtcgcgtac ggggacgacg gcgacctggc 1080

gggcttcgtg gtcgtctcgt actccggctg gaaccgccgg ctgaccgtcg aggacatcga 1140

ggtcgccccg gagcaccggg ggcacggggt cgggcgcgcg ttgatggggc tcgcgacgga 1200

gttcgcccgc gagcggggcg ccgggcacct ctggctggag gtcaccaacg tcaacgcacc 1260

ggcgatccac gcgtaccggc ggatggggtt caccctctgc ggcctggaca ccgccctgta 1320

cgacggcacc gcctcggacg gcgagcaggc gctctacatg agcatgccct gcccctagta 1380

ctgacaataa aaagattctt gttttcaaga acttgtcatt tgtatagttt ttttatattg 1440

tagttgttct attttaatca aatgttagcg tgatttatat tttttttcgc ctcgacatca 1500

tctgcccaga tgcgaagtta agtgcgcaga aagtaatatc atgcgtcaat cgtatgtgaa 1560

tgctggtcgc tatactgctg tcgattcgat actaacgccg ccatccagtg tcgacgatat 1620

ctagagcgcg cataacttcg tataatgtat gctatacgaa gttataggcc tcgagacgtc 1680

atgaaagggc gaattctgag atatccatca cactggcggc cgctcgagca tgcatctaga 1740

gggcccaatt cgccctatag tgagtcgtat tacaattcac tggccgtcgt tttacaacgt 1800

cgtgactggg aaaaccctgg cgttacccaa cttaatcgcc ttgcagcaca tccccctttc 1860

gccagctggc gtaatagcga agaggcccgc accgatcgcc cttcccaaca gttgcgcagc 1920

ctatacgtac ggcagtttaa ggtttacacc tataaaagag agagccgtta tcgtctgttt 1980

gtggatgtac agagtgatat tattgacacg ccggggcgac ggatggtgat ccccctggcc 2040

agtgcacgtc tgctgtcaga taaagtctcc cgtgaacttt acccggtggt gcatatcggg 2100

gatgaaagct ggcgcatgat gaccaccgat atggccagtg tgccggtctc cgttatcggg 2160

gaagaagtgg ctgatctcag ccaccgcgaa aatgacatca aaaacgccat taacctgatg 2220

ttctggggaa tataaatgtc aggcatgaga ttatcaaaaa ggatcttcac ctagatcctt 2280

ttcacgtaga aagccagtcc gcagaaacgg tgctgacccc ggatgaatgt cagctactgg 2340

gctatctgga caagggaaaa cgcaagcgca aagagaaagc aggtagcttg cagtgggctt 2400

acatggcgat agctagactg ggcggtttta tggacagcaa gcgaaccgga attgccagct 2460

ggggcgccct ctggtaaggt tgggaagccc tgcaaagtaa actggatggc tttctcgccg 2520

ccaaggatct gatggcgcag gggatcaagc tctgatcaag agacaggatg aggatcgttt 2580

cgcatgattg aacaagatgg attgcacgca ggttctccgg ccgcttgggt ggagaggcta 2640

ttcggctatg actgggcaca acagacaatc ggctgctctg atgccgccgt gttccggctg 2700

tcagcgcagg ggcgcccggt tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa 2760

ctgcaagacg aggcagcgcg gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct 2820

gtgctcgacg ttgtcactga agcgggaagg gactggctgc tattgggcga agtgccgggg 2880

caggatctcc tgtcatctca ccttgctcct gccgagaaag tatccatcat ggctgatgca 2940

atgcggcggc tgcatacgct tgatccggct acctgcccat tcgaccacca agcgaaacat 3000

cgcatcgagc gagcacgtac tcggatggaa gccggtcttg tcgatcagga tgatctggac 3060

gaagagcatc aggggctcgc gccagccgaa ctgttcgcca ggctcaaggc gagcatgccc 3120

gacggcgagg atctcgtcgt gacccatggc gatgcctgct tgccgaatat catggtggaa 3180

aatggccgct tttctggatt catcgactgt ggccggctgg gtgtggcgga ccgctatcag 3240

gacatagcgt tggctacccg tgatattgct gaagagcttg gcggcgaatg ggctgaccgc 3300

ttcctcgtgc tttacggtat cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt 3360

cttgacgagt tcttctgaat tattaacgct tacaatttcc tgatgcggta ttttctcctt 3420

acgcatctgt gcggtatttc acaccgcata caggtggcac ttttcgggga aatgtgcgcg 3480

gaacccctat ttgtttattt ttctaaatac attcaaatat gtatccgctc atgagacaat 3540

aaccctgata aatgcttcaa taatagcacg tgaggagggc caccatggcc aagttgacca 3600

gtgccgttcc ggtgctcacc gcgcgcgacg tcgccggagc ggtcgagttc tggaccgacc 3660

ggctcgggtt ctcccgggac ttcgtggagg acgacttcgc cggtgtggtc cgggacgacg 3720

tgaccctgtt catcagcgcg gtccaggacc aggtggtgcc ggacaacacc ctggcctggg 3780

tgtgggtgcg cggcctggac gagctgtacg ccgagtggtc ggaggtcgtg tccacgaact 3840

tccgggacgc ctccgggccg gccatgaccg agatcggcga gcagccgtgg gggcgggagt 3900

tcgccctgcg cgacccggcc ggcaactgcg tgcacttcgt ggccgaggag caggactgac 3960

acgtgctaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc 4020

tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa 4080

agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa 4140

aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc 4200

cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt 4260

agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc 4320

tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac 4380

gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca 4440

gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg 4500

ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag 4560

gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt 4620

ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat 4680

ggaaaaacgc cagcaacgcg gcctttttac ggttcctggg cttttgctgg ccttttgctc 4740

acatgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt 4800

gagctgatac cgctcgccgc agccgaacga ccgagcgcag cgagtca 4847

<210> SEQ ID NO: 10

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 115-natf

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(32)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 115-natf“ /mol_type=”unassigned DNA“

<400> SEQENCE: 10

acatgtaaaa tgaccactct tgacgacacg gc 32

<210> SEQ ID NO: 11

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 116-natr

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(25)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 116-natr“ /mol_type=”unassigned DNA“

<400> SEQENCE: 11

cagtactagg ggccagggca tgctc 25

<210> SEQ ID NO: 12

<211> LENGTH: 4254

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN447; TOPO-BLUNT-loxP-zeoMX-loxP

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(4254)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“ /note=”pRN447;

TOPO-BLUNT-loxP-zeoMX-loxP“ /mol_type=”unassigned DNA“

<400> SEQENCE: 12

agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 60

acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 120

tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 180

ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctat 240

ttaggtgaca ctatagaata ctcaagctat gcatcaagct tggtaccgag ctcggatcca 300

ctagtaacgg ccgccagtgt gctggaattc gcccttatcc ggacgtacgt ataacttcgt 360

atagcataca ttatacgaag ttattctagt aacggccgcc agtgtgctgg aattcgccct 420

taagcttgcc tcgtccccgc cgggtcaccc ggccagcgac atggaggccc agaataccct 480

ccttgacagt cttgacgtgc gcagctcagg ggcatgatgt gactgtcgcc cgtacattta 540

gcccatacat ccccatgtat aatcatttgc atccatacat tttgatggcc gcacggcgcg 600

aagcaaaaat tacggctcct cgctgcagac ctgcgagcag ggaaacgctc ccctcacaga 660

cgcgttgaat tgtccccacg ccgcgcccct gtagagaaat ataaaaggtt aggatttgcc 720

actgaggttc ttctttcata tacttccttt taaaatcttg ctaggataca gttctcacat 780

cacatccgaa cataaacaac catggccaag ttgaccagtg ccgttccggt gctcaccgcg 840

cgcgacgtcg ccggagcggt cgagttctgg accgaccggc tcgggttctc ccgggacttc 900

gtggaggacg acttcgccgg tgtggtccgg gacgacgtga ccctgttcat cagcgcggtc 960

caggaccagg tggtgccgga caacaccctg gcctgggtgt gggtgcgcgg cctggacgag 1020

ctgtacgccg agtggtcgga ggtcgtgtcc acgaacttcc gggacgcctc cgggccggcc 1080

atgaccgaga tcggcgagca gccgtggggg cgggagttcg ccctgcgcga cccggccggc 1140

aactgcgtgc acttcgtggc cgaggagcag gactgacaca ctgacaataa aaagattctt 1200

gttttcaaga acttgtcatt tgtatagttt ttttatattg tagttgttct attttaatca 1260

aatgttagcg tgatttatat tttttttcgc ctcgacatca tctgcccaga tgcgaagtta 1320

agtgcgcaga aagtaatatc atgcgtcaat cgtatgtgaa tgctggtcgc tatactgctg 1380

tcgattcgat actaacgccg ccatccagtg tcgacgatat ctagagcgcg cataacttcg 1440

tataatgtat gctatacgaa gttataggcc tcgagacgtc atgaaagggc gaattctgag 1500

atatccatca cactggcggc cgctcgagca tgcatctaga gggcccaatt cgccctatag 1560

tgagtcgtat tacaattcac tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg 1620

cgttacccaa cttaatcgcc ttgcagcaca tccccctttc gccagctggc gtaatagcga 1680

agaggcccgc accgatcgcc cttcccaaca gttgcgcagc ctatacgtac ggcagtttaa 1740

ggtttacacc tataaaagag agagccgtta tcgtctgttt gtggatgtac agagtgatat 1800

tattgacacg ccggggcgac ggatggtgat ccccctggcc agtgcacgtc tgctgtcaga 1860

taaagtctcc cgtgaacttt acccggtggt gcatatcggg gatgaaagct ggcgcatgat 1920

gaccaccgat atggccagtg tgccggtctc cgttatcggg gaagaagtgg ctgatctcag 1980

ccaccgcgaa aatgacatca aaaacgccat taacctgatg ttctggggaa tataaatgtc 2040

aggcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttcacgtaga aagccagtcc 2100

gcagaaacgg tgctgacccc ggatgaatgt cagctactgg gctatctgga caagggaaaa 2160

cgcaagcgca aagagaaagc aggtagcttg cagtgggctt acatggcgat agctagactg 2220

ggcggtttta tggacagcaa gcgaaccgga attgccagct ggggcgccct ctggtaaggt 2280

tgggaagccc tgcaaagtaa actggatggc tttctcgccg ccaaggatct gatggcgcag 2340

gggatcaagc tctgatcaag agacaggatg aggatcgttt cgcatgattg aacaagatgg 2400

attgcacgca ggttctccgg ccgcttgggt ggagaggcta ttcggctatg actgggcaca 2460

acagacaatc ggctgctctg atgccgccgt gttccggctg tcagcgcagg ggcgcccggt 2520

tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa ctgcaagacg aggcagcgcg 2580

gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga 2640

agcgggaagg gactggctgc tattgggcga agtgccgggg caggatctcc tgtcatctca 2700

ccttgctcct gccgagaaag tatccatcat ggctgatgca atgcggcggc tgcatacgct 2760

tgatccggct acctgcccat tcgaccacca agcgaaacat cgcatcgagc gagcacgtac 2820

tcggatggaa gccggtcttg tcgatcagga tgatctggac gaagagcatc aggggctcgc 2880

gccagccgaa ctgttcgcca ggctcaaggc gagcatgccc gacggcgagg atctcgtcgt 2940

gacccatggc gatgcctgct tgccgaatat catggtggaa aatggccgct tttctggatt 3000

catcgactgt ggccggctgg gtgtggcgga ccgctatcag gacatagcgt tggctacccg 3060

tgatattgct gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat 3120

cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt tcttctgaat 3180

tattaacgct tacaatttcc tgatgcggta ttttctcctt acgcatctgt gcggtatttc 3240

acaccgcata caggtggcac ttttcgggga aatgtgcgcg gaacccctat ttgtttattt 3300

ttctaaatac attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa 3360

taatagcacg tgctaaaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt 3420

gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc 3480

gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg 3540

caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact 3600

ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg 3660

tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg 3720

ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac 3780

tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca 3840

cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga 3900

gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc 3960

ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct 4020

gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg 4080

agcctatgga aaaacgccag caacgcggcc tttttacggt tcctgggctt ttgctggcct 4140

tttgctcaca tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc 4200

tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtca 4254

<210> SEQ ID NO: 13

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 28-H3f

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(45)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 28-H3f“ /mol_type=”unassigned DNA“

<400> SEQENCE: 13

tgtacatccg gaattctaga ttggtgagcg ctaggagtca ctgcc 45

<210> SEQ ID NO: 14

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 29-H3r

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(32)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 29-H3r“ /mol_type=”unassigned DNA“

<400> SEQENCE: 14

ctcgagtatt tcacaccgca tatgatccgt cg 32

<210> SEQ ID NO: 15

<211> LENGTH: 6000

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN247 (TOPO- BLUNT-HIS3::loxPkanMXloxP

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(6000)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”pRN247 (TOPO- BLUNT-HIS3::loxPkanMXloxP)“

/mol_type=”unassigned DNA“

<400> SEQENCE: 15

ggccgccaga tcttccggat ggctcgagtt tttcagcaag atcgcgagta tttcacaccg 60

catatgatcc gtcgagttca agagaaaaaa aaagaaaaag caaaaagaaa aaaggaaagc 120

gcgcctcgtt cagaatgaca cgtatagaat gatgcattac cttgtcatct tcagtatcat 180

actgttcgta tacatactta ctgacattca taggtataca tatatacaca tgtatatata 240

tcgtatgctg cagctttaaa taatcggtgt cactacataa gaacaccttt ggtggaggga 300

acatcgttgg taccattggg cgaggtggct tctcttatgg caaccgcaag agccttgaac 360

gcactctcac tacggtgatg atcattcttg cctcgcagac aatcaacgtg gagggtaatt 420

ctgctagcct ctgcaaagct ttcaagaaaa tgcgggatca tctcgcaaga gagatctcct 480

actttctccc tttgcaaacc aagttcgaca actgcgtacg tataacttcg tatagcatac 540

attatacgaa gttattctag taacggccgc cagtgtgctg gaattcgccc ttaagcttgc 600

ctcgtccccg ccgggtcacc cggccagcga catggaggcc cagaataccc tccttgacag 660

tcttgacgtg cgcagctcag gggcatgatg tgactgtcgc ccgtacattt agcccataca 720

tccccatgta taatcatttg catccataca ttttgatggc cgcacggcgc gaagcaaaaa 780

ttacggctcc tcgctgcaga cctgcgagca gggaaacgct cccctcacag acgcgttgaa 840

ttgtccccac gccgcgcccc tgtagagaaa tataaaaggt taggatttgc cactgaggtt 900

cttctttcat atacttcctt ttaaaatctt gctaggatac agttctcaca tcacatccga 960

acataaacaa ccatgggtaa ggaaaagact cacgtttcga ggccgcgatt aaattccaac 1020

atggatgctg atttatatgg gtataaatgg gctcgcgata atgtcgggca atcaggtgcg 1080

acaatctatc gattgtatgg gaagcccgat gcgccagagt tgtttctgaa acatggcaaa 1140

ggtagcgttg ccaatgatgt tacagatgag atggtcagac taaactggct gacggaattt 1200

atgcctcttc cgaccatcaa gcattttatc cgtactcctg atgatgcatg gttactcacc 1260

actgcgatcc ccggcaaaac agcattccag gtattagaag aatatcctga ttcaggtgaa 1320

aatattgttg atgcgctggc agtgttcctg cgccggttgc attcgattcc tgtttgtaat 1380

tgtcctttta acagcgatcg cgtatttcgt ctcgctcagg cgcaatcacg aatgaataac 1440

ggtttggttg atgcgagtga ttttgatgac gagcgtaatg gctggcctgt tgaacaagtc 1500

tggaaagaaa tgcataagct tttgccattc tcaccggatt cagtcgtcac tcatggtgat 1560

ttctcacttg ataaccttat ttttgacgag gggaaattaa taggttgtat tgatgttgga 1620

cgagtcggaa tcgcagaccg ataccaggat cttgccatcc tatggaactg cctcggtgag 1680

ttttctcctt cattacagaa acggcttttt caaaaatatg gtattgataa tcctgatatg 1740

aataaattgc agtttcattt gatgctcgat gagtttttct aatcagtact gacaataaaa 1800

agattcttgt tttcaagaac ttgtcatttg tatagttttt ttatattgta gttgttctat 1860

tttaatcaaa tgttagcgtg atttatattt tttttcgcct cgacatcatc tgcccagatg 1920

cgaagttaag tgcgcagaaa gtaatatcat gcgtcaatcg tatgtgaatg ctggtcgcta 1980

tactgctgtc gattcgatac taacgccgcc atccagtgtc gacgatatct agagcgcgca 2040

taacttcgta taatgtatgc tatacgaagt tataggaaag agatcgcaat ctgaatcttg 2100

gtttcatttg taatacgctt tactagggct ttctgctctg tcatctttgc cttcgtttat 2160

cttgcctgct cattttttag tatattcttc gaagaaatca cattacttta tataatgtat 2220

aattcattat gtgataatgc caatcgctaa gaaaaaaaaa gagtcatccg ctaggtggaa 2280

aaaaaaaaat gaaaatcatt accgaggcat aaaaaaatat agagtgtact agaggaggcc 2340

aagagtaata gaaaaagaaa attgcgggaa aggactgtgt tatgacttcc ctgactaatg 2400

ccgtgttcaa acgatacctg gcagtgactc ctagcgctca ccaatctaga attccggatg 2460

tacaatcttt ctagaagatc tcctacaata ttctcagctg cttaagggcg aattctgaga 2520

tatccatcac actggcggcc gctcgagcat gcatctagag ggcccaattc gccctatagt 2580

gagtcgtatt acaattcact ggccgtcgtt ttacaacgtc gtgactggga aaaccctggc 2640

gttacccaac ttaatcgcct tgcagcacat ccccctttcg ccagctggcg taatagcgaa 2700

gaggcccgca ccgatcgccc ttcccaacag ttgcgcagcc tatacgtacg gcagtttaag 2760

gtttacacct ataaaagaga gagccgttat cgtctgtttg tggatgtaca gagtgatatt 2820

attgacacgc cggggcgacg gatggtgatc cccctggcca gtgcacgtct gctgtcagat 2880

aaagtctccc gtgaacttta cccggtggtg catatcgggg atgaaagctg gcgcatgatg 2940

accaccgata tggccagtgt gccggtctcc gttatcgggg aagaagtggc tgatctcagc 3000

caccgcgaaa atgacatcaa aaacgccatt aacctgatgt tctggggaat ataaatgtca 3060

ggcatgagat tatcaaaaag gatcttcacc tagatccttt tcacgtagaa agccagtccg 3120

cagaaacggt gctgaccccg gatgaatgtc agctactggg ctatctggac aagggaaaac 3180

gcaagcgcaa agagaaagca ggtagcttgc agtgggctta catggcgata gctagactgg 3240

gcggttttat ggacagcaag cgaaccggaa ttgccagctg gggcgccctc tggtaaggtt 3300

gggaagccct gcaaagtaaa ctggatggct ttctcgccgc caaggatctg atggcgcagg 3360

ggatcaagct ctgatcaaga gacaggatga ggatcgtttc gcatgattga acaagatgga 3420

ttgcacgcag gttctccggc cgcttgggtg gagaggctat tcggctatga ctgggcacaa 3480

cagacaatcg gctgctctga tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt 3540

ctttttgtca agaccgacct gtccggtgcc ctgaatgaac tgcaagacga ggcagcgcgg 3600

ctatcgtggc tggccacgac gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa 3660

gcgggaaggg actggctgct attgggcgaa gtgccggggc aggatctcct gtcatctcac 3720

cttgctcctg ccgagaaagt atccatcatg gctgatgcaa tgcggcggct gcatacgctt 3780

gatccggcta cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact 3840

cggatggaag ccggtcttgt cgatcaggat gatctggacg aagagcatca ggggctcgcg 3900

ccagccgaac tgttcgccag gctcaaggcg agcatgcccg acggcgagga tctcgtcgtg 3960

acccatggcg atgcctgctt gccgaatatc atggtggaaa atggccgctt ttctggattc 4020

atcgactgtg gccggctggg tgtggcggac cgctatcagg acatagcgtt ggctacccgt 4080

gatattgctg aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc 4140

gccgctcccg attcgcagcg catcgccttc tatcgccttc ttgacgagtt cttctgaatt 4200

attaacgctt acaatttcct gatgcggtat tttctcctta cgcatctgtg cggtatttca 4260

caccgcatac aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 4320

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 4380

aatagcacgt gaggagggcc accatggcca agttgaccag tgccgttccg gtgctcaccg 4440

cgcgcgacgt cgccggagcg gtcgagttct ggaccgaccg gctcgggttc tcccgggact 4500

tcgtggagga cgacttcgcc ggtgtggtcc gggacgacgt gaccctgttc atcagcgcgg 4560

tccaggacca ggtggtgccg gacaacaccc tggcctgggt gtgggtgcgc ggcctggacg 4620

agctgtacgc cgagtggtcg gaggtcgtgt ccacgaactt ccgggacgcc tccgggccgg 4680

ccatgaccga gatcggcgag cagccgtggg ggcgggagtt cgccctgcgc gacccggccg 4740

gcaactgcgt gcacttcgtg gccgaggagc aggactgaca cgtgctaaaa cttcattttt 4800

aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa atcccttaac 4860

gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag 4920

atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg 4980

tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca 5040

gagcgcagat accaaatact gtccttctag tgtagccgta gttaggccac cacttcaaga 5100

actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca 5160

gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc 5220

agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca 5280

ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc gaagggagaa 5340

aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagcttc 5400

cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc 5460

gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg 5520

cctttttacg gttcctgggc ttttgctggc cttttgctca catgttcttt cctgcgttat 5580

cccctgattc tgtggataac cgtattaccg cctttgagtg agctgatacc gctcgccgca 5640

gccgaacgac cgagcgcagc gagtcaagcg cccaatacgc aaaccgcctc tccccgcgcg 5700

ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag cgggcagtga 5760

gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt tacactttat 5820

gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca caggaaacag 5880

ctatgaccat gattacgcca agctatttag gtgacactat agaatactca agctatgcat 5940

caagcttggt accgagctcg gatccactag taacggccgc cagtgtgctg gaattcgccc 6000

<210> SEQ ID NO: 16

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 201-Hx2uf

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(35)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 201-Hx2uf“ /mol_type=”unassigned DNA“

<400> SEQENCE: 16

gactagtacc ggtgttttca aaacctagca acccc 35

<210> SEQ ID NO: 17

<211> LENGTH: 43

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 202-Hx2ur

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(43)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 202-Hx2ur“ /mol_type=”unassigned DNA“

<400> SEQENCE: 17

cgtacgcgtc ttccggaagg gtaccatcag atttcatttg acc 43

<210> SEQ ID NO: 18

<211> LENGTH: 40

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 203-Hx2df

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(40)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 203-Hx2df“ /mol_type=”unassigned DNA“

<400> SEQENCE: 18

gaagacactc gagacgtcct ttgtctgtga aaccaagggc 40

<210> SEQ ID NO: 19

<211> LENGTH: 39

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 204-Hx2dr

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(39)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 204-Hx2dr“ /mol_type=”unassigned DNA“

<400> SEQENCE: 19

gtcgacgggc ccttatgttg gtcttgttta gtatggccg 39

<210> SEQ ID NO: 20

<211> LENGTH: 48

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 205-Hx3uf

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(48)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 205-Hx3uf“ /mol_type=”unassigned DNA“

<400> SEQENCE: 20

aagcggccgc actagtaccg gtgaaacaac tcaataacga tgtgggac 48

<210> SEQ ID NO: 21

<211> LENGTH: 38

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer

206-Hx3urATCCGGACGTCTTCCTCAAGAAATCAGTTTGGGCGACG

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(38)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“ /note=”primer

206-Hx3urATCCGGACGTCTTCCTCAAGAAATCAGTTTGGGCGACG“

/mol_type=”unassigned DNA“

<400> SEQENCE: 21

atccggacgt cttcctcaag aaatcagttt gggcgacg 38

<210> SEQ ID NO: 22

<211> LENGTH: 44

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 210-Hx4df

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(44)

<223> OTHER INFORMATION: /organism=”Artificial Sequence“

/note=”primer 210-Hx4df“ /mol_type=”unassigned DNA“

<400> SEQENCE: 22

agaagacgct cgagacgtcc cttatgggaa gaaggtgttt tgcc 44

<210> SEQ ID NO: 23

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 211-Hx4dr”

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(34)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 211-Hx4dr” /mol_type=“unassigned DNA”

<400> SEQENCE: 23

atggatccta ggggttcttg cagagtaaac tgcg 34

<210> SEQ ID NO: 24

<211> LENGTH: 46

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 212-Hx5uf

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(46)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 212-Hx5uf” /mol_type=“unassigned DNA”

<400> SEQENCE: 24

aagcggccgc actagtacat gtgaacttga aaacgctcat caaggc 46

<210> SEQ ID NO: 25

<211> LENGTH: 43

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 213-Hx5ur

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(43)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 213-Hx5ur” /mol_type=“unassigned DNA”

<400> SEQENCE: 25

ttcgtacgcg tcttccggag taacatgaaa ccagagtacc acg 43

<210> SEQ ID NO: 26

<211> LENGTH: 42

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 229-Hx7df

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(42)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 229-Hx7df” /mol_type=“unassigned DNA”

<400> SEQENCE: 26

agaagaccct cgagacgtcc gacgctgaag aaatgactca cg 42

<210> SEQ ID NO: 27

<211> LENGTH: 42

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 230-Hx7dr

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(42)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 230-Hx7dr” /mol_type=“unassigned DNA”

<400> SEQENCE: 27

agtcgacgga tccgtaattt ttcttctttt aagtgacggg cg 42

<210> SEQ ID NO: 28

<211> LENGTH: 44

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 243-Gal2ufn

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(44)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 243-Gal2ufn” /mol_type=“unassigned DNA”

<400> SEQENCE: 28

aagcggccgc actagtaccg gtgatctata ttcgaaaggg gcgg 44

<210> SEQ ID NO: 29

<211> LENGTH: 43

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 244-Gal2urn

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(43)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 244-Gal2urn” /mol_type=“unassigned DNA”

<400> SEQENCE: 29

aacgtacgtc cggatcatta gaatactttt gagattgtgc gct 43

<210> SEQ ID NO: 30

<211> LENGTH: 43

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 233-Ga2df

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(43)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 233-Ga2df” /mol_type=“unassigned DNA”

<400> SEQENCE: 30

agaagaccct cgagacgtct taccttggaa atctgaaggc tgg 43

<210> SEQ ID NO: 31

<211> LENGTH: 36

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 234-Ga2dr

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(36)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 234-Ga2dr” /mol_type=“unassigned DNA”

<400> SEQENCE: 31

gtggatccta ggtaaaacgg tacgagaaaa gctccg 36

<210> SEQ ID NO: 32

<211> LENGTH: 5959

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN485; TOPO-BLUNT-GAL2::loxPzeoMXloxP

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(5959)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“pRN485;

TOPO-BLUNT-GAL2::loxPzeoMXloxP” /mol_type=“unassigned DNA”

<400> SEQENCE: 32

agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 60

acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 120

tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 180

ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctat 240

ttaggtgaca ctatagaata ctcaagctat gcatcaagct tggtaccgag ctcggatcca 300

ctagtaacgg ccgccagtgt gctggaattc gcccttgtgg atcctaggaa tggatgatgg 360

taaaacggta cgagaaaagc tccgagacgt tgaattgaat attaataggt tgcaggttga 420

tataaaagaa ataaaggaaa tgcttgttac actgataaac aaatgactga aaaaagcaac 480

tcctggatcg ttcgaacatt ctcactccat taattgtatg ttagctcagg aattcaactg 540

gaagaaagtc caggcaagta cctgacttat tttctagagg accccccaga gataagtctg 600

gtgatgtggt cctttaataa tttcataggg acaattcatt ttgcgttttt aattttgctc 660

ggtgaacaaa ggatggcaga gcatgttatc gttttctttt ttttttcctg ttttagagaa 720

aaaggttata tatgtaataa tactctgata tatgtacaca aataataggt ttaggtaagg 780

aatttatata atcgtaagga tatcattgat aagggaaatt tttttttttt tttttcaaac 840

aaatactatg ataattaaaa tgaagaaaaa acgtcagtca tgaaaaatta agagagatga 900

tggagcgtct cacttcaaac gcattattct agcatggcct tgtaccacgg tttgtcgtca 960

tgttgtaaat cctctaaatc gtaattatta cctcttctgg atgaaggaat ccagccttca 1020

gatttccaag gtaagacgtc tcgaggccta taacttcgta tagcatacat tatacgaagt 1080

tatgcgcgct ctagatatcg tcgacactgg atggcggcgt tagtatcgaa tcgacagcag 1140

tatagcgacc agcattcaca tacgattgac gcatgatatt actttctgcg cacttaactt 1200

cgcatctggg cagatgatgt cgaggcgaaa aaaaatataa atcacgctaa catttgatta 1260

aaatagaaca actacaatat aaaaaaacta tacaaatgac aagttcttga aaacaagaat 1320

ctttttattg tcagtgtgtc agtcctgctc ctcggccacg aagtgcacgc agttgccggc 1380

cgggtcgcgc agggcgaact cccgccccca cggctgctcg ccgatctcgg tcatggccgg 1440

cccggaggcg tcccggaagt tcgtggacac gacctccgac cactcggcgt acagctcgtc 1500

caggccgcgc acccacaccc aggccagggt gttgtccggc accacctggt cctggaccgc 1560

gctgatgaac agggtcacgt cgtcccggac cacaccggcg aagtcgtcct ccacgaagtc 1620

ccgggagaac ccgagccggt cggtccagaa ctcgaccgct ccggcgacgt cgcgcgcggt 1680

gagcaccgga acggcactgg tcaacttggc catggttgtt tatgttcgga tgtgatgtga 1740

gaactgtatc ctagcaagat tttaaaagga agtatatgaa agaagaacct cagtggcaaa 1800

tcctaacctt ttatatttct ctacaggggc gcggcgtggg gacaattcaa cgcgtctgtg 1860

aggggagcgt ttccctgctc gcaggtctgc agcgaggagc cgtaattttt gcttcgcgcc 1920

gtgcggccat caaaatgtat ggatgcaaat gattatacat ggggatgtat gggctaaatg 1980

tacgggcgac agtcacatca tgcccctgag ctgcgcacgt caagactgtc aaggagggta 2040

ttctgggcct ccatgtcgct ggccgggtga cccggcgggg acgaggcaag cttaagggcg 2100

aattccagca cactggcggc cgttactaga ataacttcgt ataatgtatg ctatacgaag 2160

ttatacgtac gtccggatca ttagaatact tttgagattg tgcgcttaaa tgggaatctt 2220

tactgagtga agagatcacg tcttcaccag cttggggttg ctgtgaaaca acaggcatat 2280

tgttctcctc aactgccatt atgaaagaat tatttttttt attatgttaa tcttgtgttt 2340

acttaactat tactattctt gatgataatt gaataaggtg cataatgaag agcaattcac 2400

aacaccaaat tttcaatcca attactgatt gtttatatat gtctacaaaa cttatcctat 2460

ctccacattt tagcctgcga aatgtttgtt ttttgaacaa tagctctcca gaatgttgta 2520

taatttaaga atatgtgcac agttaacttt ctagcaggag tataatgcca tttgctcccc 2580

atcttgagat gggaagggct taactaatct cggttcggag tgatccgccc cgatactgcc 2640

ttctgcctta atatcgtcca aggcacatgg acccctgaac ggcgcagata tctccgcacg 2700

gacgaaagac cgccggtgcc ttcctgaggc aaccgcccct ttcgaatata gatcaccggt 2760

actagtgcgg ccgcttaagg gcgaattctg cagatatcca tcacactggc ggccgctcga 2820

gcatgcatct agagggccca attcgcccta tagtgagtcg tattacaatt cactggccgt 2880

cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc 2940

acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca 3000

acagttgcgc agcctatacg tacggcagtt taaggtttac acctataaaa gagagagccg 3060

ttatcgtctg tttgtggatg tacagagtga tattattgac acgccggggc gacggatggt 3120

gatccccctg gccagtgcac gtctgctgtc agataaagtc tcccgtgaac tttacccggt 3180

ggtgcatatc ggggatgaaa gctggcgcat gatgaccacc gatatggcca gtgtgccggt 3240

ctccgttatc ggggaagaag tggctgatct cagccaccgc gaaaatgaca tcaaaaacgc 3300

cattaacctg atgttctggg gaatataaat gtcaggcatg agattatcaa aaaggatctt 3360

cacctagatc cttttcacgt agaaagccag tccgcagaaa cggtgctgac cccggatgaa 3420

tgtcagctac tgggctatct ggacaaggga aaacgcaagc gcaaagagaa agcaggtagc 3480

ttgcagtggg cttacatggc gatagctaga ctgggcggtt ttatggacag caagcgaacc 3540

ggaattgcca gctggggcgc cctctggtaa ggttgggaag ccctgcaaag taaactggat 3600

ggctttctcg ccgccaagga tctgatggcg caggggatca agctctgatc aagagacagg 3660

atgaggatcg tttcgcatga ttgaacaaga tggattgcac gcaggttctc cggccgcttg 3720

ggtggagagg ctattcggct atgactgggc acaacagaca atcggctgct ctgatgccgc 3780

cgtgttccgg ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg acctgtccgg 3840

tgccctgaat gaactgcaag acgaggcagc gcggctatcg tggctggcca cgacgggcgt 3900

tccttgcgca gctgtgctcg acgttgtcac tgaagcggga agggactggc tgctattggg 3960

cgaagtgccg gggcaggatc tcctgtcatc tcaccttgct cctgccgaga aagtatccat 4020

catggctgat gcaatgcggc ggctgcatac gcttgatccg gctacctgcc cattcgacca 4080

ccaagcgaaa catcgcatcg agcgagcacg tactcggatg gaagccggtc ttgtcgatca 4140

ggatgatctg gacgaagagc atcaggggct cgcgccagcc gaactgttcg ccaggctcaa 4200

ggcgagcatg cccgacggcg aggatctcgt cgtgacccat ggcgatgcct gcttgccgaa 4260

tatcatggtg gaaaatggcc gcttttctgg attcatcgac tgtggccggc tgggtgtggc 4320

ggaccgctat caggacatag cgttggctac ccgtgatatt gctgaagagc ttggcggcga 4380

atgggctgac cgcttcctcg tgctttacgg tatcgccgct cccgattcgc agcgcatcgc 4440

cttctatcgc cttcttgacg agttcttctg aattattaac gcttacaatt tcctgatgcg 4500

gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atacaggtgg cacttttcgg 4560

ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg 4620

ctcatgagac aataaccctg ataaatgctt caataatagc acgtgaggag ggccaccatg 4680

gccaagttga ccagtgccgt tccggtgctc accgcgcgcg acgtcgccgg agcggtcgag 4740

ttctggaccg accggctcgg gttctcccgg gacttcgtgg aggacgactt cgccggtgtg 4800

gtccgggacg acgtgaccct gttcatcagc gcggtccagg accaggtggt gccggacaac 4860

accctggcct gggtgtgggt gcgcggcctg gacgagctgt acgccgagtg gtcggaggtc 4920

gtgtccacga acttccggga cgcctccggg ccggccatga ccgagatcgg cgagcagccg 4980

tgggggcggg agttcgccct gcgcgacccg gccggcaact gcgtgcactt cgtggccgag 5040

gagcaggact gacacgtgct aaaacttcat ttttaattta aaaggatcta ggtgaagatc 5100

ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca 5160

gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc 5220

tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta 5280

ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt 5340

ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc 5400

gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 5460

ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg 5520

tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag 5580

ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc 5640

agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat 5700

agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 5760

gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct gggcttttgc 5820

tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt 5880

accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca 5940

gtgagcgagg aagcggaag 5959

<210> SEQ ID NO: 33

<211> LENGTH: 6384

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN566; TOPO-BLUNT-HXT367::loxP-hphMX-loxP

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(6384)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“pRN566;

TOPO-BLUNT-HXT367::loxP-hphMX-loxP” /mol_type=“unassigned DNA”

<400> SEQENCE: 33

agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 60

acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 120

tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 180

ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctat 240

ttaggtgaca ctatagaata ctcaagctat gcatcaagct tggtaccgag ctcggatcca 300

ctagtaccgg tgaaacaact caataacgat gtgggacatt gggggcccac tcaaaaaatc 360

tggggactat atccccagag aatttctcca gaagagaaga aaagtcaaag ttttttttcg 420

cttgggggtt gcatataaat acaggcgctg ttttatcttc agcatgaata ttccataatt 480

ttacttaata gcttttcata aataatagaa tcacaaacaa aatttacatc tgagttaaac 540

aatcatgaat tcaactccag atttaatatc tccacaaaag tcaagtgaga attcgaatgc 600

tgacctgcct tcgaatagct ctcaggtaat gaacatgcct gaagaaaaag gtgttcaaga 660

tgatttccaa gctgaggccg accaagtact taccaaccca aatacaggta aaggtgcata 720

tgtcactgtg tctatctgtt gtgttatggt tgccttcggt ggtttcgttt tcggttggga 780

tactggtacc atttctggtt tcgtcgccca aactgatttc ttgaggaaga cgtccggacg 840

tacgtataac ttcgtatagc atacattata cgaagttatt ctagtaacgg ccgccagtgt 900

gctggaattc gcccttaagc ttgcctcgtc cccgccgggt cacccggcca gcgacatgga 960

ggcccagaat accctccttg acagtcttga cgtgcgcagc tcaggggcat gatgtgactg 1020

tcgcccgtac atttagccca tacatcccca tgtataatca tttgcatcca tacattttga 1080

tggccgcacg gcgcgaagca aaaattacgg ctcctcgctg cagacctgcg agcagggaaa 1140

cgctcccctc acagacgcgt gaattgtccc cacgccgcgc ccctgtagag aaatataaaa 1200

ggttaggatt tgccactgag gttcttcttt catatacttc cttttaaaat cttgctagga 1260

tacagttctc acatcacatc cgaacataaa caaccatggg taaaaagcct gaactcaccg 1320

cgacgtctgt cgagaagttt ctgatcgaaa agttcgacag cgtctccgac ctgatgcagc 1380

tctcggaggg cgaagaatct cgtgctttca gcttcgatgt aggagggcgt ggatatgtcc 1440

tgcgggtaaa tagctgcgcc gatggtttct acaaagatcg ttatgtttat cggcactttg 1500

catcggccgc gctcccgatt ccggaagtgc ttgacattgg ggaattcagc gagagcctga 1560

cctattgcat ctcccgccgt gcacagggtg tcacgttgca agacctgcct gaaaccgaac 1620

tgcccgctgt tctgcagccg gtcgcggagg ccatggatgc gatcgctgcg gccgatctta 1680

gccagacgag cgggttcggc ccattcggac cgcaaggaat cggtcaatac actacatggc 1740

gtgatttcat atgcgcgatt gctgatcccc atgtgtatca ctggcaaact gtgatggacg 1800

acaccgtcag tgcgtccgtc gcgcaggctc tcgatgagct gatgctttgg gccgaggact 1860

gccccgaagt ccggcacctc gtgcacgcgg atttcggctc caacaatgtc ctgacggaca 1920

atggccgcat aacagcggtc attgactgga gcgaggcgat gttcggggat tcccaatacg 1980

aggtcgccaa catcttcttc tggaggccgt ggttggcttg tatggagcag cagacgcgct 2040

acttcgagcg gaggcatccg gagcttgcag gatcgccgcg gctccgggcg tatatgctcc 2100

gcattggtct tgaccaactc tatcagagct tggttgacgg caatttcgat gatgcagctt 2160

gggcgcaggg tcgatgcgac gcaatcgtcc gatccggagc cgggactgtc gggcgtacac 2220

aaatcgcccg cagaagcgcg gccgtctgga ccgatggctg tgtagaagta ctcgccgata 2280

gtggaaaccg acgccccagc actcgtccga gggcaaagga ataatcagta ctgacaataa 2340

aaagattctt gttttcaaga acttgtcatt tgtatagttt ttttatattg tagttgttct 2400

attttaatca aatgttagcg tgatttatat tttttttcgc ctcgacatca tctgcccaga 2460

tgcgaagtta agtgcgcaga aagtaatatc atgcgtcaat cgtatgtgaa tgctggtcgc 2520

tatactgctg tcgattcgat actaacgccg ccatccagtg tcgaaaacga gctcgaattc 2580

atcgatgata tccatcacac tggcggccgc tcgacgatat ctagagcgcg cataacttcg 2640

tataatgtat gctatacgaa gttataggcc tcgagacgtc cgacgctgaa gaaatgactc 2700

acgatgacaa gccattgtac aagagaatgt tcagcaccaa ataatttgcg aacactttta 2760

ttaattcatg atcacgctct aatttgtgca tttgaaatgt actctaattc taattttata 2820

tttttaatga tatcttgaaa agtaaatacg tttttaatat atacaaaata atacagttta 2880

attttcaagt ttttgatcat ttgttctcag aaagttgagt gggacggaga caaagaaact 2940

ttaaagagaa atgcaaagtg ggaagaagtc agttgtttac cgaccgcact gttattcaca 3000

aatattccaa ttttgcctgc agacccacgt ctacaaattt tggttagttt ggtaaatggt 3060

aaggatatag tagagccttt ttgaaatggg aaatatcttc tttttctgta tcccgcttca 3120

aaaagtgtct aatgagtcag ttatttcttt cttactcatc gcccgtcact taaaagaaga 3180

aaaattacgg atccgtcgac taagggcgaa ttctgcagat atccatcaca ctggcggccg 3240

ctcgagcatg catctagagg gcccaattcg ccctatagtg agtcgtatta caattcactg 3300

gccgtcgttt tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt 3360

gcagcacatc cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct 3420

tcccaacagt tgcgcagcct atacgtacgg cagtttaagg tttacaccta taaaagagag 3480

agccgttatc gtctgtttgt ggatgtacag agtgatatta ttgacacgcc ggggcgacgg 3540

atggtgatcc ccctggccag tgcacgtctg ctgtcagata aagtctcccg tgaactttac 3600

ccggtggtgc atatcgggga tgaaagctgg cgcatgatga ccaccgatat ggccagtgtg 3660

ccggtctccg ttatcgggga agaagtggct gatctcagcc accgcgaaaa tgacatcaaa 3720

aacgccatta acctgatgtt ctggggaata taaatgtcag gcatgagatt atcaaaaagg 3780

atcttcacct agatcctttt cacgtagaaa gccagtccgc agaaacggtg ctgaccccgg 3840

atgaatgtca gctactgggc tatctggaca agggaaaacg caagcgcaaa gagaaagcag 3900

gtagcttgca gtgggcttac atggcgatag ctagactggg cggttttatg gacagcaagc 3960

gaaccggaat tgccagctgg ggcgccctct ggtaaggttg ggaagccctg caaagtaaac 4020

tggatggctt tctcgccgcc aaggatctga tggcgcaggg gatcaagctc tgatcaagag 4080

acaggatgag gatcgtttcg catgattgaa caagatggat tgcacgcagg ttctccggcc 4140

gcttgggtgg agaggctatt cggctatgac tgggcacaac agacaatcgg ctgctctgat 4200

gccgccgtgt tccggctgtc agcgcagggg cgcccggttc tttttgtcaa gaccgacctg 4260

tccggtgccc tgaatgaact gcaagacgag gcagcgcggc tatcgtggct ggccacgacg 4320

ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga ctggctgcta 4380

ttgggcgaag tgccggggca ggatctcctg tcatctcacc ttgctcctgc cgagaaagta 4440

tccatcatgg ctgatgcaat gcggcggctg catacgcttg atccggctac ctgcccattc 4500

gaccaccaag cgaaacatcg catcgagcga gcacgtactc ggatggaagc cggtcttgtc 4560

gatcaggatg atctggacga agagcatcag gggctcgcgc cagccgaact gttcgccagg 4620

ctcaaggcga gcatgcccga cggcgaggat ctcgtcgtga cccatggcga tgcctgcttg 4680

ccgaatatca tggtggaaaa tggccgcttt tctggattca tcgactgtgg ccggctgggt 4740

gtggcggacc gctatcagga catagcgttg gctacccgtg atattgctga agagcttggc 4800

ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg ccgctcccga ttcgcagcgc 4860

atcgccttct atcgccttct tgacgagttc ttctgaatta ttaacgctta caatttcctg 4920

atgcggtatt ttctccttac gcatctgtgc ggtatttcac accgcataca ggtggcactt 4980

ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat tcaaatatgt 5040

atccgctcat gagacaataa ccctgataaa tgcttcaata atagcacgtg aggagggcca 5100

ccatggccaa gttgaccagt gccgttccgg tgctcaccgc gcgcgacgtc gccggagcgg 5160

tcgagttctg gaccgaccgg ctcgggttct cccgggactt cgtggaggac gacttcgccg 5220

gtgtggtccg ggacgacgtg accctgttca tcagcgcggt ccaggaccag gtggtgccgg 5280

acaacaccct ggcctgggtg tgggtgcgcg gcctggacga gctgtacgcc gagtggtcgg 5340

aggtcgtgtc cacgaacttc cgggacgcct ccgggccggc catgaccgag atcggcgagc 5400

agccgtgggg gcgggagttc gccctgcgcg acccggccgg caactgcgtg cacttcgtgg 5460

ccgaggagca ggactgacac gtgctaaaac ttcattttta atttaaaagg atctaggtga 5520

agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 5580

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 5640

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 5700

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 5760

tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 5820

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 5880

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 5940

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 6000

gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 6060

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 6120

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 6180

caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctgggct 6240

tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct gtggataacc 6300

gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg 6360

agtcagtgag cgaggaagcg gaag 6384

<210> SEQ ID NO: 34

<211> LENGTH: 6073

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN569 TOPO-BLUNT-HXT514::loxP-natMX-loxP

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(6073)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“pRN569

TOPO-BLUNT-HXT514::loxP-natMX-loxP” /mol_type=“unassigned DNA”

<400> SEQENCE: 34

agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 60

acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 120

tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 180

ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctat 240

ttaggtgaca ctatagaata ctcaagctat gcatcaagct tggtaccgag ctcggatcca 300

ctagtaacgg ccgccagtgt gctggaattc gcccttatgg atcctagggg ttcttgcaga 360

gtaaactgcg attcttcaga taaactatcc cgaacatatt gacccacttt caggtaggtc 420

attcaaagct ttttgattga cggtagatca aagttgtgtt ctacgtattt acgtcttttt 480

tgtcgtattt attgatgacc ttttgccatc gttaagtgga gaattcggcc tattcctaac 540

ctcttccaga actttgaaac aaaaaacata attcaaaatt gtagtttgat aaagtattat 600

ctataaacta ttaaatcata aatatatatt tcatagagcg ttaaaaattg aagatcaaat 660

attattttta ttccttgaag gaagtctata ttatttaatt aactgaccta cttttttccg 720

aacatcttct tgtaaaatgg ttgatcatca tgcattagat catcagcgtt gtagtcagta 780

cctctcttgt ttggtggaac ccaagaaggt gatttccatg gcaaaacacc ttcttcccat 840

aagggacgtc tcgaggccta taacttcgta tagcatacat tatacgaagt tatgcgcgct 900

ctagatatcg tcgacactgg atggcggcgt tagtatcgaa tcgacagcag tatagcgacc 960

agcattcaca tacgattgac gcatgatatt actttctgcg cacttaactt cgcatctggg 1020

cagatgatgt cgaggcgaaa aaaaatataa atcacgctaa catttgatta aaatagaaca 1080

actacaatat aaaaaaacta tacaaatgac aagttcttga aaacaagaat ctttttattg 1140

tcagtactag gggcagggca tgctcatgta gagcgcctgc tcgccgtccg aggcggtgcc 1200

gtcgtacagg gcggtgtcca ggccgcagag ggtgaacccc atccgccggt acgcgtggat 1260

cgccggtgcg ttgacgttgg tgacctccag ccagaggtgc ccggcgcccc gctcgcgggc 1320

gaactccgtc gcgagcccca tcaacgcgcg cccgaccccg tgcccccggt gctccggggc 1380

gacctcgatg tcctcgacgg tcagccggcg gttccagccg gagtacgaga cgaccacgaa 1440

gcccgccagg tcgccgtcgt ccccgtacgc gacgaacgtc cgggagtccg ggtcgccgtc 1500

ctccccggcg tccgattcgt cgtccgattc gtcgtcgggg aacaccttgg tcaggggcgg 1560

gtccaccggc acctcccgca gggtgaagcc gtccccggtg gcggtgacgc ggaagacggt 1620

gtcggtggtg aaggacccat ccagtgcctc gatggcctcg gcgtcccccg ggacactggt 1680

gcggtaccgg taagccgtgt cgtcaagagt ggtcatttta catggttgtt tatgttcgga 1740

tgtgatgtga gaactgtatc ctagcaagat tttaaaagga agtatatgaa agaagaacct 1800

cagtggcaaa tcctaacctt ttatatttct ctacaggggc gcggcgtggg gacaattcaa 1860

cgcgtctgtg aggggagcgt ttccctgctc gcaggtctgc agcgaggagc cgtaattttt 1920

gcttcgcgcc gtgcggccat caaaatgtat ggatgcaaat gattatacat ggggatgtat 1980

gggctaaatg tacgggcgac agtcacatca tgcccctgag ctgcgcacgt caagactgtc 2040

aaggagggta ttctgggcct ccatgtcgct ggccgggtga cccggcgggg acgaggcaag 2100

cttaagggcg aattccagca cactggcggc cgttactaga ataacttcgt ataatgtatg 2160

ctatacgaag ttatacgtac gtccggagta acatgaaacc agagtaccac gcaactgctt 2220

aggcgacact tcagaaatta gcataggcgc caaaactgta ataccaccaa cgcccagtcc 2280

tgagatgatt cttccaatga aatattgata ccatttgtca atggaggcga tttggatgat 2340

gatcccaatt gagtaaatga cgacaacagt catcagacca atcttacgtc catacatatc 2400

accgagcttt gacaaaacta tacctccgat agcgcagccg atgttgaaaa tagaaaccat 2460

caaaccggtt ctgacatcgg aaagataggt agtcccgttt gcacgggtgc tgccaaatcg 2520

cctaatgaag tctgtttgcc tgacaaaacc agatatagta ccagtatccc acccaaacac 2580

gaacccacca aaagcaacca tcaaacagca gacggataca aatagtaaat ccgacttcga 2640

tttcttctct agttggttgt caacctcctt ctgaagctct tccagttcgt ctttgggagg 2700

gccttcatgg gaaatgtaac ttgagacggg tttagcttgt gccaaattat cgttgtaacc 2760

ggcggtacca ggagcagtcg agtttcctga cttctcgttg tatgagttag aatttgtgct 2820

cacagtagca gacccttcca aggggccttg atgagcgttt tcaagttcac atgtactagt 2880

gcggccgctt aagggcgaat tctgcagata tccatcacac tggcggccgc tcgagcatgc 2940

atctagaggg cccaattcgc cctatagtga gtcgtattac aattcactgg ccgtcgtttt 3000

acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc 3060

ccctttcgcc agctggcgta atagcgaaga ggcccgcacc gatcgccctt cccaacagtt 3120

gcgcagccta tacgtacggc agtttaaggt ttacacctat aaaagagaga gccgttatcg 3180

tctgtttgtg gatgtacaga gtgatattat tgacacgccg gggcgacgga tggtgatccc 3240

cctggccagt gcacgtctgc tgtcagataa agtctcccgt gaactttacc cggtggtgca 3300

tatcggggat gaaagctggc gcatgatgac caccgatatg gccagtgtgc cggtctccgt 3360

tatcggggaa gaagtggctg atctcagcca ccgcgaaaat gacatcaaaa acgccattaa 3420

cctgatgttc tggggaatat aaatgtcagg catgagatta tcaaaaagga tcttcaccta 3480

gatccttttc acgtagaaag ccagtccgca gaaacggtgc tgaccccgga tgaatgtcag 3540

ctactgggct atctggacaa gggaaaacgc aagcgcaaag agaaagcagg tagcttgcag 3600

tgggcttaca tggcgatagc tagactgggc ggttttatgg acagcaagcg aaccggaatt 3660

gccagctggg gcgccctctg gtaaggttgg gaagccctgc aaagtaaact ggatggcttt 3720

ctcgccgcca aggatctgat ggcgcagggg atcaagctct gatcaagaga caggatgagg 3780

atcgtttcgc atgattgaac aagatggatt gcacgcaggt tctccggccg cttgggtgga 3840

gaggctattc ggctatgact gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt 3900

ccggctgtca gcgcaggggc gcccggttct ttttgtcaag accgacctgt ccggtgccct 3960

gaatgaactg caagacgagg cagcgcggct atcgtggctg gccacgacgg gcgttccttg 4020

cgcagctgtg ctcgacgttg tcactgaagc gggaagggac tggctgctat tgggcgaagt 4080

gccggggcag gatctcctgt catctcacct tgctcctgcc gagaaagtat ccatcatggc 4140

tgatgcaatg cggcggctgc atacgcttga tccggctacc tgcccattcg accaccaagc 4200

gaaacatcgc atcgagcgag cacgtactcg gatggaagcc ggtcttgtcg atcaggatga 4260

tctggacgaa gagcatcagg ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgag 4320

catgcccgac ggcgaggatc tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat 4380

ggtggaaaat ggccgctttt ctggattcat cgactgtggc cggctgggtg tggcggaccg 4440

ctatcaggac atagcgttgg ctacccgtga tattgctgaa gagcttggcg gcgaatgggc 4500

tgaccgcttc ctcgtgcttt acggtatcgc cgctcccgat tcgcagcgca tcgccttcta 4560

tcgccttctt gacgagttct tctgaattat taacgcttac aatttcctga tgcggtattt 4620

tctccttacg catctgtgcg gtatttcaca ccgcatacag gtggcacttt tcggggaaat 4680

gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg 4740

agacaataac cctgataaat gcttcaataa tagcacgtga ggagggccac catggccaag 4800

ttgaccagtg ccgttccggt gctcaccgcg cgcgacgtcg ccggagcggt cgagttctgg 4860

accgaccggc tcgggttctc ccgggacttc gtggaggacg acttcgccgg tgtggtccgg 4920

gacgacgtga ccctgttcat cagcgcggtc caggaccagg tggtgccgga caacaccctg 4980

gcctgggtgt gggtgcgcgg cctggacgag ctgtacgccg agtggtcgga ggtcgtgtcc 5040

acgaacttcc gggacgcctc cgggccggcc atgaccgaga tcggcgagca gccgtggggg 5100

cgggagttcg ccctgcgcga cccggccggc aactgcgtgc acttcgtggc cgaggagcag 5160

gactgacacg tgctaaaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt 5220

gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc 5280

gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg 5340

caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact 5400

ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg 5460

tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg 5520

ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac 5580

tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca 5640

cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga 5700

gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc 5760

ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct 5820

gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg 5880

agcctatgga aaaacgccag caacgcggcc tttttacggt tcctgggctt ttgctggcct 5940

tttgctcaca tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc 6000

tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc 6060

gaggaagcgg aag 6073

<210> SEQ ID NO: 35

<211> LENGTH: 6189

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN635; TOPO-BLUNT-HXT2::loxP-kanMX-loxP

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(6189)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“pRN635;

TOPO-BLUNT-HXT2::loxP-kanMX-loxP” /mol_type=“unassigned DNA”

<400> SEQENCE: 35

agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 60

acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 120

tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 180

ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctat 240

ttaggtgaca ctatagaata ctcaagctat gcatcaagct tggtaccgag ctcggatcca 300

ctagtaacgg ccgccagtgt gctggaattc gcccttgact agtaccggtg ttttcaaaac 360

ctagcaaccc ccaccaaact tgtcatcgtt cccggattca caaatgatat aaaaagcgat 420

tacaattcta cattctaacc agatttgaga tttcctcttt ctcaattcct cttatattag 480

attataagaa caacaaatta aattacaaaa agacttataa agcaacataa tgtctgaatt 540

cgctactagc cgcgttgaaa gtggctctca acaaacttct atccactcta ctccgatagt 600

gcagaaatta gagacggatg aatctcctat tcaaaccaaa tctgaataca ctaacgctga 660

actcccagca aagccaatcg ccgcatattg gactgttatc tgtttatgtc taatgattgc 720

atttggtggg tttgtctttg gttgggatac tggtaccatc tctggttttg ttaatcaaac 780

cgatttcaaa agaagatttg gtcaaatgaa atctgatggt accttccgga agacgcgtac 840

gtataacttc gtatagcata cattatacga agttattcta gtaacggccg ccagtgtgct 900

ggaattcgcc cttaagcttg cctcgtcccc gccgggtcac ccggccagcg acatggaggc 960

ccagaatacc ctccttgaca gtcttgacgt gcgcagctca ggggcatgat gtgactgtcg 1020

cccgtacatt tagcccatac atccccatgt ataatcattt gcatccatac attttgatgg 1080

ccgcacggcg cgaagcaaaa attacggctc ctcgctgcag acctgcgagc agggaaacgc 1140

tcccctcaca gacgcgttga attgtcccca cgccgcgccc ctgtagagaa atataaaagg 1200

ttaggatttg ccactgaggt tcttctttca tatacttcct tttaaaatct tgctaggata 1260

cagttctcac atcacatccg aacataaaca accatgggta aggaaaagac tcacgtttcg 1320

aggccgcgat taaattccaa catggatgct gatttatatg ggtataaatg ggctcgcgat 1380

aatgtcgggc aatcaggtgc gacaatctat cgattgtatg ggaagcccga tgcgccagag 1440

ttgtttctga aacatggcaa aggtagcgtt gccaatgatg ttacagatga gatggtcaga 1500

ctaaactggc tgacggaatt tatgcctctt ccgaccatca agcattttat ccgtactcct 1560

gatgatgcat ggttactcac cactgcgatc cccggcaaaa cagcattcca ggtattagaa 1620

gaatatcctg attcaggtga aaatattgtt gatgcgctgg cagtgttcct gcgccggttg 1680

cattcgattc ctgtttgtaa ttgtcctttt aacagcgatc gcgtatttcg tctcgctcag 1740

gcgcaatcac gaatgaataa cggtttggtt gatgcgagtg attttgatga cgagcgtaat 1800

ggctggcctg ttgaacaagt ctggaaagaa atgcataagc ttttgccatt ctcaccggat 1860

tcagtcgtca ctcatggtga tttctcactt gataacctta tttttgacga ggggaaatta 1920

ataggttgta ttgatgttgg acgagtcgga atcgcagacc gataccagga tcttgccatc 1980

ctatggaact gcctcggtga gttttctcct tcattacaga aacggctttt tcaaaaatat 2040

ggtattgata atcctgatat gaataaattg cagtttcatt tgatgctcga tgagtttttc 2100

taatcagtac tgacaataaa aagattcttg ttttcaagaa cttgtcattt gtatagtttt 2160

tttatattgt agttgttcta ttttaatcaa atgttagcgt gatttatatt ttttttcgcc 2220

tcgacatcat ctgcccagat gcgaagttaa gtgcgcagaa agtaatatca tgcgtcaatc 2280

gtatgtgaat gctggtcgct atactgctgt cgattcgata ctaacgccgc catccagtgt 2340

cgacgatatc tagagcgcgc ataacttcgt ataatgtatg ctatacgaag ttataggcct 2400

cgagacgtcc tttgtctgtg aaaccaaggg cttaacatta gaggaagtta atgaaatgta 2460

tgttgaaggt gtcaaaccat ggaaatctgg tagctggatc tcaaaagaaa aaagagtttc 2520

cgaggaataa gagattatac ttaaactagc actgattttt ttaaggctaa tggctactaa 2580

tactttaata gatgatcttc atactttttt atttaacgat ttttaatgat gtttttattt 2640

gtaccactca tttatctaga tttttttaat actgatcaaa tcttacggac tcgacgttaa 2700

aaagttccta catacgtctg gtacttgaaa cgctgcttcg aggtattgac actataagaa 2760

tacgatccaa atacttacac cgcatgtaaa aatatgccga caatatgaat acttgttgat 2820

gaatgatatt tgattttaat ccggcaattt acctccttta tataatccaa taattgttga 2880

taattagtgg ttaggttgca gtactaataa gaattaagac aaatattctt ctactatata 2940

aaaggtgcaa acaaaacaca cgccgatcgg ccatactaaa caagaccaac ataagggccc 3000

gtcgacaagg gcgaattctg cagatatcca tcacactggc ggccgctcga gcatgcatct 3060

agagggccca attcgcccta tagtgagtcg tattacaatt cactggccgt cgttttacaa 3120

cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct 3180

ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc 3240

agcctatacg tacggcagtt taaggtttac acctataaaa gagagagccg ttatcgtctg 3300

tttgtggatg tacagagtga tattattgac acgccggggc gacggatggt gatccccctg 3360

gccagtgcac gtctgctgtc agataaagtc tcccgtgaac tttacccggt ggtgcatatc 3420

ggggatgaaa gctggcgcat gatgaccacc gatatggcca gtgtgccggt ctccgttatc 3480

ggggaagaag tggctgatct cagccaccgc gaaaatgaca tcaaaaacgc cattaacctg 3540

atgttctggg gaatataaat gtcaggcatg agattatcaa aaaggatctt cacctagatc 3600

cttttcacgt agaaagccag tccgcagaaa cggtgctgac cccggatgaa tgtcagctac 3660

tgggctatct ggacaaggga aaacgcaagc gcaaagagaa agcaggtagc ttgcagtggg 3720

cttacatggc gatagctaga ctgggcggtt ttatggacag caagcgaacc ggaattgcca 3780

gctggggcgc cctctggtaa ggttgggaag ccctgcaaag taaactggat ggctttctcg 3840

ccgccaagga tctgatggcg caggggatca agctctgatc aagagacagg atgaggatcg 3900

tttcgcatga ttgaacaaga tggattgcac gcaggttctc cggccgcttg ggtggagagg 3960

ctattcggct atgactgggc acaacagaca atcggctgct ctgatgccgc cgtgttccgg 4020

ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg acctgtccgg tgccctgaat 4080

gaactgcaag acgaggcagc gcggctatcg tggctggcca cgacgggcgt tccttgcgca 4140

gctgtgctcg acgttgtcac tgaagcggga agggactggc tgctattggg cgaagtgccg 4200

gggcaggatc tcctgtcatc tcaccttgct cctgccgaga aagtatccat catggctgat 4260

gcaatgcggc ggctgcatac gcttgatccg gctacctgcc cattcgacca ccaagcgaaa 4320

catcgcatcg agcgagcacg tactcggatg gaagccggtc ttgtcgatca ggatgatctg 4380

gacgaagagc atcaggggct cgcgccagcc gaactgttcg ccaggctcaa ggcgagcatg 4440

cccgacggcg aggatctcgt cgtgacccat ggcgatgcct gcttgccgaa tatcatggtg 4500

gaaaatggcc gcttttctgg attcatcgac tgtggccggc tgggtgtggc ggaccgctat 4560

caggacatag cgttggctac ccgtgatatt gctgaagagc ttggcggcga atgggctgac 4620

cgcttcctcg tgctttacgg tatcgccgct cccgattcgc agcgcatcgc cttctatcgc 4680

cttcttgacg agttcttctg aattattaac gcttacaatt tcctgatgcg gtattttctc 4740

cttacgcatc tgtgcggtat ttcacaccgc atacaggtgg cacttttcgg ggaaatgtgc 4800

gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg ctcatgagac 4860

aataaccctg ataaatgctt caataatagc acgtgaggag ggccaccatg gccaagttga 4920

ccagtgccgt tccggtgctc accgcgcgcg acgtcgccgg agcggtcgag ttctggaccg 4980

accggctcgg gttctcccgg gacttcgtgg aggacgactt cgccggtgtg gtccgggacg 5040

acgtgaccct gttcatcagc gcggtccagg accaggtggt gccggacaac accctggcct 5100

gggtgtgggt gcgcggcctg gacgagctgt acgccgagtg gtcggaggtc gtgtccacga 5160

acttccggga cgcctccggg ccggccatga ccgagatcgg cgagcagccg tgggggcggg 5220

agttcgccct gcgcgacccg gccggcaact gcgtgcactt cgtggccgag gagcaggact 5280

gacacgtgct aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata 5340

atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag 5400

aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa 5460

caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt 5520

ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc 5580

cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa 5640

tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa 5700

gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc 5760

ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa 5820

gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa 5880

caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg 5940

ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc 6000

tatggaaaaa cgccagcaac gcggcctttt tacggttcct gggcttttgc tggccttttg 6060

ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg 6120

agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg 6180

aagcggaag 6189

<210> SEQ ID NO: 36

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 281-Hx3inr2

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(24)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 281-Hx3inr2” /mol_type=“unassigned DNA”

<400> SEQENCE: 36

gctcttttca cggagaaatt cggg 24

<210> SEQ ID NO: 37

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 323-Hx7inr1

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(22)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 323-Hx7inr1” /mol_type=“unassigned DNA”

<400> SEQENCE: 37

gatgagaatc cttggcaacc gc 22

<210> SEQ ID NO: 38

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer Hx4inr2

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(25)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer Hx4inr2” /mol_type=“unassigned DNA”

<400> SEQENCE: 38

ccatactatt tgtcgactca agcgc 25

<210> SEQ ID NO: 39

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer Hx5inf

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(25)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer Hx5inf” /mol_type=“unassigned DNA”

<400> SEQENCE: 39

gggttaatta gttttagggg cacgg 25

<210> SEQ ID NO: 40

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 324-Ga2inf1

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(24)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 324-Ga2inf1” /mol_type=“unassigned DNA”

<400> SEQENCE: 40

tcaattcgga aagcttcctt ccgg 24

<210> SEQ ID NO: 41

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 325-Ga2inr1

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 325-Ga2inr1” /mol_type=“unassigned DNA”

<400> SEQENCE: 41

cagtgatagt ttggttcgag cgg 23

<210> SEQ ID NO: 42

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 289-Hx2inf

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 289-Hx2inf” /mol_type=“unassigned DNA”

<400> SEQENCE: 42

tcttcgggaa ctagataggt ggc 23

<210> SEQ ID NO: 43

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 290-Hx2inr

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 290-Hx2inr” /mol_type=“unassigned DNA”

<400> SEQENCE: 43

gaagtaatca gccacaatac gcc 23

<210> SEQ ID NO: 44

<211> LENGTH: 73

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 838-Glk1-psuc227f

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(73)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 838-Glk1-psuc227f” /mol_type=“unassigned DNA”

<400> SEQENCE: 44

atgtcattcg acgacttaca caaagccact gagagagcgg tcatccaggc ccgtcgacct 60

cgagtaccgt tcg 73

<210> SEQ ID NO: 45

<211> LENGTH: 73

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 834- Hxk2-psuc227f

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(73)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“primer

834- Hxk2-psuc227f” /mol_type=“unassigned DNA”

<400> SEQENCE: 45

gccagaaagg gttccatggc cgatgtgcca aaggaattga tgcaacaaat ccgtcgacct 60

cgagtaccgt tcg 73

<210> SEQ ID NO: 46

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 645-pSUC227r

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(21)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 645-pSUC227r” /mol_type=“unassigned DNA”

<400> SEQENCE: 46

gcaatttcgg ctatacgtaa c 21

<210> SEQ ID NO: 47

<211> LENGTH: 73

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 839-Glk1-psuc225r

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(73)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 839-Glk1-psuc225r” /mol_type=“unassigned DNA”

<400> SEQENCE: 47

caatcttcaa gtgcaccttc ctctcaccct cggcacccaa gggtgacaag ccggatccta 60

ccgttcgtat agc 73

<210> SEQ ID NO: 48

<211> LENGTH: 73

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 835-Hxk2-psuc225r

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(73)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 835-Hxk2-psuc225r” /mol_type=“unassigned DNA”

<400> SEQENCE: 48

gccagaaagg gttccatggc cgatgtgcca aaggaattga tgcaacaaat ccgtcgacct 60

cgagtaccgt tcg 73

<210> SEQ ID NO: 49

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 646-pSUC225f

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(21)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 646-pSUC225f” /mol_type=“unassigned DNA”

<400> SEQENCE: 49

cgttcactca tggaaaatag c 21

<210> SEQ ID NO: 50

<211> LENGTH: 72

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 846-Hxk1_loxP_f

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(72)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 846-Hxk1_loxP_f” /mol_type=“unassigned DNA”

<400> SEQENCE: 50

atggttcatt taggtccaaa gaaaccacag gctagaaagg gttccatggc cggatccact 60

agcataactt cg 72

<210> SEQ ID NO: 51

<211> LENGTH: 72

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 847-Hxk1_loxP_r

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(72)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 847-Hxk1_loxP_r” /mol_type=“unassigned DNA”

<400> SEQENCE: 51

atggttcatt taggtccaaa gaaaccacag gctagaaagg gttccatggc cggatccact 60

agcataactt cg 72

<210> SEQ ID NO: 52

<211> LENGTH: 72

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 848-Gal1_loxP_f

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(72)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 848-Gal1_loxP_f” /mol_type=“unassigned DNA”

<400> SEQENCE: 52

atgactaaat ctcattcaga agaagtgatt gtacctgagt tcaattctag cggatccact 60

agcataactt cg 72

<210> SEQ ID NO: 53

<211> LENGTH: 70

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer 849-Gal1_loxP_r

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(70)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“primer 849-Gal1_loxP_r” /mol_type=“unassigned DNA”

<400> SEQENCE: 53

ttataattca tatagacagc tgcccaatgc tggtttagag acgatgatag ttgggccgcc 60

agtgtgatgg 70

<210> SEQ ID NO: 54

<211> LENGTH: 5250

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN774; TOPO-BLUNT-loxP-hphMX-loxP (loxP sites

in opposite orientation)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(5250)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“pRN774;

TOPO-BLUNT-loxP-hphMX-loxP (loxP sites in opposite orientation) ”

/mol_type=“unassigned DNA”

<400> SEQENCE: 54

gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca caggaaacag 60

ctatgaccat gattacgcca agctatttag gtgacactat agaatactca agctatgcat 120

caagcttggt accgagctcg gatccactag cataacttcg tataatgtat gctatacgaa 180

gttattctag taacggccgc cagtgtgctg gaattcgccc ttaagctttg cctcgtcccc 240

gccgggtcac ccggccagcg acatggaggc ccagaatacc ctccttgaca gtcttgacgt 300

gcgcagctca ggggcatgat gtgactgtcg cccgtacatt tagcccatac atccccatgt 360

ataatcattt gcatccatac attttgatgg ccgcacggcg cgaagcaaaa attacggctc 420

ctcgctgcag acctgcgagc agggaaacgc tcccctcaca gacgcgtgaa ttgtccccac 480

gccgcgcccc tgtagagaaa tataaaaggt taggatttgc cactgaggtt cttctttcat 540

atacttcctt ttaaaatctt gctaggatac agttctcaca tcacatccga acataaacaa 600

ccatgggtaa aaagcctgaa ctcaccgcga cgtctgtcga gaagtttctg atcgaaaagt 660

tcgacagcgt ctccgacctg atgcagctct cggagggcga agaatctcgt gctttcagct 720

tcgatgtagg agggcgtgga tatgtcctgc gggtaaatag ctgcgccgat ggtttctaca 780

aagatcgtta tgtttatcgg cactttgcat cggccgcgct cccgattccg gaagtgcttg 840

acattgggga attcagcgag agcctgacct attgcatctc ccgccgtgca cagggtgtca 900

cgttgcaaga cctgcctgaa accgaactgc ccgctgttct gcagccggtc gcggaggcca 960

tggatgcgat cgctgcggcc gatcttagcc agacgagcgg gttcggccca ttcggaccgc 1020

aaggaatcgg tcaatacact acatggcgtg atttcatatg cgcgattgct gatccccatg 1080

tgtatcactg gcaaactgtg atggacgaca ccgtcagtgc gtccgtcgcg caggctctcg 1140

atgagctgat gctttgggcc gaggactgcc ccgaagtccg gcacctcgtg cacgcggatt 1200

tcggctccaa caatgtcctg acggacaatg gccgcataac agcggtcatt gactggagcg 1260

aggcgatgtt cggggattcc caatacgagg tcgccaacat cttcttctgg aggccgtggt 1320

tggcttgtat ggagcagcag acgcgctact tcgagcggag gcatccggag cttgcaggat 1380

cgccgcggct ccgggcgtat atgctccgca ttggtcttga ccaactctat cagagcttgg 1440

ttgacggcaa tttcgatgat gcagcttggg cgcagggtcg atgcgacgca atcgtccgat 1500

ccggagccgg gactgtcggg cgtacacaaa tcgcccgcag aagcgcggcc gtctggaccg 1560

atggctgtgt agaagtactc gccgatagtg gaaaccgacg ccccagcact cgtccgaggg 1620

caaaggaata atcagtactg acaataaaaa gattcttgtt ttcaagaact tgtcatttgt 1680

atagtttttt tatattgtag ttgttctatt ttaatcaaat gttagcgtga tttatatttt 1740

ttttcgcctc gacatcatct gcccagatgc gaagttaagt gcgcagaaag taatatcatg 1800

cgtcaatcgt atgtgaatgc tggtcgctat actgctgtcg attcgatact aacgccgcca 1860

tccagtgtcg aaaacgagct cgaattcatc gatgatatcc atcacactgg cggccgctcg 1920

acgatatcta gagcgcgcat aacttcgtat aatgtatgct atacgaagtt ataggatcca 1980

tcacactggc ggcccaattc gccctatagt gagtcgtatt acaattcact ggccgtcgtt 2040

ttacaacgtc gtgactggga aaaccctggc gttacccaac ttaatcgcct tgcagcacat 2100

ccccctttcg ccagctggcg taatagcgaa gaggcccgca ccgatcgccc ttcccaacag 2160

ttgcgcagcc tatacgtacg gcagtttaag gtttacacct ataaaagaga gagccgttat 2220

cgtctgtttg tggatgtaca gagtgatatt attgacacgc cggggcgacg gatggtgatc 2280

cccctggcca gtgcacgtct gctgtcagat aaagtctccc gtgaacttta cccggtggtg 2340

catatcgggg atgaaagctg gcgcatgatg accaccgata tggccagtgt gccggtctcc 2400

gttatcgggg aagaagtggc tgatctcagc caccgcgaaa atgacatcaa aaacgccatt 2460

aacctgatgt tctggggaat ataaatgtca ggcatgagat tatcaaaaag gatcttcacc 2520

tagatccttt tcacgtagaa agccagtccg cagaaacggt gctgaccccg gatgaatgtc 2580

agctactggg ctatctggac aagggaaaac gcaagcgcaa agagaaagca ggtagcttgc 2640

agtgggctta catggcgata gctagactgg gcggttttat ggacagcaag cgaaccggaa 2700

ttgccagctg gggcgccctc tggtaaggtt gggaagccct gcaaagtaaa ctggatggct 2760

ttctcgccgc caaggatctg atggcgcagg ggatcaagct ctgatcaaga gacaggatga 2820

ggatcgtttc gcatgattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg 2880

gagaggctat tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg 2940

ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc 3000

ctgaatgaac tgcaagacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct 3060

tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa 3120

gtgccggggc aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg 3180

gctgatgcaa tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa 3240

gcgaaacatc gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat 3300

gatctggacg aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg 3360

agcatgcccg acggcgagga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc 3420

atggtggaaa atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac 3480

cgctatcagg acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg 3540

gctgaccgct tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc 3600

tatcgccttc ttgacgagtt cttctgaatt attaacgctt acaatttcct gatgcggtat 3660

tttctcctta cgcatctgtg cggtatttca caccgcatac aggtggcact tttcggggaa 3720

atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca 3780

tgagacaata accctgataa atgcttcaat aatagcacgt gaggagggcc accatggcca 3840

agttgaccag tgccgttccg gtgctcaccg cgcgcgacgt cgccggagcg gtcgagttct 3900

ggaccgaccg gctcgggttc tcccgggact tcgtggagga cgacttcgcc ggtgtggtcc 3960

gggacgacgt gaccctgttc atcagcgcgg tccaggacca ggtggtgccg gacaacaccc 4020

tggcctgggt gtgggtgcgc ggcctggacg agctgtacgc cgagtggtcg gaggtcgtgt 4080

ccacgaactt ccgggacgcc tccgggccgg ccatgaccga gatcggcgag cagccgtggg 4140

ggcgggagtt cgccctgcgc gacccggccg gcaactgcgt gcacttcgtg gccgaggagc 4200

aggactgaca cgtgctaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt 4260

ttgataatct catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc 4320

ccgtagaaaa gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct 4380

tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa 4440

ctctttttcc gaaggtaact ggcttcagca gagcgcagat accaaatact gtccttctag 4500

tgtagccgta gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc 4560

tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg 4620

actcaagacg atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca 4680

cacagcccag cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat 4740

gagaaagcgc cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg 4800

tcggaacagg agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc 4860

ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc 4920

ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg gttcctgggc ttttgctggc 4980

cttttgctca catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg 5040

cctttgagtg agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcaagcg 5100

cccaatacgc aaaccgcctc tccccgcgcg ttggccgatt cattaatgca gctggcacga 5160

caggtttccc gactggaaag cgggcagtga gcgcaacgca attaatgtga gttagctcac 5220

tcattaggca ccccaggctt tacactttat 5250

<210> SEQ ID NO: 55

<211> LENGTH: 4744

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN775; TOPO-BLUNT-loxP-natMX-loxP (loxP sites

in opposite orientation)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(4744)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“pRN775;

TOPO-BLUNT-loxP-natMX-loxP (loxP sites in opposite orientation)”

/mol_type=“unassigned DNA”

<400> SEQENCE: 55

gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca caggaaacag 60

ctatgaccat gattacgcca agctatttag gtgacactat agaatactca agctatgcat 120

caagcttggt accgagctcg gatccactag cataacttcg tataatgtat gctatacgaa 180

gttattctag taacggccgc cagtgtgctg gaattcgccc ttaagcttgc ctcgtccccg 240

ccgggtcacc cggccagcga catggaggcc cagaataccc tccttgacag tcttgacgtg 300

cgcagctcag gggcatgatg tgactgtcgc ccgtacattt agcccataca tccccatgta 360

taatcatttg catccataca ttttgatggc cgcacggcgc gaagcaaaaa ttacggctcc 420

tcgctgcaga cctgcgagca gggaaacgct cccctcacag acgcgttgaa ttgtccccac 480

gccgcgcccc tgtagagaaa tataaaaggt taggatttgc cactgaggtt cttctttcat 540

atacttcctt ttaaaatctt gctaggatac agttctcaca tcacatccga acataaacaa 600

ccatgtaaaa tgaccactct tgacgacacg gcttaccggt accgcaccag tgtcccgggg 660

gacgccgagg ccatcgaggc actggatggg tccttcacca ccgacaccgt cttccgcgtc 720

accgccaccg gggacggctt caccctgcgg gaggtgccgg tggacccgcc cctgaccaag 780

gtgttccccg acgacgaatc ggacgacgaa tcggacgccg gggaggacgg cgacccggac 840

tcccggacgt tcgtcgcgta cggggacgac ggcgacctgg cgggcttcgt ggtcgtctcg 900

tactccggct ggaaccgccg gctgaccgtc gaggacatcg aggtcgcccc ggagcaccgg 960

gggcacgggg tcgggcgcgc gttgatgggg ctcgcgacgg agttcgcccg cgagcggggc 1020

gccgggcacc tctggctgga ggtcaccaac gtcaacgcac cggcgatcca cgcgtaccgg 1080

cggatggggt tcaccctctg cggcctggac accgccctgt acgacggcac cgcctcggac 1140

ggcgagcagg cgctctacat gagcatgccc tgcccctagt actgacaata aaaagattct 1200

tgttttcaag aacttgtcat ttgtatagtt tttttatatt gtagttgttc tattttaatc 1260

aaatgttagc gtgatttata ttttttttcg cctcgacatc atctgcccag atgcgaagtt 1320

aagtgcgcag aaagtaatat catgcgtcaa tcgtatgtga atgctggtcg ctatactgct 1380

gtcgattcga tactaacgcc gccatccagt gtcgacgata tctagagcgc gcataacttc 1440

gtataatgta tgctatacga agttatagga tccatcacac tggcggccca attcgcccta 1500

tagtgagtcg tattacaatt cactggccgt cgttttacaa cgtcgtgact gggaaaaccc 1560

tggcgttacc caacttaatc gccttgcagc acatccccct ttcgccagct ggcgtaatag 1620

cgaagaggcc cgcaccgatc gcccttccca acagttgcgc agcctatacg tacggcagtt 1680

taaggtttac acctataaaa gagagagccg ttatcgtctg tttgtggatg tacagagtga 1740

tattattgac acgccggggc gacggatggt gatccccctg gccagtgcac gtctgctgtc 1800

agataaagtc tcccgtgaac tttacccggt ggtgcatatc ggggatgaaa gctggcgcat 1860

gatgaccacc gatatggcca gtgtgccggt ctccgttatc ggggaagaag tggctgatct 1920

cagccaccgc gaaaatgaca tcaaaaacgc cattaacctg atgttctggg gaatataaat 1980

gtcaggcatg agattatcaa aaaggatctt cacctagatc cttttcacgt agaaagccag 2040

tccgcagaaa cggtgctgac cccggatgaa tgtcagctac tgggctatct ggacaaggga 2100

aaacgcaagc gcaaagagaa agcaggtagc ttgcagtggg cttacatggc gatagctaga 2160

ctgggcggtt ttatggacag caagcgaacc ggaattgcca gctggggcgc cctctggtaa 2220

ggttgggaag ccctgcaaag taaactggat ggctttctcg ccgccaagga tctgatggcg 2280

caggggatca agctctgatc aagagacagg atgaggatcg tttcgcatga ttgaacaaga 2340

tggattgcac gcaggttctc cggccgcttg ggtggagagg ctattcggct atgactgggc 2400

acaacagaca atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc 2460

ggttcttttt gtcaagaccg acctgtccgg tgccctgaat gaactgcaag acgaggcagc 2520

gcggctatcg tggctggcca cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac 2580

tgaagcggga agggactggc tgctattggg cgaagtgccg gggcaggatc tcctgtcatc 2640

tcaccttgct cctgccgaga aagtatccat catggctgat gcaatgcggc ggctgcatac 2700

gcttgatccg gctacctgcc cattcgacca ccaagcgaaa catcgcatcg agcgagcacg 2760

tactcggatg gaagccggtc ttgtcgatca ggatgatctg gacgaagagc atcaggggct 2820

cgcgccagcc gaactgttcg ccaggctcaa ggcgagcatg cccgacggcg aggatctcgt 2880

cgtgacccat ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg 2940

attcatcgac tgtggccggc tgggtgtggc ggaccgctat caggacatag cgttggctac 3000

ccgtgatatt gctgaagagc ttggcggcga atgggctgac cgcttcctcg tgctttacgg 3060

tatcgccgct cccgattcgc agcgcatcgc cttctatcgc cttcttgacg agttcttctg 3120

aattattaac gcttacaatt tcctgatgcg gtattttctc cttacgcatc tgtgcggtat 3180

ttcacaccgc atacaggtgg cacttttcgg ggaaatgtgc gcggaacccc tatttgttta 3240

tttttctaaa tacattcaaa tatgtatccg ctcatgagac aataaccctg ataaatgctt 3300

caataatagc acgtgaggag ggccaccatg gccaagttga ccagtgccgt tccggtgctc 3360

accgcgcgcg acgtcgccgg agcggtcgag ttctggaccg accggctcgg gttctcccgg 3420

gacttcgtgg aggacgactt cgccggtgtg gtccgggacg acgtgaccct gttcatcagc 3480

gcggtccagg accaggtggt gccggacaac accctggcct gggtgtgggt gcgcggcctg 3540

gacgagctgt acgccgagtg gtcggaggtc gtgtccacga acttccggga cgcctccggg 3600

ccggccatga ccgagatcgg cgagcagccg tgggggcggg agttcgccct gcgcgacccg 3660

gccggcaact gcgtgcactt cgtggccgag gagcaggact gacacgtgct aaaacttcat 3720

ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct 3780

taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct 3840

tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca 3900

gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc 3960

agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc 4020

aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct 4080

gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag 4140

gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc 4200

tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg 4260

agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag 4320

cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt 4380

gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac 4440

gcggcctttt tacggttcct gggcttttgc tggccttttg ctcacatgtt ctttcctgcg 4500

ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc 4560

cgcagccgaa cgaccgagcg cagcgagtca agcgcccaat acgcaaaccg cctctccccg 4620

cgcgttggcc gattcattaa tgcagctggc acgacaggtt tcccgactgg aaagcgggca 4680

gtgagcgcaa cgcaattaat gtgagttagc tcactcatta ggcaccccag gctttacact 4740

ttat 4744

<210> SEQ ID NO: 56

<211> LENGTH: 1725

<212> TYPE: DNA

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(1725)

<223> OTHER INFORMATION: /organism=“Saccharomyces cerevisiae”

/note=“WT-GAL2 DNA sequence ” /mol_type=“unassigned DNA”

<400> SEQENCE: 56

atggcagttg aggagaacaa tatgcctgtt gtttcacagc aaccccaagc tggtgaagac 60

gtgatctctt cactcagtaa agattcccat ttaagcgcac aatctcaaaa gtattccaat 120

gatgaattga aagccggtga gtcagggcct gaaggctccc aaagtgttcc tatagagata 180

cccaagaagc ccatgtctga atatgttacc gtttccttgc tttgtttgtg tgttgccttc 240

ggcggcttca tgtttggctg ggataccggt actatttctg ggtttgttgt ccaaacagac 300

tttttgagaa ggtttggtat gaaacataag gatggtaccc actatttgtc aaacgtcaga 360

acaggtttaa tcgtcgccat tttcaatatt ggctgtgcct ttggtggtat tatactttcc 420

aaaggtggag atatgtatgg ccgtaaaaag ggtctttcga ttgtcgtctc ggtttatata 480

gttggtatta tcattcaaat tgcctctatc aacaagtggt accaatattt cattggtaga 540

atcatatctg gtttgggtgt cggcggcatc gccgtcttat gtcctatgtt gatctctgaa 600

attgctccaa agcacttgag aggcacacta gtttcttgtt atcagctgat gattactgca 660

ggtatctttt tgggctactg tactaattac ggtacaaaga gctattcgaa ctcagttcaa 720

tggagagttc cattagggct atgtttcgct tggtcattat ttatgattgg cgctttgacg 780

ttagttcctg aatccccacg ttatttatgt gaggtgaata aggtagaaga cgccaagctt 840

tccattgcta agtctaacaa ggtgtcacca gaggatcctg ccgtccaggc agagttagat 900

ctgatcatgg ccggtataga agctgaaaaa ctggctggca atgcgtcctg gggggaatta 960

ttttccacca agaccaaagt atttcaacgt ttgttgatgg gtgtatttgt tcaaatgttc 1020

caacaattaa ccggtaacaa ttattttttc tactacggta ccgttatttt caagtcagtt 1080

ggcctggatg attcctttga aacatccatt gtcattggtg tagtcaactt tgcctccact 1140

ttctttagtt tgtggactgt cgaaaacttg gggcgtcgta aatgtttact tttgggcgct 1200

gccactatga tggcttgtat ggtcatctac gcctctgttg gtgttaccag attatatcct 1260

cacggtaaaa gccagccatc ttctaaaggt gccggtaact gtatgattgt ctttacctgt 1320

ttttatattt tctgttatgc cacaacctgg gcgccagttg cctgggtcat cacagcagaa 1380

tcattcccac tgagagtcaa gtcgaaatgt atggcgttgg cctctgcttc caattgggta 1440

tgggggttct tgattgcatt tttcacccca ttcatcacat ctgccattaa cttctactac 1500

ggttatgtct tcatgggctg tttggttgcc atgttttttt atgtcttttt ctttgttcca 1560

gaaactaaag gcctatcgtt agaagaaatt caagaattat gggaagaagg tgttttacct 1620

tggaaatctg aaggctggat tccttcatcc agaagaggta ataattacga tttagaggat 1680

ttacaacatg acgacaaacc gtggtacaag gccatgctag aataa 1725

<210> SEQ ID NO: 57

<211> LENGTH: 7392

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN993

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(7392)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“pRN993 ”

/mol_type=“unassigned DNA”

<400> SEQENCE: 57

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accataattc cgttttaaga gcttggtgag cgctaggagt cactgccagg tatcgtttga 240

acacggcatt agtcagggaa gtcataacac agtcctttcc cgcaattttc tttttctatt 300

actcttggcc tcctctagta cactctatat ttttttatgc ctcggtaatg attttcattt 360

ttttttttcc acctagcgga tgactctttt tttttcttag cgattggcat tatcacataa 420

tgaattatac attatataaa gtaatgtgat ttcttcgaag aatatactaa aaaatgagca 480

ggcaagataa acgaaggcaa agatgacaga gcagaaagcc ctagtaaagc gtattacaaa 540

tgaaaccaag attcagattg cgatctcttt aaagggtggt cccctagcga tagagcactc 600

gatcttccca gaaaaagagg cagaagcagt agcagaacag gccacacaat cgcaagtgat 660

taacgtccac acaggtatag ggtttctgga ccatatgata catgctctgg ccaagcattc 720

cggctggtcg ctaatcgttg agtgcattgg tgacttacac atagacgacc atcacaccac 780

tgaagactgc gggattgctc tcggtcaagc ttttaaagag gccctactgg cgcgtggagt 840

aaaaaggttt ggatcaggat ttgcgccttt ggatgaggca ctttccagag cggtggtaga 900

tctttcgaac aggccgtacg cagttgtcga acttggtttg caaagggaga aagtaggaga 960

tctctcttgc gagatgatcc cgcattttct tgaaagcttt gcagaggcta gcagaattac 1020

cctccacgtt gattgtctgc gaggcaagaa tgatcatcac cgtagtgaga gtgcgttcaa 1080

ggctcttgcg gttgccataa gagaagccac ctcgcccaat ggtaccaacg atgttccctc 1140

caccaaaggt gttcttatgt agtgacaccg attatttaaa gctgcagcat acgatatata 1200

tacatgtgta tatatgtata cctatgaatg tcagtaagta tgtatacgaa cagtatgata 1260

ctgaagatga caaggtaatg catcattcta tacgtgtcat tctgaacgag gcgcgatcgc 1320

gctttccttt tttctttttg ctttttcttt ttttttctct tgaactcgac ggatcatatg 1380

cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggaa attgtaaacg 1440

ttaatatttt gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat 1500

aggccgaaat cggcaaaatc ccttataaat caaaagaata gaccgagata gggttgagtg 1560

ttgttccagt ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc 1620

gaaaaaccgt ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt 1680

tggggtcgag gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag 1740

cttgacgggg aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaggagcggg 1800

cgctagggcg ctggcaagtg tagcggtcac gctgcgcgta accaccacac ccgccgcgct 1860

taatgcgccg ctacagggcg cgtcgcgcca ttcgccattc aggctgcgca actgttggga 1920

agggcgatcg gtgcgggcct cttcgctatt acgccagctg gcgaaggggg gatgtgctgc 1980

aaggcgatta agttgggtaa cgccagggtt ttcccagtca cgacgttgta aaacgacggc 2040

cagtgaattg taatacgact cactataggg cgaattggag ctccaccgcg gtggcggccg 2100

cggctacttc tcgtaggaac aatttcgggc ccctgcgtgt tcttctgagg ttcatctttt 2160

acatttgctt ctgctggata attttcagag gcaacaagga aaaattagat ggcaaaaagt 2220

cgtctttcaa ggaaaaatcc ccaccatctt tcgagatccc ctgtaactta ttggcaactg 2280

aaagaatgaa aaggaggaaa atacaaaata tactagaact gaaaaaaaaa aagtataaat 2340

agagacgata tatgccaata cttcacaatg ttcgaatcta ttcttcattt gcagctattg 2400

taaaataata aaacatcaag aacaaacaag ctcaacttgt cttttctaag aacaaagaat 2460

aaacacaaaa acaaaaagtt tttttaattc tgcagatctc tagaaaatgg cagttgagga 2520

gaacaatatg cctgttgttt cacagcaacc ccaagctggt gaagacgtga tctcttcact 2580

cagtaaagat tcccatttaa gcgcacaatc tcaaaagtat tctaatgatg aattgaaagc 2640

cggtgagtca gggtctgaag gctcccaaag tgttcctata gagataccca agaagcccat 2700

gtctgaatat gttaccgttt ccttgctttg tttgtgtgtt gccttcggcg gcttcatgtt 2760

tggctgggat accggtacta tttctgggtt tgttgtccaa acagactttt tgagaaggtt 2820

tggtatgaaa cataaggatg gtacccacta tttgtcaaac gtcagaacag gtttaatcgt 2880

cgccattttc aatattggct gtgcctttgg tggtattata ctttccaaag gtggagatat 2940

gtatggccgt aaaaagggtc tttcgattgt cgtctcggtt tatatagttg gtattatcat 3000

tcaaattgcc tctatcaaca agtggtacca atatttcatt ggtagaatca tatctggttt 3060

gggtgtcggc ggcatcgccg tcttatgtcc tatgttgatc tctgaaattg ctccaaagca 3120

cttgagaggc acactagttt cttgttatca gctgatgatt actgcaggta tctttttggg 3180

ctactgtact aattacggta caaagagcta ttcgaactca gttcaatgga gagttccatt 3240

agggctatgt ttcgcttggt cattatttat gattggcgct ttgacgttag ttcctgaatc 3300

cccacgttat ttatgtgagg tgaataaggt agaagacgcc aagcgttcca ttgctaagtc 3360

taacaaggtg tcaccagagg atcctgccgt ccaggcagag ttagatctga tcatggccgg 3420

tatagaagct gaaaaactgg ctggcaatgc gtcctggggg gaattatttt ccaccaagac 3480

caaagtattt caacgtttgt tgatgggtgt gtttgttcaa atgttccaac aattaaccgg 3540

taacaattat tttttctact acggtaccgt tattttcaag tcagttggcc tggatgattc 3600

ctttgaaaca tccattgtca ttggtgtagt caactttgcc tccactttct ttagtttgtg 3660

gactgtcgaa aacttgggac atcgtaaatg tttacttttg ggcgctgcca ctatgatggc 3720

ttgtatggtc atctacgcct ctgttggtgt tactagatta tatcctcacg gtaaaagcca 3780

gccatcttct aaaggtgccg gtaactgtat gattgtcttt acctgttttt atattttctg 3840

ttatgccaca acctgggcgc cagttgcctg ggtcatcaca gcagaatcat tcccactgag 3900

agtcaagtcg aaatgtatgg cgttggcctc tgcttccaat tgggtatggg ggttcttgat 3960

tgcatttttc accccattca tcacatctgc cattaacttc tactacggtt atgtcttcat 4020

gggctgtttg gttgccatgt ttttttatgt ctttttcttt gttccagaaa ctaaaggcct 4080

atcgttagaa gaaattcaag aattatggga agaaggtgtt ttaccttgga aatctgaagg 4140

ctggattcct tcatccagaa gaggtaataa ttacgattta gaggatttac aacatgacga 4200

caaaccgtgg tacaaggcca tgctagaata agcttgcgcg cgaatttctt atgatttatg 4260

atttttatta ttaaataagt tataaaaaaa ataagtgtat acaaatttta aagtgactct 4320

taggttttaa aacgaaaatt cttattcttg agtaactctt tcctgtaggt caggttgctt 4380

tctcaggtat agcatgaggt cgctcttatt gaccacacct ctaccggcat gccgagcaaa 4440

tgcctgcaaa tcgctcccca tttcacccaa ttgtagatat gctaactcca gcaatgagtt 4500

gatgaatctc ggtgtgtatt ttatgtcctc agaggacaac acctgttgta atcgttcttc 4560

cacacgtacg aagcttatcg ataccgtcga gggggggccc ggtacccagc ttttgttccc 4620

tttagtgagg gttaattccg agcttggcgt aatcatggtc atagctgttt cctgtgtgaa 4680

attgttatcc gctcacaatt ccacacaaca taggagccgg aagcataaag tgtaaagcct 4740

ggggtgccta atgagtgagg taactcacat taattgcgtt gcgctcactg cccgctttcc 4800

agtcgggaaa cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg 4860

gtttgcgtat tgggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc 4920

ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag 4980

gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa 5040

aggccgcgtt gctggcgttt ttccataggc tcggcccccc tgacgagcat cacaaaaatc 5100

gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgttccccc 5160

ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg 5220

cctttctccc ttcgggaagc gtggcgcttt ctcaatgctc acgctgtagg tatctcagtt 5280

cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc 5340

gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc 5400

cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag 5460

agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg 5520

ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa 5580

ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag 5640

gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact 5700

cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa 5760

attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt 5820

accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag 5880

ttgcctgact gcccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca 5940

gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc 6000

agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt 6060

ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg 6120

ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca 6180

gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtga aaaaaagcgg 6240

ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca 6300

tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg 6360

tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct 6420

cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca 6480

tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca 6540

gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccacgt 6600

ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg 6660

gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta 6720

ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc 6780

gcgcacattt ccccgaaaag tgccacctgg gtccttttca tcacgtgcta taaaaataat 6840

tataatttaa attttttaat ataaatatat aaattaaaaa tagaaagtaa aaaaagaaat 6900

taaagaaaaa atagtttttg ttttccgaag atgtaaaaga ctctaggggg atcgccaaca 6960

aatactacct tttatcttgc tcttcctgct ctcaggtatt aatgccgaat tgtttcatct 7020

tgtctgtgta gaagaccaca cacgaaaatc ctgtgatttt acattttact tatcgttaat 7080

cgaatgtata tctatttaat ctgcttttct tgtctaataa atatatatgt aaagtacgct 7140

ttttgttgaa attttttaaa cctttgttta tttttttttc ttcattccgt aactcttcta 7200

ccttctttat ttactttcta aaatccaaat acaaaacata aaaataaata aacacagagt 7260

aaattcccaa attattccat cattaaaaga tacgaggcgc gtgtaagtta caggcaagcg 7320

atccgtccta agaaaccatt attatcatga cattaaccta taaaaatagg cgtatcacga 7380

ggccctttcg tc 7392

<210> SEQ ID NO: 58

<211> LENGTH: 7389

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pDB1250; WT-GAL2 expression vector for

screening

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(7389)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“pDB1250; WT-GAL2 expression vector for screening”

/mol_type=“unassigned DNA”

<400> SEQENCE: 58

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accataattc cgttttaaga gcttggtgag cgctaggagt cactgccagg tatcgtttga 240

acacggcatt agtcagggaa gtcataacac agtcctttcc cgcaattttc tttttctatt 300

actcttggcc tcctctagta cactctatat ttttttatgc ctcggtaatg attttcattt 360

ttttttttcc acctagcgga tgactctttt tttttcttag cgattggcat tatcacataa 420

tgaattatac attatataaa gtaatgtgat ttcttcgaag aatatactaa aaaatgagca 480

ggcaagataa acgaaggcaa agatgacaga gcagaaagcc ctagtaaagc gtattacaaa 540

tgaaaccaag attcagattg cgatctcttt aaagggtggt cccctagcga tagagcactc 600

gatcttccca gaaaaagagg cagaagcagt agcagaacag gccacacaat cgcaagtgat 660

taacgtccac acaggtatag ggtttctgga ccatatgata catgctctgg ccaagcattc 720

cggctggtcg ctaatcgttg agtgcattgg tgacttacac atagacgacc atcacaccac 780

tgaagactgc gggattgctc tcggtcaagc ttttaaagag gccctactgg cgcgtggagt 840

aaaaaggttt ggatcaggat ttgcgccttt ggatgaggca ctttccagag cggtggtaga 900

tctttcgaac aggccgtacg cagttgtcga acttggtttg caaagggaga aagtaggaga 960

tctctcttgc gagatgatcc cgcattttct tgaaagcttt gcagaggcta gcagaattac 1020

cctccacgtt gattgtctgc gaggcaagaa tgatcatcac cgtagtgaga gtgcgttcaa 1080

ggctcttgcg gttgccataa gagaagccac ctcgcccaat ggtaccaacg atgttccctc 1140

caccaaaggt gttcttatgt agtgacaccg attatttaaa gctgcagcat acgatatata 1200

tacatgtgta tatatgtata cctatgaatg tcagtaagta tgtatacgaa cagtatgata 1260

ctgaagatga caaggtaatg catcattcta tacgtgtcat tctgaacgag gcgcgatcgc 1320

gctttccttt tttctttttg ctttttcttt ttttttctct tgaactcgac ggatcatatg 1380

cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggaa attgtaaacg 1440

ttaatatttt gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat 1500

aggccgaaat cggcaaaatc ccttataaat caaaagaata gaccgagata gggttgagtg 1560

ttgttccagt ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc 1620

gaaaaaccgt ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt 1680

tggggtcgag gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag 1740

cttgacgggg aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaggagcggg 1800

cgctagggcg ctggcaagtg tagcggtcac gctgcgcgta accaccacac ccgccgcgct 1860

taatgcgccg ctacagggcg cgtcgcgcca ttcgccattc aggctgcgca actgttggga 1920

agggcgatcg gtgcgggcct cttcgctatt acgccagctg gcgaaggggg gatgtgctgc 1980

aaggcgatta agttgggtaa cgccagggtt ttcccagtca cgacgttgta aaacgacggc 2040

cagtgaattg taatacgact cactataggg cgaattggag ctccaccgcg gtggcggccg 2100

cggctacttc tcgtaggaac aatttcgggc ccctgcgtgt tcttctgagg ttcatctttt 2160

acatttgctt ctgctggata attttcagag gcaacaagga aaaattagat ggcaaaaagt 2220

cgtctttcaa ggaaaaatcc ccaccatctt tcgagatccc ctgtaactta ttggcaactg 2280

aaagaatgaa aaggaggaaa atacaaaata tactagaact gaaaaaaaaa aagtataaat 2340

agagacgata tatgccaata cttcacaatg ttcgaatcta ttcttcattt gcagctattg 2400

taaaataata aaacatcaag aacaaacaag ctcaacttgt cttttctaag aacaaagaat 2460

aaacacaaaa acaaaaagtt tttttaattc tgcagatctc tagaaaaatg gcagttgagg 2520

agaacaatat gcctgttgtt tcacagcaac cccaagctgg tgaagacgtg atctcttcac 2580

tcagtaaaga ttcccattta agcgcacaat ctcaaaagta ttccaatgat gaattgaaag 2640

ccggtgagtc agggcctgaa ggctcccaaa gtgttcctat agagataccc aagaagccca 2700

tgtctgaata tgttaccgtt tccttgcttt gtttgtgtgt tgccttcggc ggcttcatgt 2760

ttggctggga taccggtact atttctgggt ttgttgtcca aacagacttt ttgagaaggt 2820

ttggtatgaa acataaggat ggtacccact atttgtcaaa cgtcagaaca ggtttaatcg 2880

tcgccatttt caatattggc tgtgcctttg gtggtattat actttccaaa ggtggagata 2940

tgtatggccg taaaaagggt ctttcgattg tcgtctcggt ttatatagtt ggtattatca 3000

ttcaaattgc ctctatcaac aagtggtacc aatatttcat tggtagaatc atatctggtt 3060

tgggtgtcgg cggcatcgcc gtcttatgtc ctatgttgat ctctgaaatt gctccaaagc 3120

acttgagagg cacactagtt tcttgttatc agctgatgat tactgcaggt atctttttgg 3180

gctactgtac taattacggt acaaagagct attcgaactc agttcaatgg agagttccat 3240

tagggctatg tttcgcttgg tcattattta tgattggcgc tttgacgtta gttcctgaat 3300

ccccacgtta tttatgtgag gtgaataagg tagaagacgc caagctttcc attgctaagt 3360

ctaacaaggt gtcaccagag gatcctgccg tccaggcaga gttagatctg atcatggccg 3420

gtatagaagc tgaaaaactg gctggcaatg cgtcctgggg ggaattattt tccaccaaga 3480

ccaaagtatt tcaacgtttg ttgatgggtg tatttgttca aatgttccaa caattaaccg 3540

gtaacaatta ttttttctac tacggtaccg ttattttcaa gtcagttggc ctggatgatt 3600

cctttgaaac atccattgtc attggtgtag tcaactttgc ctccactttc tttagtttgt 3660

ggactgtcga aaacttgggg cgtcgtaaat gtttactttt gggcgctgcc actatgatgg 3720

cttgtatggt catctacgcc tctgttggtg ttaccagatt atatcctcac ggtaaaagcc 3780

agccatcttc taaaggtgcc ggtaactgta tgattgtctt tacctgtttt tatattttct 3840

gttatgccac aacctgggcg ccagttgcct gggtcatcac agcagaatca ttcccactga 3900

gagtcaagtc gaaatgtatg gcgttggcct ctgcttccaa ttgggtatgg gggttcttga 3960

ttgcattttt caccccattc atcacatctg ccattaactt ctactacggt tatgtcttca 4020

tgggctgttt ggttgccatg tttttttatg tctttttctt tgttccagaa actaaaggcc 4080

tatcgttaga agaaattcaa gaattatggg aagaaggtgt tttaccttgg aaatctgaag 4140

gctggattcc ttcatccaga agaggtaata attacgattt agaggattta caacatgacg 4200

acaaaccgtg gtacaaggcc atgctagaat aagcgcgcga atttcttatg atttatgatt 4260

tttattatta aataagttat aaaaaaaata agtgtataca aattttaaag tgactcttag 4320

gttttaaaac gaaaattctt attcttgagt aactctttcc tgtaggtcag gttgctttct 4380

caggtatagc atgaggtcgc tcttattgac cacacctcta ccggcatgcc gagcaaatgc 4440

ctgcaaatcg ctccccattt cacccaattg tagatatgct aactccagca atgagttgat 4500

gaatctcggt gtgtatttta tgtcctcaga ggacaacacc tgttgtaatc gttcttccac 4560

acgtacgaag cttatcgata ccgtcgaggg ggggcccggt acccagcttt tgttcccttt 4620

agtgagggtt aattccgagc ttggcgtaat catggtcata gctgtttcct gtgtgaaatt 4680

gttatccgct cacaattcca cacaacatag gagccggaag cataaagtgt aaagcctggg 4740

gtgcctaatg agtgaggtaa ctcacattaa ttgcgttgcg ctcactgccc gctttccagt 4800

cgggaaacct gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg agaggcggtt 4860

tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc 4920

tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca gaatcagggg 4980

ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg 5040

ccgcgttgct ggcgtttttc cataggctcg gcccccctga cgagcatcac aaaaatcgac 5100

gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg ttcccccctg 5160

gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct 5220

ttctcccttc gggaagcgtg gcgctttctc aatgctcacg ctgtaggtat ctcagttcgg 5280

tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct 5340

gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac 5400

tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt 5460

tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc 5520

tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca 5580

ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat 5640

ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac 5700

gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc cttttaaatt 5760

aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct gacagttacc 5820

aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca tccatagttg 5880

cctgactgcc cgtcgtgtag ataactacga tacgggaggg cttaccatct ggccccagtg 5940

ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca ataaaccagc 6000

cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc atccagtcta 6060

ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg cgcaacgttg 6120

ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct tcattcagct 6180

ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgaaaa aaagcggtta 6240

gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg 6300

ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc ttttctgtga 6360

ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg agttgctctt 6420

gcccggcgtc aatacgggat aataccgcgc cacatagcag aactttaaaa gtgctcatca 6480

ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg agatccagtt 6540

cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc accacgtttc 6600

tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa 6660

atgttgaata ctcatactct tcctttttca atattattga agcatttatc agggttattg 6720

tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg 6780

cacatttccc cgaaaagtgc cacctgggtc cttttcatca cgtgctataa aaataattat 6840

aatttaaatt ttttaatata aatatataaa ttaaaaatag aaagtaaaaa aagaaattaa 6900

agaaaaaata gtttttgttt tccgaagatg taaaagactc tagggggatc gccaacaaat 6960

actacctttt atcttgctct tcctgctctc aggtattaat gccgaattgt ttcatcttgt 7020

ctgtgtagaa gaccacacac gaaaatcctg tgattttaca ttttacttat cgttaatcga 7080

atgtatatct atttaatctg cttttcttgt ctaataaata tatatgtaaa gtacgctttt 7140

tgttgaaatt ttttaaacct ttgtttattt ttttttcttc attccgtaac tcttctacct 7200

tctttattta ctttctaaaa tccaaataca aaacataaaa ataaataaac acagagtaaa 7260

ttcccaaatt attccatcat taaaagatac gaggcgcgtg taagttacag gcaagcgatc 7320

cgtcctaaga aaccattatt atcatgacat taacctataa aaataggcgt atcacgaggc 7380

cctttcgtc 7389

<210> SEQ ID NO: 59

<211> LENGTH: 574

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: MISC_FEATURE

<222> LOCATION: (1)..(574)

<223> OTHER INFORMATION: WT Gal2p amino acid sequence

<400> SEQENCE: 59

Met Ala Val Glu Glu Asn Asn Met Pro Val Val Ser Gln Gln Pro Gln

1 5 10 15

Ala Gly Glu Asp Val Ile Ser Ser Leu Ser Lys Asp Ser His Leu Ser

20 25 30

Ala Gln Ser Gln Lys Tyr Ser Asn Asp Glu Leu Lys Ala Gly Glu Ser

35 40 45

Gly Pro Glu Gly Ser Gln Ser Val Pro Ile Glu Ile Pro Lys Lys Pro

50 55 60

Met Ser Glu Tyr Val Thr Val Ser Leu Leu Cys Leu Cys Val Ala Phe

65 70 75 80

Gly Gly Phe Met Phe Gly Trp Asp Thr Gly Thr Ile Ser Gly Phe Val

85 90 95

Val Gln Thr Asp Phe Leu Arg Arg Phe Gly Met Lys His Lys Asp Gly

100 105 110

Thr His Tyr Leu Ser Asn Val Arg Thr Gly Leu Ile Val Ala Ile Phe

115 120 125

Asn Ile Gly Cys Ala Phe Gly Gly Ile Ile Leu Ser Lys Gly Gly Asp

130 135 140

Met Tyr Gly Arg Lys Lys Gly Leu Ser Ile Val Val Ser Val Tyr Ile

145 150 155 160

Val Gly Ile Ile Ile Gln Ile Ala Ser Ile Asn Lys Trp Tyr Gln Tyr

165 170 175

Phe Ile Gly Arg Ile Ile Ser Gly Leu Gly Val Gly Gly Ile Ala Val

180 185 190

Leu Cys Pro Met Leu Ile Ser Glu Ile Ala Pro Lys His Leu Arg Gly

195 200 205

Thr Leu Val Ser Cys Tyr Gln Leu Met Ile Thr Ala Gly Ile Phe Leu

210 215 220

Gly Tyr Cys Thr Asn Tyr Gly Thr Lys Ser Tyr Ser Asn Ser Val Gln

225 230 235 240

Trp Arg Val Pro Leu Gly Leu Cys Phe Ala Trp Ser Leu Phe Met Ile

245 250 255

Gly Ala Leu Thr Leu Val Pro Glu Ser Pro Arg Tyr Leu Cys Glu Val

260 265 270

Asn Lys Val Glu Asp Ala Lys Leu Ser Ile Ala Lys Ser Asn Lys Val

275 280 285

Ser Pro Glu Asp Pro Ala Val Gln Ala Glu Leu Asp Leu Ile Met Ala

290 295 300

Gly Ile Glu Ala Glu Lys Leu Ala Gly Asn Ala Ser Trp Gly Glu Leu

305 310 315 320

Phe Ser Thr Lys Thr Lys Val Phe Gln Arg Leu Leu Met Gly Val Phe

325 330 335

Val Gln Met Phe Gln Gln Leu Thr Gly Asn Asn Tyr Phe Phe Tyr Tyr

340 345 350

Gly Thr Val Ile Phe Lys Ser Val Gly Leu Asp Asp Ser Phe Glu Thr

355 360 365

Ser Ile Val Ile Gly Val Val Asn Phe Ala Ser Thr Phe Phe Ser Leu

370 375 380

Trp Thr Val Glu Asn Leu Gly Arg Arg Lys Cys Leu Leu Leu Gly Ala

385 390 395 400

Ala Thr Met Met Ala Cys Met Val Ile Tyr Ala Ser Val Gly Val Thr

405 410 415

Arg Leu Tyr Pro His Gly Lys Ser Gln Pro Ser Ser Lys Gly Ala Gly

420 425 430

Asn Cys Met Ile Val Phe Thr Cys Phe Tyr Ile Phe Cys Tyr Ala Thr

435 440 445

Thr Trp Ala Pro Val Ala Trp Val Ile Thr Ala Glu Ser Phe Pro Leu

450 455 460

Arg Val Lys Ser Lys Cys Met Ala Leu Ala Ser Ala Ser Asn Trp Val

465 470 475 480

Trp Gly Phe Leu Ile Ala Phe Phe Thr Pro Phe Ile Thr Ser Ala Ile

485 490 495

Asn Phe Tyr Tyr Gly Tyr Val Phe Met Gly Cys Leu Val Ala Met Phe

500 505 510

Phe Tyr Val Phe Phe Phe Val Pro Glu Thr Lys Gly Leu Ser Leu Glu

515 520 525

Glu Ile Gln Glu Leu Trp Glu Glu Gly Val Leu Pro Trp Lys Ser Glu

530 535 540

Gly Trp Ile Pro Ser Ser Arg Arg Gly Asn Asn Tyr Asp Leu Glu Asp

545 550 555 560

Leu Gln His Asp Asp Lys Pro Trp Tyr Lys Ala Met Leu Glu

565 570

<210> SEQ ID NO: 60

<211> LENGTH: 9400

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN187 (pSH65-derived CRE recombinase

expressing vector)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(9400)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“pRN187

(pSH65-derived CRE recombinase expressing vector)”

/mol_type=“unassigned DNA”

<400> SEQENCE: 60

cctctagagt cgacctgcag cttctcaatg atattcgaat acgctttgag gagatacagc 60

ctaatatccg acaaactgtt ttacagattt acgatcgtac ttgttaccca tcattgaatt 120

ttgaacatcc gaacctggga gttttccctg aaacagatag tatatttgaa cctgtataat 180

aatatatagt ctagcgcttt acggaagaca atgtatgtat ttcggttcct ggagaaacta 240

ttgcatctat tgcataggta atcttgcacg tcgcatcccc ggttcatttt ctgcgtttcc 300

atcttgcact tcaatagcat atctttgtta acgaagcatc tgtgcttcat tttgtagaac 360

aaaaatgcaa cgcgagagcg ctaatttttc aaacaaagaa tctgagctgc atttttacag 420

aacagaaatg caacgcgaaa gcgctatttt accaacgaag aatctgtgct tcatttttgt 480

aaaacaaaaa tgcaacgcga gagcgctaat ttttcaaaca aagaatctga gctgcatttt 540

tacagaacag aaatgcaacg cgagagcgct attttaccaa caaagaatct atacttcttt 600

tttgttctac aaaaatgcat cccgagagcg ctatttttct aacaaagcat cttagattac 660

tttttttctc ctttgtgcgc tctataatgc agtctcttga taactttttg cactgtaggt 720

ccgttaaggt tagaagaagg ctactttggt gtctattttc tcttccataa aaaaagcctg 780

actccacttc ccgcgtttac tgattactag cgaagctgcg ggtgcatttt ttcaagataa 840

aggcatcccc gattatattc tataccgatg tggattgcgc atactttgtg aacagaaagt 900

gatagcgttg atgattcttc attggtcaga aaattatgaa cggtttcttc tattttgtct 960

ctatatacta cgtataggaa atgtttacat tttcgtattg ttttcgattc actctatgaa 1020

tagttcttac tacaattttt ttgtctaaag agtaatacta gagataaaca taaaaaatgt 1080

agaggtcgag tttagatgca agttcaagga gcgaaaggtg gatgggtagg ttatataggg 1140

atatagcaca gagatatata gcaaagagat acttttgagc aatgtttgtg gaagcggtat 1200

tcgcaatatt ttagtagctc gttacagtcc ggtgcgtttt tggttttttg aaagtgcgtc 1260

ttcagagcgc ttttggtttt caaaagcgct ctgaagttcc tatactttct agagaatagg 1320

aacttcggaa taggaacttc aaagcgtttc cgaaaacgag cgcttccgaa aatgcaacgc 1380

gagctgcgca catacagctc actgttcacg tcgcacctat atctgcgtgt tgcctgtata 1440

tatatataca tgagaagaac ggcatagtgc gtgtttatgc ttaaatgcgt acttatatgc 1500

gtctatttat gtaggatgaa aggtagtcta gtacctcctg tgatattatc ccattccatg 1560

cggggtatcg tatgcttcct tcagcactac cctttagctg ttctatatgc tgccactcct 1620

caattggatt agtctcatcc ttcaatgcta tcatttcctt tgatattgga tcatatgcat 1680

agtaccgaga aactagtgcg aagtagtgat caggtattgc tgttatctga tgagtatacg 1740

ttgtcctggc cacggcagaa gcacgcttat cgctccaatt tcccacaaca ttagtcaact 1800

ccgttaggcc cttcattgaa agaaatgagg tcatcaaatg tcttccaatg tgagattttg 1860

ggccattttt tatagcaaag attgaataag gcgcattttt cttcaaagct ttattgtacg 1920

atctgactaa gttatctttt aataattggt attcctgttt attgcttgaa gaattgccgg 1980

tcctatttac tcgttttagg actggttcag aattcttgaa gacgaaaggg cctcgtgata 2040

cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact 2100

tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg 2160

tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt 2220

atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct 2280

gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca 2340

cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc 2400

gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc 2460

cgtgttgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg 2520

gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta 2580

tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc 2640

ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt 2700

gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg 2760

cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct 2820

tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc 2880

tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct 2940

cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac 3000

acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc 3060

tcactgatta agcattggta actgtcagac caagtttact catatatact ttagattgat 3120

ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg 3180

accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc 3240

aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa 3300

ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag 3360

gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta 3420

ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta 3480

ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag 3540

ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg 3600

gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg 3660

cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag 3720

cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc 3780

cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa 3840

aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg 3900

ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct 3960

gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa 4020

gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta atgcagctgg 4080

cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa tgtgagttac 4140

ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcctat gttgtgtgga 4200

attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta cgccaagcgc 4260

gcaattaacc ctcactaaag ggaacaaaag ctggagctct agtacggatt agaagccgcc 4320

gagcgggtga cagccctccg aaggaagact ctcctccgtg cgtcctcgtc ttcaccggtc 4380

gcgttcctga aacgcagatg tgcctcgcgc cgcactgctc cgaacaataa agattctaca 4440

atactagctt ttatggttat gaagaggaaa aattggcagt aacctggccc cacaaacctt 4500

caaatgaacg aatcaaatta acaaccatag gatgataatg cgattagttt tttagcctta 4560

tttctggggt aattaatcag cgaagcgatg atttttgatc tattaacaga tatataaatg 4620

caaaaactgc ataaccactt taactaatac tttcaacatt ttcggtttgt attacttctt 4680

attcaaatgt aataaaagta tcaacaaaaa attgttaata tacctctata ctttaacgtc 4740

aaggagaaaa aaccccggat tctagaacta gtggatcccc cgggctgcag gaattcgata 4800

tcaagcttat cgataccgtc gaggggcaga gccgatcctg tacactttac ttaaaaccat 4860

tatctgagtg ttaaatgtcc aatttactga ccgtacacca aaatttgcct gcattaccgg 4920

tcgatgcaac gagtgatgag gttcgcaaga acctgatgga catgttcagg gatcgccagg 4980

cgttttctga gcatacctgg aaaatgcttc tgtccgtttg ccggtcgtgg gcggcatggt 5040

gcaagttgaa taaccggaaa tggtttcccg cagaacctga agatgttcgc gattatcttc 5100

tatatcttca ggcgcgcggt ctggcagtaa aaactatcca gcaacatttg ggccagctaa 5160

acatgcttca tcgtcggtcc gggctgccac gaccaagtga cagcaatgct gtttcactgg 5220

ttatgcggcg gatccgaaaa gaaaacgttg atgccggtga acgtgcaaaa caggctctag 5280

cgttcgaacg cactgatttc gaccaggttc gttcactcat ggaaaatagc gatcgctgcc 5340

aggatatacg taatctggca tttctgggga ttgcttataa caccctgtta cgtatagccg 5400

aaattgccag gatcagggtt aaagatatct cacgtactga cggtgggaga atgttaatcc 5460

atattggcag aacgaaaacg ctggttagca ccgcaggtgt agagaaggca cttagcctgg 5520

gggtaactaa actggtcgag cgatggattt ccgtctctgg tgtagctgat gatccgaata 5580

actacctgtt ttgccgggtc agaaaaaatg gtgttgccgc gccatctgcc accagccagc 5640

tatcaactcg cgccctggaa gggatttttg aagcaactca tcgattgatt tacggcgcta 5700

aggatgactc tggtcagaga tacctggcct ggtctggaca cagtgcccgt gtcggagccg 5760

cgcgagatat ggcccgcgct ggagtttcaa taccggagat catgcaagct ggtggctgga 5820

ccaatgtaaa tattgtcatg aactatatcc gtaccctgga tagtgaaaca ggggcaatgg 5880

tgcgcctgct ggaagatggc gattagccat taacgcgtaa atgattgcta taattatttg 5940

atatttatgg tgacatatga gaaaggattt caacatcgac ggaaaatatg tagtgctgtc 6000

tgtaagcact aatattcagt cgccagccgt cattgtcact gtaaagctga gcgatagaat 6060

gcctgatatt gactcaatat ccgttgcgtt tcctgtcaaa agtatgcgta gtgctgaaca 6120

tttcgtgatg aatgccaccg aggaagaagc acggcgcggt tttgcaaagt gatgtctgag 6180

tttggcgaac tcttgggtaa ggttggaatt gtcgacctcg agtcatgtaa ttagttatgt 6240

cacgcttaca ttcacgccct ccccccacat ccgctctaac cgaaaaggaa ggagttagac 6300

aacctgaagt ctaggtccct atttattttt ttatagttat gttagtatta agaacgttat 6360

ttatatttca aatttttctt ttttttctgt acagacgcgt gtacgcatgt aacattatac 6420

tgaaaacctt gcttgagaag gttttgggac gctcgaaggc tttaatttgc ggccggtacc 6480

taggaccggt ttatcattat caatactgcc atttcaaaga atacgtaaat aattaatagt 6540

agtgattttc ctaactttat ttagtcaaaa aattagcctt ttaattctgc tgtaacccgt 6600

acatgcccaa aatagggggc gggttacaca gaatatataa catcgtaggt gtctgggtga 6660

acagtttatt cctggcatcc actaaatata atggagcccg ctttttaagc tggcatccag 6720

aaaaaaaaag aatcccagca ccaaaatatt gttttcttca ccaaccatca gttcataggt 6780

ccattctctt agcgcaacta cagagaacag gggcacaaac aggcaaaaaa cgggcacaac 6840

ctcaatggag tgatgcaacc tgcctggagt aaatgatgac acaaggcaat tgacccacgc 6900

atgtatctat ctcattttct tacaccttct attaccttct gctctctctg atttggaaaa 6960

agctgaaaaa aaaggttgaa accagttccc tgaaattatt cccctacttg actaataagt 7020

atataaagac ggtaggtatt gattgtaatt ctgtaaatct atttcttaaa cttcttaaat 7080

tctactttta tagttagtct tttttttagt tttaaaacac caagaactta gtttcgaata 7140

aacacacata aagaattcaa aatggtttca aaaggtgaag aagataatat ggctattatt 7200

aaagaattta tgagatttaa agttcatatg gaaggttcag ttaatggtca tgaatttgaa 7260

attgaaggtg aaggtgaagg tagaccatat gaaggtactc aaactgctaa attgaaagtt 7320

actaaaggtg gtccattacc atttgcttgg gatattttgt caccacaatt tatgtatggt 7380

tcaaaagctt atgttaaaca tccagctgat attccagatt atttaaaatt gtcatttcca 7440

gaaggtttta aatgggaaag agttatgaat tttgaagatg gtggtgttgt tactgttact 7500

caagattcat cattacaaga tggtgaattt atttataaag ttaaattgag aggtactaat 7560

tttccatcag atggtccagt tatgcaaaaa aaaactatgg gttgggaagc ttcatcagaa 7620

agaatgtatc cagaagatgg tgctttaaaa ggtgaaatta aacaaagatt gaaattaaaa 7680

gatggtggtc attatgatgc tgaagttaaa actacttata aagctaaaaa accagttcaa 7740

ttaccaggtg cttataatgt taatattaaa ttggatatta cttcacataa tgaagattat 7800

actattgttg aacaatatga aagagctgaa ggtagacatt caactggtgg tatggatgaa 7860

ttatataaat aatctagaca aatcgctctt aaatatatac ctaaagaaca ttaaagctat 7920

attataagca aagatacgta aattttgctt atattattat acacatatca tatttctata 7980

tttttaagat ttggttatat aatgtacgta atgcaaagga aataaatttt atacattatt 8040

gaacagcgtc caagtaacta cattatgtgc actaatagtt tagcgtcgtg aagactttat 8100

tgtgtcgcga aaagtaaaaa ttttaaaaat tagagcacct tgaacttgcg aaaaaggttc 8160

tcatcaactg tttaaaagat ctgagctcgc ggccgcgata tcgctagctc gagcccacac 8220

accatagctt caaaatgttt ctactccttt tttactcttc cagattttct cggactccgc 8280

gcatcgccgt accacttcaa aacacccaag cacagcatac taaattttcc ctctttcttc 8340

ctctagggtg tcgttaatta cccgtactaa aggtttggaa aagaaaaaag agaccgcctc 8400

gtttcttttt cttcgtcgaa aaaggcaata aaaattttta tcacgtttct ttttcttgaa 8460

attttttttt ttagtttttt tctctttcag tgacctccat tgatatttaa gttaataaac 8520

ggtcttcaat ttctcaagtt tcagtttcat ttttcttgtt ctattacaac tttttttact 8580

tcttgttcat tagaaagaaa gcatagcaat ctaatctaag gggcggtgtt gacaattaat 8640

catcggcata gtatatcggc atagtataat acgacaaggt gaggaactaa accatggcca 8700

agttgaccag tgccgttccg gtgctcaccg cgcgcgacgt cgccggagcg gtcgagttct 8760

ggaccgaccg gctcgggttc tcccgggact tcgtggagga cgacttcgcc ggtgtggtcc 8820

gggacgacgt gaccctgttc atcagcgcgg tccaggacca ggtggtgccg gacaacaccc 8880

tggcctgggt gtgggtgcgc ggcctggacg agctgtacgc cgagtggtcg gaggtcgtgt 8940

ccacgaactt ccgggacgcc tccgggccgg ccatgaccga gatcggcgag cagccgtggg 9000

ggcgggagtt cgccctgcgc gacccggccg gcaactgcgt gcacttcgtg gccgaggagc 9060

aggactgaca cgtccgacgg cggcccacgg gtcccaggcc tcggagatcc gtcccccttt 9120

tcctttgtcg atatcatgta attagttatg tcacgcttac attcacgccc tccccccaca 9180

tccgctctaa ccgaaaagga aggagttaga caacctgaag tctaggtccc tatttatttt 9240

tttatagtta tgttagtatt aagaacgtta tttatatttc aaatttttct tttttttctg 9300

tacagacgcg tgtacgcatg taacattata ctgaaaacct tgcttgagaa ggttttggga 9360

cgctcgaagg ctttaatttg caagctgaat tcccggggat 9400

<210> SEQ ID NO: 61

<211> LENGTH: 5763

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: pRN486 (TOPO-BLUNT-his3::loxP-natMX-loxP)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(5763)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“pRN486

(TOPO-BLUNT-his3::loxP-natMX-loxP)” /mol_type=“unassigned DNA”

<400> SEQENCE: 61

acttcgtata atgtatgcta tacgaagtta tacgtacgca gttgtcgaac ttggtttgca 60

aagggagaaa gtaggagatc tctcttgcga gatgatcccg cattttcttg aaagctttgc 120

agaggctagc agaattaccc tccacgttga ttgtctgcga ggcaagaatg atcatcaccg 180

tagtgagagt gcgttcaagg ctcttgcggt tgccataaga gaagccacct cgcccaatgg 240

taccaacgat gttccctcca ccaaaggtgt tcttatgtag tgacaccgat tatttaaagc 300

tgcagcatac gatatatata catgtgtata tatgtatacc tatgaatgtc agtaagtatg 360

tatacgaaca gtatgatact gaagatgaca aggtaatgca tcattctata cgtgtcattc 420

tgaacgaggc gcgctttcct tttttctttt tgctttttct ttttttttct cttgaactcg 480

acggatcata tgcggtgtga aatactcgag atcttgctga aaaactcgag ccatccggaa 540

gatctggctt aagggcgaat tctgagatat ccatcacact ggcggccgct cgagcatgca 600

tctagagggc ccaattcgcc ctatagtgag tcgtattaca attcactggc cgtcgtttta 660

caacgtcgtg actgggaaaa ccctggcgtt acccaactta atcgccttgc agcacatccc 720

cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg atcgcccttc ccaacagttg 780

cgcagcctat acgtacggca gtttaaggtt tacacctata aaagagagag ccgttatcgt 840

ctgtttgtgg atgtacagag tgatattatt gacacgccgg ggcgacggat ggtgatcccc 900

ctggccagtg cacgtctgct gtcagataaa gtctcccgtg aactttaccc ggtggtgcat 960

atcggggatg aaagctggcg catgatgacc accgatatgg ccagtgtgcc ggtctccgtt 1020

atcggggaag aagtggctga tctcagccac cgcgaaaatg acatcaaaaa cgccattaac 1080

ctgatgttct ggggaatata aatgtcaggc atgagattat caaaaaggat cttcacctag 1140

atccttttca cgtagaaagc cagtccgcag aaacggtgct gaccccggat gaatgtcagc 1200

tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt agcttgcagt 1260

gggcttacat ggcgatagct agactgggcg gttttatgga cagcaagcga accggaattg 1320

ccagctgggg cgccctctgg taaggttggg aagccctgca aagtaaactg gatggctttc 1380

tcgccgccaa ggatctgatg gcgcagggga tcaagctctg atcaagagac aggatgagga 1440

tcgtttcgca tgattgaaca agatggattg cacgcaggtt ctccggccgc ttgggtggag 1500

aggctattcg gctatgactg ggcacaacag acaatcggct gctctgatgc cgccgtgttc 1560

cggctgtcag cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc cggtgccctg 1620

aatgaactgc aagacgaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc 1680

gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt gggcgaagtg 1740

ccggggcagg atctcctgtc atctcacctt gctcctgccg agaaagtatc catcatggct 1800

gatgcaatgc ggcggctgca tacgcttgat ccggctacct gcccattcga ccaccaagcg 1860

aaacatcgca tcgagcgagc acgtactcgg atggaagccg gtcttgtcga tcaggatgat 1920

ctggacgaag agcatcaggg gctcgcgcca gccgaactgt tcgccaggct caaggcgagc 1980

atgcccgacg gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc gaatatcatg 2040

gtggaaaatg gccgcttttc tggattcatc gactgtggcc ggctgggtgt ggcggaccgc 2100

tatcaggaca tagcgttggc tacccgtgat attgctgaag agcttggcgg cgaatgggct 2160

gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat cgccttctat 2220

cgccttcttg acgagttctt ctgaattatt aacgcttaca atttcctgat gcggtatttt 2280

ctccttacgc atctgtgcgg tatttcacac cgcatacagg tggcactttt cggggaaatg 2340

tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat ccgctcatga 2400

gacaataacc ctgataaatg cttcaataat agcacgtgag gagggccacc atggccaagt 2460

tgaccagtgc cgttccggtg ctcaccgcgc gcgacgtcgc cggagcggtc gagttctgga 2520

ccgaccggct cgggttctcc cgggacttcg tggaggacga cttcgccggt gtggtccggg 2580

acgacgtgac cctgttcatc agcgcggtcc aggaccaggt ggtgccggac aacaccctgg 2640

cctgggtgtg ggtgcgcggc ctggacgagc tgtacgccga gtggtcggag gtcgtgtcca 2700

cgaacttccg ggacgcctcc gggccggcca tgaccgagat cggcgagcag ccgtgggggc 2760

gggagttcgc cctgcgcgac ccggccggca actgcgtgca cttcgtggcc gaggagcagg 2820

actgacacgt gctaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg 2880

ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg 2940

tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc 3000

aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc 3060

tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt 3120

agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc 3180

taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact 3240

caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac 3300

agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag 3360

aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg 3420

gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg 3480

tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga 3540

gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctgggcttt tgctggcctt 3600

ttgctcacat gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct 3660

ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcaagcgccc 3720

aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct ggcacgacag 3780

gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt agctcactca 3840

ttaggcaccc caggctttac actttatgct tccggctcgt atgttgtgtg gaattgtgag 3900

cggataacaa tttcacacag gaaacagcta tgaccatgat tacgccaagc tatttaggtg 3960

acactataga atactcaagc tatgcatcaa gcttggtacc gagctcggat ccactagtaa 4020

cggccgccag tgtgctggaa ttcgccccat ggcagctgag aatattgtag gagatcttct 4080

agaaagattg tacatccgga attctagatt ggtgagcgct aggagtcact gccaggtatc 4140

gtttgaacac ggcattagtc agggaagtca taacacagtc ctttcccgca attttctttt 4200

tctattactc ttggcctcct ctagtacact ctatattttt ttatgcctcg gtaatgattt 4260

tcattttttt ttttccacct agcggatgac tctttttttt tcttagcgat tggcattatc 4320

acataatgaa ttatacatta tataaagtaa tgtgatttct tcgaagaata tactaaaaaa 4380

tgagcaggca agataaacga aggcaaagat gacagagcag aaagccctag taaagcgtat 4440

tacaaatgaa accaagattc agattgcgat ctctttccta taacttcgta tagcatacat 4500

tatacgaagt tatgcgcgct ctagatatcg tcgacactgg atggcggcgt tagtatcgaa 4560

tcgacagcag tatagcgacc agcattcaca tacgattgac gcatgatatt actttctgcg 4620

cacttaactt cgcatctggg cagatgatgt cgaggcgaaa aaaaatataa atcacgctaa 4680

catttgatta aaatagaaca actacaatat aaaaaaacta tacaaatgac aagttcttga 4740

aaacaagaat ctttttattg tcagtactag gggcagggca tgctcatgta gagcgcctgc 4800

tcgccgtccg aggcggtgcc gtcgtacagg gcggtgtcca ggccgcagag ggtgaacccc 4860

atccgccggt acgcgtggat cgccggtgcg ttgacgttgg tgacctccag ccagaggtgc 4920

ccggcgcccc gctcgcgggc gaactccgtc gcgagcccca tcaacgcgcg cccgaccccg 4980

tgcccccggt gctccggggc gacctcgatg tcctcgacgg tcagccggcg gttccagccg 5040

gagtacgaga cgaccacgaa gcccgccagg tcgccgtcgt ccccgtacgc gacgaacgtc 5100

cgggagtccg ggtcgccgtc ctccccggcg tccgattcgt cgtccgattc gtcgtcgggg 5160

aacaccttgg tcaggggcgg gtccaccggc acctcccgca gggtgaagcc gtccccggtg 5220

gcggtgacgc ggaagacggt gtcggtggtg aaggacccat ccagtgcctc gatggcctcg 5280

gcgtcccccg ggacactggt gcggtaccgg taagccgtgt cgtcaagagt ggtcatttta 5340

catggttgtt tatgttcgga tgtgatgtga gaactgtatc ctagcaagat tttaaaagga 5400

agtatatgaa agaagaacct cagtggcaaa tcctaacctt ttatatttct ctacaggggc 5460

gcggcgtggg gacaattcaa cgcgtctgtg aggggagcgt ttccctgctc gcaggtctgc 5520

agcgaggagc cgtaattttt gcttcgcgcc gtgcggccat caaaatgtat ggatgcaaat 5580

gattatacat ggggatgtat gggctaaatg tacgggcgac agtcacatca tgcccctgag 5640

ctgcgcacgt caagactgtc aaggagggta ttctgggcct ccatgtcgct ggccgggtga 5700

cccggcgggg acgaggcaag cttaagggcg aattccagca cactggcggc cgttactaga 5760

ata 5763

<210> SEQ ID NO: 62

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer ActinF (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

ActinF (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 62

ggattctgag gttgctgctt tgg 23

<210> SEQ ID NO: 63

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer ActinR (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

ActinR (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 63

gagcttcatc accaacgtag gag 23

<210> SEQ ID NO: 64

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT1F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT1F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 64

tgttctctgt acaccgttga ccg 23

<210> SEQ ID NO: 65

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT1R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT1R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 65

agatcataca gttaccagca ccc 23

<210> SEQ ID NO: 66

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT2F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(19)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“ Primer

HXT2F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 66

cttcgcatcc actttcgtg 19

<210> SEQ ID NO: 67

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT2R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(22)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT2R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 67

aatcatgacg ttaccggcag cc 22

<210> SEQ ID NO: 68

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT3F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT3F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 68

gaagctagag ctgctggttc agc 23

<210> SEQ ID NO: 69

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT3R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(24)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT3R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 69

acaacgacat aaggaattgg agcc 24

<210> SEQ ID NO: 70

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT4F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(24)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT4F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 70

atggagagtt ccattaggtc tagg 24

<210> SEQ ID NO: 71

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT4R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(24)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT4R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 71

atggagagtt ccattaggtc tagg 24

<210> SEQ ID NO: 72

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT5F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT5F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 72

ttgctatgtc gtctatgcct ctg 23

<210> SEQ ID NO: 73

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT5R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(22)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT5R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 73

agataaggac ataggcaacg gg 22

<210> SEQ ID NO: 74

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT7F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(21)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT7F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 74

gggtgctgca tccatgactg c 21

<210> SEQ ID NO: 75

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT7R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(24)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT7R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 75

acaacgacat aaggaattgg agcc 24

<210> SEQ ID NO: 76

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT8F ( (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(25)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“Primer HXT8F ( (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 76

gtactactat cttcaaatct gtcgg 25

<210> SEQ ID NO: 77

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT8R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(21)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT8R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 77

cttgtgacgc caacggaggc g 21

<210> SEQ ID NO: 78

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT9F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(22)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT9F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 78

ccattgagag gtttggacgc cg 22

<210> SEQ ID NO: 79

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT9R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT9R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 79

acacaatcat acagttaccg gcg 23

<210> SEQ ID NO: 80

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT10F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT10F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 80

ggaatgcaag actctttcga gac 23

<210> SEQ ID NO: 81

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT10R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(21)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT10R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 81

ctagtgacgc caacggtggc g 21

<210> SEQ ID NO: 82

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT11F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(21)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT11F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 82

gccactcaat ggagagtcgg c 21

<210> SEQ ID NO: 83

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT11R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(22)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT11R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 83

caactagcaa ggctggatcg tc 22

<210> SEQ ID NO: 84

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT12F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT12F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 84

caccatcttc aaatctgtcg gtc 23

<210> SEQ ID NO: 85

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT12R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT12R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 85

caatcataca gttaccggca ccc 23

<210> SEQ ID NO: 86

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT13F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(20)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT13F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 86

ccctcatggc caggacggtc 20

<210> SEQ ID NO: 87

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT13R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT13R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 87

ttgccataac cagttgcatg cag 23

<210> SEQ ID NO: 88

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT14F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(24)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT14F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 88

gccttagtag tgtactgcat cggt 24

<210> SEQ ID NO: 89

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT14R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT14R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 89

tgatacgtag ataccatgga gcc 23

<210> SEQ ID NO: 90

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT15F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(21)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT15F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 90

gaggcctgtg tctccatcgc c 21

<210> SEQ ID NO: 91

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT15R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(24)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT15R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 91

cacaagaata cctgtgatca aacg 24

<210> SEQ ID NO: 92

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT16F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(24)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT16F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 92

caaggaagta tagtaatact gcgc 24

<210> SEQ ID NO: 93

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT16R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(21)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT16R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 93

ttggcgatgg agacacaggc c 21

<210> SEQ ID NO: 94

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT17F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT17F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 94

taacactgca caatggagag tcc 23

<210> SEQ ID NO: 95

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT17R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(22)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT17R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 95

tgagtaccca tggatcctct gg 22

<210> SEQ ID NO: 96

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer GAL2F (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(23)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

GAL2F (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 96

tcaatggaga gttccattag ggc 23

<210> SEQ ID NO: 97

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer GAL2R (Real time PCR)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(21)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

GAL2R (Real time PCR)” /mol_type=“unassigned DNA”

<400> SEQENCE: 97

ctggacggca ggatcctctg g 21

<210> SEQ ID NO: 98

<211> LENGTH: 82

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer KOP11* for KO HXT11

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(82)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

KOP11* for KO HXT11” /mol_type=“unassigned DNA”

<400> SEQENCE: 98

aataatcatt gcacaattta gttctaaacg cttttgttat tactcaatat ccgttttaag 60

agcttggtga gcgctaggag tc 82

<210> SEQ ID NO: 99

<211> LENGTH: 101

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer KOT11* for KO HXT11

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(101)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

KOT11* for KO HXT11” /mol_type=“unassigned DNA”

<400> SEQENCE: 99

tcgtcaattt ttttttttgc ttttttacca atttaccgaa aactagaaga gagttcaaga 60

gaaaaaaaaa gaaaaagcaa aaagaaaaaa ggaaagcgcg c 101

<210> SEQ ID NO: 100

<211> LENGTH: 39

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer iHXT11F (Inverse HXT11)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(39)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“Primer iHXT11F (Inverse HXT11)” /mol_type=“unassigned DNA”

<400> SEQENCE: 100

ggcctctaga tcagctggaa aagaacctct tgtaaattg 39

<210> SEQ ID NO: 101

<211> LENGTH: 41

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer iHXT11R (Inverse HXT11)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(41)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“Primer iHXT11R (Inverse HXT11)” /mol_type=“unassigned DNA”

<400> SEQENCE: 101

gctaggatcc atgtcaggtg ttaataatac atccgcaaat g 41

<210> SEQ ID NO: 102

<211> LENGTH: 36

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT11F (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(36)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“Primer HXT11F (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 102

ggcctctaga atgtcaggtg ttaataatac atccgc 36

<210> SEQ ID NO: 103

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT12F (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(37)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“Primer HXT12F (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 103

ggcctctaga atgggtttga ttgtctcaat attcaac 37

<210> SEQ ID NO: 104

<211> LENGTH: 39

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT11/12R (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(39)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

HXT11/12R (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 104

cgatggatcc tcagctggaa aagaacctct tgtaaattg 39

<210> SEQ ID NO: 105

<211> LENGTH: 36

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer HXT1 Xbal (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(36)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“Primer HXT1 Xbal (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 105

gcattctaga atgaattcaa ctcccgatct aatatc 36

<210> SEQ ID NO: 106

<211> LENGTH: 38

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer R HXT1 Cfr9i (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(38)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

R HXT1 Cfr9i (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 106

tgcatcccgg gttatttcct gctaaacaaa ctcttgta 38

<210> SEQ ID NO: 107

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer F HXT2 Xbai (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(33)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

F HXT2 Xbai (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 107

gtcctctaga atgtctgaat tcgctactag ccg 33

<210> SEQ ID NO: 108

<211> LENGTH: 40

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer R HXT2 Cfr9i (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(40)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

R HXT2 Cfr9i (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 108

catcgcccgg gttattcctc ggaaactctt ttttcttttg 40

<210> SEQ ID NO: 109

<211> LENGTH: 38

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer F HXT3 Xbal (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(38)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

F HXT3 Xbal (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 109

gcattctaga atgaattcaa ctccagattt aatatctc 38

<210> SEQ ID NO: 110

<211> LENGTH: 36

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer R HXT6 Cfr9i (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(36)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

R HXT6 Cfr9i (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 110

catcgcccgg gttatttggt gctgaacatt ctcttg 36

<210> SEQ ID NO: 111

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer F HXT4 Xbal (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(35)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

F HXT4 Xbal (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 111

gtcctctaga atgtctgaag aagctgccta tcaag 35

<210> SEQ ID NO: 112

<211> LENGTH: 38

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer R HXT4RN Cfr9l (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(38)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

R HXT4RN Cfr9l (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 112

tatcgcccgg gttaattaac tgacctactt ttttccga 38

<210> SEQ ID NO: 113

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer F HXT5 Xbal (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(35)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

F HXT5 Xbal (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 113

gtcctctaga atgtcggaac ttgaaaacgc tcatc 35

<210> SEQ ID NO: 114

<211> LENGTH: 40

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer R HXT5 Cfr9i (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(40)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

R HXT5 Cfr9i (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 114

gcatcccggg ttatttttct ttagtgaaca tccttttata 40

<210> SEQ ID NO: 115

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer F HXT7 Xbal (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(34)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

F HXT7 Xbal (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 115

gtcctctaga atgtcacaag acgctgctat tgca 34

<210> SEQ ID NO: 116

<211> LENGTH: 36

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer R HXT7 Cfr9l (Cloning)

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(36)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Primer

R HXT7 Cfr9l (Cloning)” /mol_type=“unassigned DNA”

<400> SEQENCE: 116

catcgcccgg gttatttggt gctgaacatt ctcttg 36

<210> SEQ ID NO: 117

<211> LENGTH: 6338

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Plasmid pRS313-P7T7

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(6338)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Plasmid

pRS313-P7T7” /mol_type=“unassigned DNA”

<400> SEQENCE: 117

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accataattc cgttttaaga gcttggtgag cgctaggagt cactgccagg tatcgtttga 240

acacggcatt agtcagggaa gtcataacac agtcctttcc cgcaattttc tttttctatt 300

actcttggcc tcctctagta cactctatat ttttttatgc ctcggtaatg attttcattt 360

ttttttttcc acctagcgga tgactctttt tttttcttag cgattggcat tatcacataa 420

tgaattatac attatataaa gtaatgtgat ttcttcgaag aatatactaa aaaatgagca 480

ggcaagataa acgaaggcaa agatgacaga gcagaaagcc ctagtaaagc gtattacaaa 540

tgaaaccaag attcagattg cgatctcttt aaagggtggt cccctagcga tagagcactc 600

gatcttccca gaaaaagagg cagaagcagt agcagaacag gccacacaat cgcaagtgat 660

taacgtccac acaggtatag ggtttctgga ccatatgata catgctctgg ccaagcattc 720

cggctggtcg ctaatcgttg agtgcattgg tgacttacac atagacgacc atcacaccac 780

tgaagactgc gggattgctc tcggtcaagc ttttaaagag gccctactgg cgcgtggagt 840

aaaaaggttt ggatcaggat ttgcgccttt ggatgaggca ctttccagag cggtggtaga 900

tctttcgaac aggccgtacg cagttgtcga acttggtttg caaagggaga aagtaggaga 960

tctctcttgc gagatgatcc cgcattttct tgaaagcttt gcagaggcta gcagaattac 1020

cctccacgtt gattgtctgc gaggcaagaa tgatcatcac cgtagtgaga gtgcgttcaa 1080

ggctcttgcg gttgccataa gagaagccac ctcgcccaat ggtaccaacg atgttccctc 1140

caccaaaggt gttcttatgt agtgacaccg attatttaaa gctgcagcat acgatatata 1200

tacatgtgta tatatgtata cctatgaatg tcagtaagta tgtatacgaa cagtatgata 1260

ctgaagatga caaggtaatg catcattcta tacgtgtcat tctgaacgag gcgcgctttc 1320

cttttttctt tttgcttttt cttttttttt ctcttgaact cgacggatca tatgcggtgt 1380

gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggaaattgta aacgttaata 1440

ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg 1500

aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc 1560

cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa 1620

ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt 1680

cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac 1740

ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta 1800

gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg 1860

cgccgctaca gggcgcgtcg cgccattcgc cattcaggct gcgcaactgt tgggaagggc 1920

gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa ggggggatgt gctgcaaggc 1980

gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg 2040

aattgtaata cgactcacta tagggcgaat tggagctctc tcgtaggaac aatttcgggc 2100

ccctgcgtgt tcttctgagg ttcatctttt acatttgctt ctgctggata attttcagag 2160

gcaacaagga aaaattagat ggcaaaaagt cgtctttcaa ggaaaaatcc ccaccatctt 2220

tcgagatccc ctgtaactta ttggcaactg aaagaatgaa aaggaggaaa atacaaaata 2280

tactagaact gaaaaaaaaa aagtataaat agagacgata tatgccaata cttcacaatg 2340

ttcgaatcta ttcttcattt gcagctattg taaaataata aaacatcaag aacaaacaag 2400

ctcaacttgt cttttctaag aacaaagaat aaacacaaaa acaaaaagtt tttttaattt 2460

taatcaaaaa tctagaacta gtggatcccc cgggctgcag gaattcgata tcaagcttat 2520

cgattttgcg aacactttta ttaattcatg atcacgctct aatttgtgca tttgaaatgt 2580

actctaattc taattttata tttttaatga tatcttgaaa agtaaatacg tttttaatat 2640

atacaaaata atacagttta attttcaagt ttttgatcat ttgttctcag aaagttgagt 2700

gggacggaga caaagaaact ttaaagagaa atgcaaagtg ggaagaagtc agttgtttac 2760

cgaccgcact gttattcaca aatattccaa ttttgcctgc agacccacgt ctacaaattt 2820

tggttagttt ggtaaatggt aaggatatag tagagccttt ttgaaatggg aaatatcttc 2880

tttttctgta tcccgcttca aaaagtgtct aatgagtcag ttatttcttt cttactcatc 2940

gcccgtcact taaaagaaga aaaattactt tcatgatgcg aagcgaaaaa aatttttagc 3000

ttcaattttc acaatgcatc tatggagagg atattataag gttacgaaat aaattcttga 3060

gtgttgtaaa ttctgttaat caaagaaaaa gcaatagctc gtttttctac agaatggcta 3120

gcacagcaaa tatgatttct caactaaaga aactatctat cgcggaacct gcggttgcca 3180

aggattctca tcctgatgta aatatcgtgg atttgatgag aaattacatt tcacaagaat 3240

taagcaagat ttccggcgta gactcgtctc ttatttttcc agcattagaa tggacaaata 3300

ctatggagag aggcgatttg ttgattccta tcccaagatt gagaatcaaa ggtgccaatc 3360

caaaggattt ggcagtccaa tgggctgaaa aatttccatg tggagatttc ttggagaaag 3420

ttgaagcgaa tggcccgttc atccagtttt tcttcaaccc tcaattttta gcaaaacttg 3480

tcatcccaga tatcttaacc agaaaggagg attatggttc ttgcgtcgac ctcgaggggg 3540

ggcccggtac ccagcttttg ttccctttag tgagggttaa ttccgagctt ggcgtaatca 3600

tggtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatagga 3660

gccggaagca taaagtgtaa agcctggggt gcctaatgag tgaggtaact cacattaatt 3720

gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga 3780

atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc 3840

actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 3900

gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 3960

cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctcggc 4020

ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 4080

ctataaagat accaggcgtt cccccctgga agctccctcg tgcgctctcc tgttccgacc 4140

ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa 4200

tgctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 4260

cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 4320

aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 4380

gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 4440

agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 4500

ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 4560

cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 4620

tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 4680

aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata 4740

tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg 4800

atctgtctat ttcgttcatc catagttgcc tgactgcccg tcgtgtagat aactacgata 4860

cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg 4920

gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct 4980

gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt 5040

tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc 5100

tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 5160

tcccccatgt tgtgaaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 5220

aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 5280

atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 5340

tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca 5400

catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca 5460

aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 5520

tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 5580

gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 5640

tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 5700

tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgggtcc 5760

ttttcatcac gtgctataaa aataattata atttaaattt tttaatataa atatataaat 5820

taaaaataga aagtaaaaaa agaaattaaa gaaaaaatag tttttgtttt ccgaagatgt 5880

aaaagactct agggggatcg ccaacaaata ctacctttta tcttgctctt cctgctctca 5940

ggtattaatg ccgaattgtt tcatcttgtc tgtgtagaag accacacacg aaaatcctgt 6000

gattttacat tttacttatc gttaatcgaa tgtatatcta tttaatctgc ttttcttgtc 6060

taataaatat atatgtaaag tacgcttttt gttgaaattt tttaaacctt tgtttatttt 6120

tttttcttca ttccgtaact cttctacctt ctttatttac tttctaaaat ccaaatacaa 6180

aacataaaaa taaataaaca cagagtaaat tcccaaatta ttccatcatt aaaagatacg 6240

aggcgcgtgt aagttacagg caagcgatcc gtcctaagaa accattatta tcatgacatt 6300

aacctataaa aataggcgta tcacgaggcc ctttcgtc 6338

<210> SEQ ID NO: 118

<211> LENGTH: 8726

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Plasmid pRS313-P7t7-HXT11+GFP

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(8726)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“Plasmid

pRS313-P7t7-HXT11+GFP” /mol_type=“unassigned DNA”

<400> SEQENCE: 118

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accataattc cgttttaaga gcttggtgag cgctaggagt cactgccagg tatcgtttga 240

acacggcatt agtcagggaa gtcataacac agtcctttcc cgcaattttc tttttctatt 300

actcttggcc tcctctagta cactctatat ttttttatgc ctcggtaatg attttcattt 360

ttttttttcc acctagcgga tgactctttt tttttcttag cgattggcat tatcacataa 420

tgaattatac attatataaa gtaatgtgat ttcttcgaag aatatactaa aaaatgagca 480

ggcaagataa acgaaggcaa agatgacaga gcagaaagcc ctagtaaagc gtattacaaa 540

tgaaaccaag attcagattg cgatctcttt aaagggtggt cccctagcga tagagcactc 600

gatcttccca gaaaaagagg cagaagcagt agcagaacag gccacacaat cgcaagtgat 660

taacgtccac acaggtatag ggtttctgga ccatatgata catgctctgg ccaagcattc 720

cggctggtcg ctaatcgttg agtgcattgg tgacttacac atagacgacc atcacaccac 780

tgaagactgc gggattgctc tcggtcaagc ttttaaagag gccctactgg cgcgtggagt 840

aaaaaggttt ggatcaggat ttgcgccttt ggatgaggca ctttccagag cggtggtaga 900

tctttcgaac aggccgtacg cagttgtcga acttggtttg caaagggaga aagtaggaga 960

tctctcttgc gagatgatcc cgcattttct tgaaagcttt gcagaggcta gcagaattac 1020

cctccacgtt gattgtctgc gaggcaagaa tgatcatcac cgtagtgaga gtgcgttcaa 1080

ggctcttgcg gttgccataa gagaagccac ctcgcccaat ggtaccaacg atgttccctc 1140

caccaaaggt gttcttatgt agtgacaccg attatttaaa gctgcagcat acgatatata 1200

tacatgtgta tatatgtata cctatgaatg tcagtaagta tgtatacgaa cagtatgata 1260

ctgaagatga caaggtaatg catcattcta tacgtgtcat tctgaacgag gcgcgctttc 1320

cttttttctt tttgcttttt cttttttttt ctcttgaact cgacggatca tatgcggtgt 1380

gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggaaattgta aacgttaata 1440

ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg 1500

aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc 1560

cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa 1620

ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt 1680

cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac 1740

ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta 1800

gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg 1860

cgccgctaca gggcgcgtcg cgccattcgc cattcaggct gcgcaactgt tgggaagggc 1920

gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa ggggggatgt gctgcaaggc 1980

gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg 2040

aattgtaata cgactcacta tagggcgaat tggagctctc tcgtaggaac aatttcgggc 2100

ccctgcgtgt tcttctgagg ttcatctttt acatttgctt ctgctggata attttcagag 2160

gcaacaagga aaaattagat ggcaaaaagt cgtctttcaa ggaaaaatcc ccaccatctt 2220

tcgagatccc ctgtaactta ttggcaactg aaagaatgaa aaggaggaaa atacaaaata 2280

tactagaact gaaaaaaaaa aagtataaat agagacgata tatgccaata cttcacaatg 2340

ttcgaatcta ttcttcattt gcagctattg taaaataata aaacatcaag aacaaacaag 2400

ctcaacttgt cttttctaag aacaaagaat aaacacaaaa acaaaaagtt tttttaattt 2460

taatcaaaaa tctagaatgt caggtgttaa taatacatcc gcaaatgagt tatctactac 2520

catgtctaac tctaactcag cagtaggcgc tccctctgtt aagactgaac acggtgactc 2580

taaaaattcc cttaacctag atgccaatga gccacctatt gacttacctc aaaaacccct 2640

ctctgcgtat accaccgtcg caatcctgtg tttgatgatt gcatttggcg gcttcatctt 2700

tggttgggat accggtacca tttctggttt tgttaacctt tctgatttca tcagaaggtt 2760

cggtcaaaaa aatgacaagg gaacctacta cttatcgaaa gtaagaatgg gtttgatcgt 2820

ctcaatattc aacattggct gcgccatagg cggaattgtc ttgtcaaaag tcggtgatat 2880

atatggtcgt cgtattggat tgattacagt tactgccatt tacgttgtag gcatcctaat 2940

ccaaataact tccataaaca agtggtacca atacttcatt ggaagaatta tttctggcct 3000

aggagtggga ggcattgctg tcctttcccc aatgttgata tctgaagttg ctcccaaaca 3060

tatcagagga actctggtcc aattgtacca gctgatgggt acgatgggta tttttctagg 3120

atactgtacc aattacggta ccaagaacta tcacaacgcc actcaatgga gagtcggcct 3180

tggtctttgc tttgcctggg ctacattcat ggttagtgga atgatgtttg taccagaatc 3240

accacgttac ctgattgagg ttggtaaaga tgaggaagcg aaacgttcac tatcgaaatc 3300

caacaaagtc tcagttgacg atccagcctt gctagttgaa tatgacacta taaaggcagg 3360

aattgaactt gaaaagctgg caggtaacgc atcatggtct gaactactct ccactaaaac 3420

aaaggtcttt cagcgtgttc tcatgggagt gatgatccaa tcgctgcagc aattaaccgg 3480

tgacaactac ttcttttact acggtaccac catcttcaaa tctgtcggtc taaaggactc 3540

ctttcagact tcgatcatta tcggtgtggt taattttttc tcttcattca tagcggtata 3600

caccattgag aggtttggac gccgtacgtg tctattgtgg ggtgctgctt ctatgctatg 3660

ctgctttgct gtgtttgcct ccgtcggtgt gacaaagttg tggcctcaag gaagcagtca 3720

ccaagacatt acttctcagg gcgccggtaa ctgtatgatt gtgtttacta tgttcttcat 3780

tttttcgttc gccaccactt gggcaggcgg ctgttacgtt attgtctcag agacgtttcc 3840

tcttagggtc aaatcaagag gaatggcaat cgcaacagct gcaaactgga tgtggggttt 3900

cctgattagt ttctttaccc cattcattac cggggcaatc aacttttact acggttacgt 3960

attcttaggc tgtctggttt ttgcatactt ttatgtcttt ttctttgtcc cagaaacaaa 4020

aggcctgaca ctggaggagg tgaatactat gtggctggaa ggtgtgccag catggaaatc 4080

ggcctcatgg gtgccaccgg agagaagaac cgcagattac gatgctgatg caatagatca 4140

tgacaataga ccaatttaca agaggttctt ttccagctga cccgggatgg tgagcaaggg 4200

cgaggagctg ttcaccgggg tggtgcccat cctggtcgag ctggacggcg acgtaaacgg 4260

ccacaagttc agcgtgtccg gcgagggcga gggcgatgcc acctacggca agctgaccct 4320

gaagttcatc tgcaccaccg gcaagctgcc cgtgccctgg cccaccctcg tgaccaccct 4380

gacctacggc gtgcagtgct tcagccgcta ccccgaccac atgaagcagc acgacttctt 4440

caagtccgcc atgcccgaag gctacgtcca ggagcgcacc atcttcttca aggacgacgg 4500

caactacaag acccgcgccg aggtgaagtt cgagggcgac accctggtga accgcatcga 4560

gctgaagggc atcgacttca aggaggacgg caacatcctg gggcacaagc tggagtacaa 4620

ctacaacagc cacaacgtct atatcatggc cgacaagcag aagaacggca tcaaggtgaa 4680

cttcaagatc cgccacaaca tcgaggacgg cagcgtgcag ctcgccgacc actaccagca 4740

gaacaccccc atcggcgacg gccccgtgct gctgcccgac aaccactacc tgagcaccca 4800

gtccgccctg agcaaagatc ccaacgagaa gcgcgatcac atggtcctgc tggagttcgt 4860

gaccgccgcc gggatcactc tcggcatgga cgagctgtac aagtaaatcg attttgcgaa 4920

cacttttatt aattcatgat cacgctctaa tttgtgcatt tgaaatgtac tctaattcta 4980

attttatatt tttaatgata tcttgaaaag taaatacgtt tttaatatat acaaaataat 5040

acagtttaat tttcaagttt ttgatcattt gttctcagaa agttgagtgg gacggagaca 5100

aagaaacttt aaagagaaat gcaaagtggg aagaagtcag ttgtttaccg accgcactgt 5160

tattcacaaa tattccaatt ttgcctgcag acccacgtct acaaattttg gttagtttgg 5220

taaatggtaa ggatatagta gagccttttt gaaatgggaa atatcttctt tttctgtatc 5280

ccgcttcaaa aagtgtctaa tgagtcagtt atttctttct tactcatcgc ccgtcactta 5340

aaagaagaaa aattactttc atgatgcgaa gcgaaaaaaa tttttagctt caattttcac 5400

aatgcatcta tggagaggat attataaggt tacgaaataa attcttgagt gttgtaaatt 5460

ctgttaatca aagaaaaagc aatagctcgt ttttctacag aatggctagc acagcaaata 5520

tgatttctca actaaagaaa ctatctatcg cggaacctgc ggttgccaag gattctcatc 5580

ctgatgtaaa tatcgtggat ttgatgagaa attacatttc acaagaatta agcaagattt 5640

ccggcgtaga ctcgtctctt atttttccag cattagaatg gacaaatact atggagagag 5700

gcgatttgtt gattcctatc ccaagattga gaatcaaagg tgccaatcca aaggatttgg 5760

cagtccaatg ggctgaaaaa tttccatgtg gagatttctt ggagaaagtt gaagcgaatg 5820

gcccgttcat ccagtttttc ttcaaccctc aatttttagc aaaacttgtc atcccagata 5880

tcttaaccag aaaggaggat tatggttctt gcgtcgacct cgaggggggg cccggtaccc 5940

agcttttgtt ccctttagtg agggttaatt ccgagcttgg cgtaatcatg gtcatagctg 6000

tttcctgtgt gaaattgtta tccgctcaca attccacaca acataggagc cggaagcata 6060

aagtgtaaag cctggggtgc ctaatgagtg aggtaactca cattaattgc gttgcgctca 6120

ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc 6180

gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg 6240

cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta 6300

tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc 6360

aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctcggccc ccctgacgag 6420

catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac 6480

caggcgttcc cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc 6540

ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcaatg ctcacgctgt 6600

aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc 6660

gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga 6720

cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta 6780

ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta 6840

tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga 6900

tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg 6960

cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag 7020

tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc 7080

tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact 7140

tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt 7200

cgttcatcca tagttgcctg actgcccgtc gtgtagataa ctacgatacg ggagggctta 7260

ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta 7320

tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc 7380

gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat 7440

agtttgcgca acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt 7500

atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg 7560

tgaaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca 7620

gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta 7680

agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg 7740

cgaccgagtt gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact 7800

ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg 7860

ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt 7920

actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga 7980

ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc 8040

atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa 8100

caaatagggg ttccgcgcac atttccccga aaagtgccac ctgggtcctt ttcatcacgt 8160

gctataaaaa taattataat ttaaattttt taatataaat atataaatta aaaatagaaa 8220

gtaaaaaaag aaattaaaga aaaaatagtt tttgttttcc gaagatgtaa aagactctag 8280

ggggatcgcc aacaaatact accttttatc ttgctcttcc tgctctcagg tattaatgcc 8340

gaattgtttc atcttgtctg tgtagaagac cacacacgaa aatcctgtga ttttacattt 8400

tacttatcgt taatcgaatg tatatctatt taatctgctt ttcttgtcta ataaatatat 8460

atgtaaagta cgctttttgt tgaaattttt taaacctttg tttatttttt tttcttcatt 8520

ccgtaactct tctaccttct ttatttactt tctaaaatcc aaatacaaaa cataaaaata 8580

aataaacaca gagtaaattc ccaaattatt ccatcattaa aagatacgag gcgcgtgtaa 8640

gttacaggca agcgatccgt cctaagaaac cattattatc atgacattaa cctataaaaa 8700

taggcgtatc acgaggccct ttcgtc 8726

<210> SEQ ID NO: 119

<211> LENGTH: 1704

<212> TYPE: DNA

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(1704)

<223> OTHER INFORMATION: /organism=“Saccharomyces cerevisiae”

/note=“HXT11 ORF RN1053” /mol_type=“unassigned DNA”

<400> SEQENCE: 119

atgtcaggtg ttaataatac atccgcaaat gagttatcta ctaccatgtc taactctaac 60

tcagcagtag gcgctccctc tgttaagact gaacacggtg actctaaaaa ttcccttaac 120

ctagatgcca atgagccacc tattgactta cctcaaaaac ccctctctgc gtataccacc 180

gtcgcaatcc tgtgtttgat gattgcattt ggcggcttca tctttggttg ggataccggt 240

accatttctg gttttgttaa cctttctgat ttcatcagaa ggttcggtca aaaaaatgac 300

aagggaacct actacttatc gaaagtaaga atgggtttga tcgtctcaat attcaacatt 360

ggctgcgcca taggcggaat tgtcttgtca aaagtcggtg atatatatgg tcgtcgtatt 420

ggattgatta cagttactgc catttacgtt gtaggcatcc taatccaaat aacttccata 480

aacaagtggt accaatactt cattggaaga attatttctg gcctaggagt gggaggcatt 540

gctgtccttt ccccaatgtt gatatctgaa gttgctccca aacatatcag aggaactctg 600

gtccaattgt accagctgat gggtacgatg ggtatttttc taggatactg taccaattac 660

ggtaccaaga actatcacaa cgccactcaa tggagagtcg gccttggtct ttgctttgcc 720

tgggctacat tcatggttag tggaatgatg tttgtaccag aatcaccacg ttacctgatt 780

gaggttggta aagatgagga agcgaaacgt tcactatcga aatccaacaa agtctcagtt 840

gacgatccag ccttgctagt tgaatatgac actataaagg caggaattga acttgaaaag 900

ctggcaggta acgcatcatg gtctgaacta ctctccacta aaacaaaggt ctttcagcgt 960

gttctcatgg gagtgatgat ccaatcgctg cagcaattaa ccggtgacaa ctacttcttt 1020

tactacggta ccaccatctt caaatctgtc ggtctaaagg actcctttca gacttcgatc 1080

attatcggtg tggttaattt tttctcttca ttcatagcgg tatacaccat tgagaggttt 1140

ggacgccgta cgtgtctatt gtggggtgct gcttctatgc tatgctgctt tgctgtgttt 1200

gcctccgtcg gtgtgacaaa gttgtggcct caaggaagca gtcaccaaga cattacttct 1260

cagggcgccg gtaactgtat gattgtgttt actatgttct tcattttttc gttcgccacc 1320

acttgggcag gcggctgtta cgttattgtc tcagagacgt ttcctcttag ggtcaaatca 1380

agaggaatgg caatcgcaac agctgcaaac tggatgtggg gtttcctgat tagtttcttt 1440

accccattca ttaccggggc aatcaacttt tactacggtt acgtattctt aggctgtctg 1500

gtttttgcat acttttatgt ctttttcttt gtcccagaaa caaaaggcct gacactggag 1560

gaggtgaata ctatgtggct ggaaggtgtg ccagcatgga aatcggcctc atgggtgcca 1620

ccggagagaa gaaccgcaga ttacgatgct gatgcaatag atcatgacaa tagaccaatt 1680

tacaagaggt tcttttccag ctga 1704

<210> SEQ ID NO: 120

<211> LENGTH: 1626

<212> TYPE: DNA

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(1626)

<223> OTHER INFORMATION: /organism=“Saccharomyces

cerevisiae” /note=“HXT2 ORF” /mol_type=“unassigned DNA”

<400> SEQENCE: 120

atgtctgaat tcgctactag ccgcgttgaa agtggctctc aacaaacttc tatccactct 60

actccgatag tgcagaaatt agagacggat gaatctccta ttcaaaccaa atctgaatac 120

actaacgctg aactcccagc aaagccaatc gccgcatatt ggactgttat ctgtttatgt 180

ctaatgattg catttggtgg gtttgtcttt ggttgggata ctggtaccat ctctggtttt 240

gttaatcaaa ccgatttcaa aagaagattt ggtcaaatga aatctgatgg tacctattat 300

ctttcggacg tccggactgg tttgatcgtt ggtatcttca atattggttg tgcctttggt 360

gggttaacct taggacgtct gggtgatatg tatggacgta gaattggttt gatgtgcgtc 420

gttctggtat acatcgttgg tattgtgatt caaattgctt ctagtgacaa atggtaccaa 480

tatttcattg gtagaattat ctctggtatg ggtgtcggtg gtattgctgt cctatctcca 540

actttgattt ccgaaacagc accaaaacac attagaggta cctgtgtttc tttctatcag 600

ttaatgatca ctctaggtat tttcttaggt tactgtacca actatggtac taaagactac 660

tccaattcag ttcaatggag agtgcctttg ggtttgaact ttgccttcgc tattttcatg 720

atcgctggta tgctaatggt tccagaatct ccaagattct tagtcgaaaa aggcagatac 780

gaagacgcta aacgttcttt ggcaaaatct aacaaagtca ccattgaaga tccaagtatt 840

gttgctgaaa tggatacaat tatggccaac gttgaaactg aaagattagc cggtaacgct 900

tcttggggtg agttattctc caacaaaggt gctattttac ctcgtgtgat tatgggtatt 960

atgattcaat ccttacaaca attaactggt aacaattact tcttctatta tggtactact 1020

attttcaacg ccgtcggtat gaaagattct ttccaaactt ccatcgtttt aggtatagtc 1080

aacttcgcat ccactttcgt ggccttatac actgttgata aatttggtcg tcgtaagtgt 1140

ctattgggtg gttctgcttc catggccatt tgttttgtta tcttctctac tgtcggtgtc 1200

acaagcttat atccaaatgg taaagatcaa ccatcttcca aggctgccgg taacgtcatg 1260

attgtcttta cctgtttatt cattttcttc ttcgctatta gttgggcccc aattgcctac 1320

gttattgttg ccgaatccta tcctttgcgt gtcaaaaatc gtgctatggc tattgctgtt 1380

ggtgccaact ggatttgggg tttcttgatt ggtttcttca ctcccttcat tacaagtgca 1440

attggatttt catacgggta tgtcttcatg ggctgtttgg tattttcatt cttctacgtg 1500

tttttctttg tctgtgaaac caagggctta acattagagg aagttaatga aatgtatgtt 1560

gaaggtgtca aaccatggaa atctggtagc tggatctcaa aagaaaaaag agtttccgag 1620

gaataa 1626

<210> SEQ ID NO: 121

<211> LENGTH: 1725

<212> TYPE: DNA

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(1725)

<223> OTHER INFORMATION: /organism=“Saccharomyces

cerevisiae” /note=“GAL2 ORF” /mol_type=“unassigned DNA”

<400> SEQENCE: 121

atggcagttg aggagaacaa tatgcctgtt gtttcacagc aaccccaagc tggtgaagac 60

gtgatctctt cactcagtaa agattcccat ttaagcgcac aatctcaaaa gtattccaat 120

gatgaattga aagccggtga gtcagggcct gaaggctccc aaagtgttcc tatagagata 180

cccaagaagc ccatgtctga atatgttacc gtttccttgc tttgtttgtg tgttgccttc 240

ggcggcttca tgtttggctg ggataccggt actatttctg ggtttgttgt ccaaacagac 300

tttttgagaa ggtttggtat gaaacataag gatggtaccc actatttgtc aaacgtcaga 360

acaggtttaa tcgtcgccat tttcaatatt ggctgtgcct ttggtggtat tatactttcc 420

aaaggtggag atatgtatgg ccgtaaaaag ggtctttcga ttgtcgtctc ggtttatata 480

gttggtatta tcattcaaat tgcctctatc aacaagtggt accaatattt cattggtaga 540

atcatatctg gtttgggtgt cggcggcatc gccgtcttat gtcctatgtt gatctctgaa 600

attgctccaa agcacttgag aggcacacta gtttcttgtt atcagctgat gattactgca 660

ggtatctttt tgggctactg tactaattac ggtacaaaga gctattcgaa ctcagttcaa 720

tggagagttc cattagggct atgtttcgct tggtcattat ttatgattgg cgctttgacg 780

ttagttcctg aatccccacg ttatttatgt gaggtgaata aggtagaaga cgccaagctt 840

tccattgcta agtctaacaa ggtgtcacca gaggatcctg ccgtccaggc agagttagat 900

ctgatcatgg ccggtataga agctgaaaaa ctggctggca atgcgtcctg gggggaatta 960

ttttccacca agaccaaagt atttcaacgt ttgttgatgg gtgtatttgt tcaaatgttc 1020

caacaattaa ccggtaacaa ttattttttc tactacggta ccgttatttt caagtcagtt 1080

ggcctggatg attcctttga aacatccatt gtcattggtg tagtcaactt tgcctccact 1140

ttctttagtt tgtggactgt cgaaaacttg gggcgtcgta aatgtttact tttgggcgct 1200

gccactatga tggcttgtat ggtcatctac gcctctgttg gtgttaccag attatatcct 1260

cacggtaaaa gccagccatc ttctaaaggt gccggtaact gtatgattgt ctttacctgt 1320

ttttatattt tctgttatgc cacaacctgg gcgccagttg cctgggtcat cacagcagaa 1380

tcattcccac tgagagtcaa gtcgaaatgt atggcgttgg cctctgcttc caattgggta 1440

tgggggttct tgattgcatt tttcacccca ttcatcacat ctgccattaa cttctactac 1500

ggttatgtct tcatgggctg tttggttgcc atgttttttt atgtcttttt ctttgttcca 1560

gaaactaaag gcctatcgtt agaagaaatt caagaattat gggaagaagg tgttttacct 1620

tggaaatctg aaggctggat tccttcatcc agaagaggta ataattacga tttagaggat 1680

ttacaacatg acgacaaacc gtggtacaag gccatgctag aataa 1725

<210> SEQ ID NO: 122

<211> LENGTH: 1704

<212> TYPE: DNA

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(1704)

<223> OTHER INFORMATION: /organism=“Saccharomyces

cerevisiae” /note=“HXT3-6 ORF” /mol_type=“unassigned DNA”

<400> SEQENCE: 122

atgaattcaa ctccagattt aatatctcca caaaagtcaa gtgagaattc gaatgctgac 60

ctgccttcga atagctctca ggtaatgaac atgcctgaag aaaaaggtgt tcaagatgat 120

ttccaagctg aggccgacca agtacttacc aacccaaata caggtaaagg tgcatatgtc 180

actgtgtcta tctgttgtgt tatggttgcc ttcggtggtt tcgttttcgg ttgggatact 240

ggtaccattt ctggtttcgt cgcccaaact gatttcttga gaagattcgg tatgaagcat 300

aaagatggta gttattattt gtctaaggtt agaactggtt taattgtctc cattttcaac 360

attggttgtg ccattggtgg tattattttg gctaaattgg gtgatatgta cggtcgtaaa 420

atgggtttga ttgtcgttgt tgttatctac atcatcggta ttattattca aattgcatcc 480

atcaacaaat ggtaccaata tttcatcggt agaattattt ccggtttggg tgttggtggt 540

attgccgttt tatctcctat gttgatttct gaagtcgctc ctaaggaaat gagaggtact 600

ttagtctcct gttaccaact gatgattacc ttgggtattt tcttgggtta ctgtaccaac 660

ttcggtacta agaactactc caactctgtg caatggagag ttccattagg tttgtgtttt 720

gcctgggctt tgtttatgat cggtggtatg actttcgttc cagaatcccc acgttatttg 780

gttgaagctg gtcaaattga cgaagcaaga gcatctcttt ccaaagttaa caaggttgcc 840

ccagaccatc cattcattca acaagagttg gaagttattg aagctagtgt tgaagaagct 900

agagctgctg gttcagcatc atggggtgag ttgttcactg gtaagccggc catgtttaag 960

cgtactatga tgggtatcat gatccaatct ctacaacaat tgactggtga taactatttc 1020

ttctactatg gtactaccgt ttttaacgct gttggtatga gtgattcttt cgaaacttct 1080

attgttttcg gtgtcgtcaa cttcttctct acttgttgtt ctttgtacac tgtcgatcgt 1140

tttggacgtc gtaactgttt gttatatggt gccattggta tggtctgctg ttatgtagtt 1200

tacgcttctg ttggtgtcac cagactatgg ccaaatggtg aaggtaatgg ttcatccaag 1260

ggtgctggta actgtatgat tgtctttgcc tgtttctata ttttctgttt tgctactaca 1320

tgggctccaa ttccttatgt cgttgtttct gaaactttcc cattgagagt caagtctaag 1380

gctatgtcta ttgctacagc tgctaattgg ttgtggggtt tcttgattgg tttcttcact 1440

ccatttatta ctggtgctat taacttctac tacggttacg ttttcatggg ctgtttggtc 1500

ttcatgttct tctatgtttt gttagttgtt ccagaaacta agggtttgac tttggaagaa 1560

gtcaacacca tgtgggaaga aggtgttcta ccatggaagt ctgcctcatg ggttccacca 1620

tctagaagag gtgccaacta cgacgctgaa gaaatggctc acgatgataa gccattgtac 1680

aagagaatgt tcagcaccaa ataa 1704

<210> SEQ ID NO: 123

<211> LENGTH: 567

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: MISC_FEATURE

<222> LOCATION: (1)..(567)

<223> OTHER INFORMATION: Hxt11p

<400> SEQENCE: 123

Met Ser Gly Val Asn Asn Thr Ser Ala Asn Glu Leu Ser Thr Thr Met

1 5 10 15

Ser Asn Ser Asn Ser Ala Val Gly Ala Pro Ser Val Lys Thr Glu His

20 25 30

Gly Asp Ser Lys Asn Ser Leu Asn Leu Asp Ala Asn Glu Pro Pro Ile

35 40 45

Asp Leu Pro Gln Lys Pro Leu Ser Ala Tyr Thr Thr Val Ala Ile Leu

50 55 60

Cys Leu Met Ile Ala Phe Gly Gly Phe Ile Phe Gly Trp Asp Thr Gly

65 70 75 80

Thr Ile Ser Gly Phe Val Asn Leu Ser Asp Phe Ile Arg Arg Phe Gly

85 90 95

Gln Lys Asn Asp Lys Gly Thr Tyr Tyr Leu Ser Lys Val Arg Met Gly

100 105 110

Leu Ile Val Ser Ile Phe Asn Ile Gly Cys Ala Ile Gly Gly Ile Val

115 120 125

Leu Ser Lys Val Gly Asp Ile Tyr Gly Arg Arg Ile Gly Leu Ile Thr

130 135 140

Val Thr Ala Ile Tyr Val Val Gly Ile Leu Ile Gln Ile Thr Ser Ile

145 150 155 160

Asn Lys Trp Tyr Gln Tyr Phe Ile Gly Arg Ile Ile Ser Gly Leu Gly

165 170 175

Val Gly Gly Ile Ala Val Leu Ser Pro Met Leu Ile Ser Glu Val Ala

180 185 190

Pro Lys His Ile Arg Gly Thr Leu Val Gln Leu Tyr Gln Leu Met Gly

195 200 205

Thr Met Gly Ile Phe Leu Gly Tyr Cys Thr Asn Tyr Gly Thr Lys Asn

210 215 220

Tyr His Asn Ala Thr Gln Trp Arg Val Gly Leu Gly Leu Cys Phe Ala

225 230 235 240

Trp Ala Thr Phe Met Val Ser Gly Met Met Phe Val Pro Glu Ser Pro

245 250 255

Arg Tyr Leu Ile Glu Val Gly Lys Asp Glu Glu Ala Lys Arg Ser Leu

260 265 270

Ser Lys Ser Asn Lys Val Ser Val Asp Asp Pro Ala Leu Leu Val Glu

275 280 285

Tyr Asp Thr Ile Lys Ala Gly Ile Glu Leu Glu Lys Leu Ala Gly Asn

290 295 300

Ala Ser Trp Ser Glu Leu Leu Ser Thr Lys Thr Lys Val Phe Gln Arg

305 310 315 320

Val Leu Met Gly Val Met Ile Gln Ser Leu Gln Gln Leu Thr Gly Asp

325 330 335

Asn Tyr Phe Phe Tyr Tyr Gly Thr Thr Ile Phe Lys Ser Val Gly Leu

340 345 350

Lys Asp Ser Phe Gln Thr Ser Ile Ile Ile Gly Val Val Asn Phe Phe

355 360 365

Ser Ser Phe Ile Ala Val Tyr Thr Ile Glu Arg Phe Gly Arg Arg Thr

370 375 380

Cys Leu Leu Trp Gly Ala Ala Ser Met Leu Cys Cys Phe Ala Val Phe

385 390 395 400

Ala Ser Val Gly Val Thr Lys Leu Trp Pro Gln Gly Ser Ser His Gln

405 410 415

Asp Ile Thr Ser Gln Gly Ala Gly Asn Cys Met Ile Val Phe Thr Met

420 425 430

Phe Phe Ile Phe Ser Phe Ala Thr Thr Trp Ala Gly Gly Cys Tyr Val

435 440 445

Ile Val Ser Glu Thr Phe Pro Leu Arg Val Lys Ser Arg Gly Met Ala

450 455 460

Ile Ala Thr Ala Ala Asn Trp Met Trp Gly Phe Leu Ile Ser Phe Phe

465 470 475 480

Thr Pro Phe Ile Thr Gly Ala Ile Asn Phe Tyr Tyr Gly Tyr Val Phe

485 490 495

Leu Gly Cys Leu Val Phe Ala Tyr Phe Tyr Val Phe Phe Phe Val Pro

500 505 510

Glu Thr Lys Gly Leu Thr Leu Glu Glu Val Asn Thr Met Trp Leu Glu

515 520 525

Gly Val Pro Ala Trp Lys Ser Ala Ser Trp Val Pro Pro Glu Arg Arg

530 535 540

Thr Ala Asp Tyr Asp Ala Asp Ala Ile Asp His Asp Asn Arg Pro Ile

545 550 555 560

Tyr Lys Arg Phe Phe Ser Ser

565

<210> SEQ ID NO: 124

<211> LENGTH: 541

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: MISC_FEATURE

<222> LOCATION: (1)..(541)

<223> OTHER INFORMATION: Hxt2p

<400> SEQENCE: 124

Met Ser Glu Phe Ala Thr Ser Arg Val Glu Ser Gly Ser Gln Gln Thr

1 5 10 15

Ser Ile His Ser Thr Pro Ile Val Gln Lys Leu Glu Thr Asp Glu Ser

20 25 30

Pro Ile Gln Thr Lys Ser Glu Tyr Thr Asn Ala Glu Leu Pro Ala Lys

35 40 45

Pro Ile Ala Ala Tyr Trp Thr Val Ile Cys Leu Cys Leu Met Ile Ala

50 55 60

Phe Gly Gly Phe Val Phe Gly Trp Asp Thr Gly Thr Ile Ser Gly Phe

65 70 75 80

Val Asn Gln Thr Asp Phe Lys Arg Arg Phe Gly Gln Met Lys Ser Asp

85 90 95

Gly Thr Tyr Tyr Leu Ser Asp Val Arg Thr Gly Leu Ile Val Gly Ile

100 105 110

Phe Asn Ile Gly Cys Ala Phe Gly Gly Leu Thr Leu Gly Arg Leu Gly

115 120 125

Asp Met Tyr Gly Arg Arg Ile Gly Leu Met Cys Val Val Leu Val Tyr

130 135 140

Ile Val Gly Ile Val Ile Gln Ile Ala Ser Ser Asp Lys Trp Tyr Gln

145 150 155 160

Tyr Phe Ile Gly Arg Ile Ile Ser Gly Met Gly Val Gly Gly Ile Ala

165 170 175

Val Leu Ser Pro Thr Leu Ile Ser Glu Thr Ala Pro Lys His Ile Arg

180 185 190

Gly Thr Cys Val Ser Phe Tyr Gln Leu Met Ile Thr Leu Gly Ile Phe

195 200 205

Leu Gly Tyr Cys Thr Asn Tyr Gly Thr Lys Asp Tyr Ser Asn Ser Val

210 215 220

Gln Trp Arg Val Pro Leu Gly Leu Asn Phe Ala Phe Ala Ile Phe Met

225 230 235 240

Ile Ala Gly Met Leu Met Val Pro Glu Ser Pro Arg Phe Leu Val Glu

245 250 255

Lys Gly Arg Tyr Glu Asp Ala Lys Arg Ser Leu Ala Lys Ser Asn Lys

260 265 270

Val Thr Ile Glu Asp Pro Ser Ile Val Ala Glu Met Asp Thr Ile Met

275 280 285

Ala Asn Val Glu Thr Glu Arg Leu Ala Gly Asn Ala Ser Trp Gly Glu

290 295 300

Leu Phe Ser Asn Lys Gly Ala Ile Leu Pro Arg Val Ile Met Gly Ile

305 310 315 320

Met Ile Gln Ser Leu Gln Gln Leu Thr Gly Asn Asn Tyr Phe Phe Tyr

325 330 335

Tyr Gly Thr Thr Ile Phe Asn Ala Val Gly Met Lys Asp Ser Phe Gln

340 345 350

Thr Ser Ile Val Leu Gly Ile Val Asn Phe Ala Ser Thr Phe Val Ala

355 360 365

Leu Tyr Thr Val Asp Lys Phe Gly Arg Arg Lys Cys Leu Leu Gly Gly

370 375 380

Ser Ala Ser Met Ala Ile Cys Phe Val Ile Phe Ser Thr Val Gly Val

385 390 395 400

Thr Ser Leu Tyr Pro Asn Gly Lys Asp Gln Pro Ser Ser Lys Ala Ala

405 410 415

Gly Asn Val Met Ile Val Phe Thr Cys Leu Phe Ile Phe Phe Phe Ala

420 425 430

Ile Ser Trp Ala Pro Ile Ala Tyr Val Ile Val Ala Glu Ser Tyr Pro

435 440 445

Leu Arg Val Lys Asn Arg Ala Met Ala Ile Ala Val Gly Ala Asn Trp

450 455 460

Ile Trp Gly Phe Leu Ile Gly Phe Phe Thr Pro Phe Ile Thr Ser Ala

465 470 475 480

Ile Gly Phe Ser Tyr Gly Tyr Val Phe Met Gly Cys Leu Val Phe Ser

485 490 495

Phe Phe Tyr Val Phe Phe Phe Val Cys Glu Thr Lys Gly Leu Thr Leu

500 505 510

Glu Glu Val Asn Glu Met Tyr Val Glu Gly Val Lys Pro Trp Lys Ser

515 520 525

Gly Ser Trp Ile Ser Lys Glu Lys Arg Val Ser Glu Glu

530 535 540

<210> SEQ ID NO: 125

<211> LENGTH: 574

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(574)

<223> OTHER INFORMATION: Gal2p

<400> SEQENCE: 125

Met Ala Val Glu Glu Asn Asn Met Pro Val Val Ser Gln Gln Pro Gln

1 5 10 15

Ala Gly Glu Asp Val Ile Ser Ser Leu Ser Lys Asp Ser His Leu Ser

20 25 30

Ala Gln Ser Gln Lys Tyr Ser Asn Asp Glu Leu Lys Ala Gly Glu Ser

35 40 45

Gly Ser Glu Gly Ser Gln Ser Val Pro Ile Glu Ile Pro Lys Lys Pro

50 55 60

Met Ser Glu Tyr Val Thr Val Ser Leu Leu Cys Leu Cys Val Ala Phe

65 70 75 80

Gly Gly Phe Met Phe Gly Trp Asp Thr Gly Thr Ile Ser Gly Phe Val

85 90 95

Val Gln Thr Asp Phe Leu Arg Arg Phe Gly Met Lys His Lys Asp Gly

100 105 110

Thr His Tyr Leu Ser Asn Val Arg Thr Gly Leu Ile Val Ala Ile Phe

115 120 125

Asn Ile Gly Cys Ala Phe Gly Gly Ile Ile Leu Ser Lys Gly Gly Asp

130 135 140

Met Tyr Gly Arg Lys Lys Gly Leu Ser Ile Val Val Ser Val Tyr Ile

145 150 155 160

Val Gly Ile Ile Ile Gln Ile Ala Ser Ile Asn Lys Trp Tyr Gln Tyr

165 170 175

Phe Ile Gly Arg Ile Ile Ser Gly Leu Gly Val Gly Gly Ile Ala Val

180 185 190

Leu Cys Pro Met Leu Ile Ser Glu Ile Ala Pro Lys His Leu Arg Gly

195 200 205

Thr Leu Val Ser Cys Tyr Gln Leu Met Ile Thr Ala Gly Ile Phe Leu

210 215 220

Gly Tyr Cys Thr Asn Tyr Gly Thr Lys Ser Tyr Ser Asn Ser Val Gln

225 230 235 240

Trp Arg Val Pro Leu Gly Leu Cys Phe Ala Trp Ser Leu Phe Met Ile

245 250 255

Gly Ala Leu Thr Leu Val Pro Glu Ser Pro Arg Tyr Leu Cys Glu Val

260 265 270

Asn Lys Val Glu Asp Ala Lys Arg Ser Ile Ala Lys Ser Asn Lys Val

275 280 285

Ser Pro Glu Asp Pro Ala Val Gln Ala Glu Leu Asp Leu Ile Met Ala

290 295 300

Gly Ile Glu Ala Glu Lys Leu Ala Gly Asn Ala Ser Trp Gly Glu Leu

305 310 315 320

Phe Ser Thr Lys Thr Lys Val Phe Gln Arg Leu Leu Met Gly Val Phe

325 330 335

Val Gln Met Phe Gln Gln Leu Thr Gly Asn Asn Tyr Phe Phe Tyr Tyr

340 345 350

Gly Thr Val Ile Phe Lys Ser Val Gly Leu Asp Asp Ser Phe Glu Thr

355 360 365

Ser Ile Val Ile Gly Val Val Asn Phe Ala Ser Thr Phe Phe Ser Leu

370 375 380

Trp Thr Val Glu Asn Leu Gly His Arg Lys Cys Leu Leu Leu Gly Ala

385 390 395 400

Ala Thr Met Met Ala Cys Met Val Ile Tyr Ala Ser Val Gly Val Thr

405 410 415

Arg Leu Tyr Pro His Gly Lys Ser Gln Pro Ser Ser Lys Gly Ala Gly

420 425 430

Asn Cys Met Ile Val Phe Thr Cys Phe Tyr Ile Phe Cys Tyr Ala Thr

435 440 445

Thr Trp Ala Pro Val Ala Trp Val Ile Thr Ala Glu Ser Phe Pro Leu

450 455 460

Arg Val Lys Ser Lys Cys Met Ala Leu Ala Ser Ala Ser Asn Trp Val

465 470 475 480

Trp Gly Phe Leu Ile Ala Phe Phe Thr Pro Phe Ile Thr Ser Ala Ile

485 490 495

Asn Phe Tyr Tyr Gly Tyr Val Phe Met Gly Cys Leu Val Ala Met Phe

500 505 510

Phe Tyr Val Phe Phe Phe Val Pro Glu Thr Lys Gly Leu Ser Leu Glu

515 520 525

Glu Ile Gln Glu Leu Trp Glu Glu Gly Val Leu Pro Trp Lys Ser Glu

530 535 540

Gly Trp Ile Pro Ser Ser Arg Arg Gly Asn Asn Tyr Asp Leu Glu Asp

545 550 555 560

Leu Gln His Asp Asp Lys Pro Trp Tyr Lys Ala Met Leu Glu

565 570

<210> SEQ ID NO: 126

<211> LENGTH: 508

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: MISC_FEATURE

<222> LOCATION: (1)..(508)

<223> OTHER INFORMATION: Hxt3-6p

<400> SEQENCE: 126

Met Asn Ser Thr Pro Asp Leu Ile Ser Pro Gln Lys Ser Ser Glu Asn

1 5 10 15

Ser Asn Ala Asp Leu Pro Ser Asn Ser Ser Gln Val Met Asn Met Pro

20 25 30

Glu Glu Lys Gly Val Gln Asp Asp Phe Gln Ala Glu Ala Asp Gln Val

35 40 45

Leu Thr Asn Pro Asn Thr Gly Lys Gly Ala Tyr Val Thr Val Ser Ile

50 55 60

Cys Cys Val Met Val Ala Phe Gly Gly Phe Val Phe Gly Trp Asp Thr

65 70 75 80

Gly Thr Ile Ser Gly Phe Val Ala Gln Thr Asp Phe Leu Arg Arg Phe

85 90 95

Gly Met Lys His Lys Asp Gly Ser Tyr Tyr Leu Ser Lys Val Arg Thr

100 105 110

Gly Leu Ile Val Ser Ile Ile Asn Ile Gly Cys Ala Ile Gly Gly Ile

115 120 125

Ile Leu Ala Lys Leu Gly Asp Met Tyr Gly Arg Lys Met Gly Leu Ile

130 135 140

Val Val Val Val Ile Tyr Ile Ile Gly Ile Ile Ile Gln Ile Ala Ser

145 150 155 160

Ile Asn Lys Trp Tyr Gln Tyr Phe Ile Gly Arg Ile Ile Ser Gly Leu

165 170 175

Gly Val Gly Gly Ile Ala Val Leu Ser Pro Met Leu Ile Ser Glu Val

180 185 190

Ala Pro Lys Glu Met Arg Gly Thr Leu Val Ser Cys Tyr Gln Leu Met

195 200 205

Ile Thr Leu Gly Ile Phe Leu Gly Tyr Cys Thr Asn Phe Gly Thr Lys

210 215 220

Asn Tyr Ser Asn Ser Val Gln Trp Arg Val Pro Leu Gly Leu Cys Phe

225 230 235 240

Ala Trp Ala Leu Phe Met Ile Gly Gly Met Thr Phe Val Pro Glu Ser

245 250 255

Pro Arg Tyr Leu Val Glu Ala Gly Gln Ile Asp Glu Ala Arg Ala Ser

260 265 270

Leu Ser Lys Val Asn Lys Val Ala Pro Asp His Pro Phe Ile Gln Gln

275 280 285

Glu Leu Glu Val Ile Glu Ala Ser Val Glu Glu Ala Arg Ala Ala Gly

290 295 300

Ser Ala Ser Trp Gly Glu Leu Phe Thr Gly Lys Pro Ala Met Phe Lys

305 310 315 320

Arg Thr Met Met Gly Ile Met Ile Gln Ser Leu Gln Gln Leu Thr Gly

325 330 335

Asp Asn Tyr Phe Phe Tyr Tyr Gly Thr Thr Val Phe Asn Ala Val Gly

340 345 350

Met Ser Asp Ser Phe Glu Thr Ser Ile Val Phe Gly Val Val Asn Phe

355 360 365

Phe Ser Thr Cys Cys Ser Leu Tyr Thr Val Asp Arg Phe Gly Arg Arg

370 375 380

Asn Cys Leu Leu Tyr Gly Ala Ile Gly Met Val Cys Cys Tyr Val Val

385 390 395 400

Tyr Ala Ser Val Gly Val Thr Arg Leu Trp Pro Asn Gly Glu Gly Asn

405 410 415

Gly Ser Ser Lys Gly Ala Gly Asn Cys Met Ile Cys Phe Ala Cys Phe

420 425 430

Tyr Ile Phe Cys Phe Ala Thr Thr Trp Ala Pro Ile Ala Tyr Val Val

435 440 445

Ile Ser Glu Thr Phe Pro Leu Arg Val Lys Ser Lys Ala Met Ser Ile

450 455 460

Ala Thr Ala Ala Asn Trp Leu Trp Gly Phe Leu Ile Gly Phe Phe Thr

465 470 475 480

Pro Phe Ile Thr Gly Ala Ile Asn Phe Tyr Tyr Gly Tyr Val Phe Met

485 490 495

Gly Cys Gln Glu Gln Thr Ser Ser Thr Cys Leu Phe

500 505

<210> SEQ ID NO: 127

<211> LENGTH: 38

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer F HXT36 Bcui

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(38)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“primer

F HXT36 Bcui” /mol_type=“unassigned DNA”

<400> SEQENCE: 127

gcatactagt atgaattcaa ctccagattt aatatctc 38

<210> SEQ ID NO: 128

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer R HXT36 367NNN

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(30)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“primer

R HXT36 367NNN” /mol_type=“unassigned DNA”

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (18)..(20)

<223> OTHER INFORMATION: n is a, c, g, or t

<400> SEQENCE: 128

caacaagtag agaagaannn gacgacaccg 30

<210> SEQ ID NO: 129

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer F HXT36 367NNN

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(30)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“primer

F HXT36 367NNN” /mol_type=“unassigned DNA”

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (11)..(13)

<223> OTHER INFORMATION: n is a, c, g, or t

<400> SEQENCE: 129

cggtgtcgtc nnnttcttct ctacttgttg 30

<210> SEQ ID NO: 130

<211> LENGTH: 36

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer R HXT36 BamHi

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(36)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“primer

R HXT36 BamHi” /mol_type=“unassigned DNA”

<400> SEQENCE: 130

acgtggatcc ttatttggtg ctgaacattc tcttgt 36

<210> SEQ ID NO: 131

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer R HXT36 BamHI-stop

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(35)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“primer

R HXT36 BamHI-stop” /mol_type=“unassigned DNA”

<400> SEQENCE: 131

ccatggatcc tttggtgctg aacattctct tgtac 35

<210> SEQ ID NO: 132

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer F GFP BamHI

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(31)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“primer

F GFP BamHI” /mol_type=“unassigned DNA”

<400> SEQENCE: 132

aaaggatcca tggtgagcaa gggcgaggag c 31

<210> SEQ ID NO: 133

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: primer R GFP ClaI

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“primer

R GFP ClaI” /mol_type=“unassigned DNA”

<400> SEQENCE: 133

aaaatcgatt tacttgtaca gctcgtcc 28

<210> SEQ ID NO: 134

<211> LENGTH: 36

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: F HXT11 XbaI

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(36)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“F HXT11 XbaI” /mol_type=“unassigned DNA”

<400> SEQENCE: 134

ggcctctaga atgtcaggtg ttaataatac atccgc 36

<210> SEQ ID NO: 135

<211> LENGTH: 39

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: R HXT11 BamHI

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(39)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“R HXT11 BamHI” /mol_type=“unassigned DNA”

<400> SEQENCE: 135

cgatggatcc tcagctggaa aagaacctct tgtaaattg 39

<210> SEQ ID NO: 136

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: F HXT11 366NNN

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“F HXT11 366NNN” /mol_type=“unassigned DNA”

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (11)..(13)

<223> OTHER INFORMATION: n is a, c, g, or t

<400> SEQENCE: 136

cggtgtggtt nnntttttct cttcattc 28

<210> SEQ ID NO: 137

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: R HXT11 366NNN

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“R HXT11 366NNN” /mol_type=“unassigned DNA”

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(18)

<223> OTHER INFORMATION: n is a, c, g, or t

<400> SEQENCE: 137

gaatgaagag aaaaannnaa ccacaccg 28

<210> SEQ ID NO: 138

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: F HXT11 N366F

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“F HXT11 N366F” /mol_type=“unassigned DNA”

<400> SEQENCE: 138

cggtgtggtt ttttttttct cttcattc 28

<210> SEQ ID NO: 139

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: R HXT11 N366F

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“R HXT11 N366F” /mol_type=“unassigned DNA”

<400> SEQENCE: 139

gaatgaagag aaaaaaaaaa ccacaccg 28

<210> SEQ ID NO: 140

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: F HXT11 N366E

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“F HXT11 N366E” /mol_type=“unassigned DNA”

<400> SEQENCE: 140

cggtgtggtt gagtttttct cttcattc 28

<210> SEQ ID NO: 141

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: R HXT11 N366E

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“R HXT11 N366E” /mol_type=“unassigned DNA”

<400> SEQENCE: 141

gaatgaagag aaaaactcaa ccacaccg 28

<210> SEQ ID NO: 142

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: F HXT11 N366K

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“F HXT11 N366K” /mol_type=“unassigned DNA”

<400> SEQENCE: 142

cggtgtggtt aaatttttct cttcattc 28

<210> SEQ ID NO: 143

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: R HXT11 N366K

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence” /note=“R

HXT11 N366K ” /mol_type=“unassigned DNA”

<400> SEQENCE: 143

gaatgaagag aaaaatttaa ccacaccg 28

<210> SEQ ID NO: 144

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: F HXT11 N366M

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“F HXT11 N366M” /mol_type=“unassigned DNA”

<400> SEQENCE: 144

cggtgtggtt atgtttttct cttcattc 28

<210> SEQ ID NO: 145

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: R HXT11 N366M

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“R HXT11 N366M” /mol_type=“unassigned DNA”

<400> SEQENCE: 145

gaatgaagag aaaaacataa ccacaccg 28

<210> SEQ ID NO: 146

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: F HXT11 N366W

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“F HXT11 N366W” /mol_type=“unassigned DNA”

<400> SEQENCE: 146

cggtgtggtt tggtttttct cttcattc 28

<210> SEQ ID NO: 147

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: R HXT11 N366W

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“R HXT11 N366W” /mol_type=“unassigned DNA”

<400> SEQENCE: 147

gaatgaagag aaaaaccaaa ccacaccg 28

<210> SEQ ID NO: 148

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: F HXT11 N366Y

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“F HXT11 N366Y” /mol_type=“unassigned DNA”

<400> SEQENCE: 148

cggtgtggtt tattttttct cttcattc 28

<210> SEQ ID NO: 149

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: R HXT11 N366Y

<220> FEATURE:

<221> NAME/KEY: source

<222> LOCATION: (1)..(28)

<223> OTHER INFORMATION: /organism=“Artificial Sequence”

/note=“R HXT11 N366Y” /mol_type=“unassigned DNA”

<400> SEQENCE: 149

gaatgaagag aaaaaataaa ccacaccg 28

<210> SEQ ID NO: 150

<211> LENGTH: 574

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: MISC_FEATURE

<222> LOCATION: (1)..(574)

<223> OTHER INFORMATION: Gal2 (Fig. 10)

<400> SEQENCE: 150

Met Ala Val Glu Glu Asn Asn Met Pro Val Val Ser Gln Gln Pro Gln

1 5 10 15

Ala Gly Glu Asp Val Ile Ser Ser Leu Ser Lys Asp Ser His Leu Ser

20 25 30

Ala Gln Ser Gln Lys Tyr Ser Asn Asp Glu Leu Lys Ala Gly Glu Ser

35 40 45

Gly Ser Glu Gly Ser Gln Ser Val Pro Ile Glu Ile Pro Lys Lys Pro

50 55 60

Met Ser Glu Tyr Val Thr Val Ser Leu Leu Cys Leu Cys Val Ala Phe

65 70 75 80

Gly Gly Phe Met Phe Gly Trp Asp Thr Gly Thr Ile Ser Gly Phe Val

85 90 95

Val Gln Thr Asp Phe Leu Arg Arg Phe Gly Met Lys His Lys Asp Gly

100 105 110

Thr His Tyr Leu Ser Asn Val Arg Thr Gly Leu Ile Val Ala Ile Phe

115 120 125

Asn Ile Gly Cys Ala Phe Gly Gly Ile Ile Leu Ser Lys Gly Gly Asp

130 135 140

Met Tyr Gly Arg Lys Lys Gly Leu Ser Ile Val Val Ser Val Tyr Ile

145 150 155 160

Val Gly Ile Ile Ile Gln Ile Ala Ser Ile Asn Lys Trp Tyr Gln Tyr

165 170 175

Phe Ile Gly Arg Ile Ile Ser Gly Leu Gly Val Gly Gly Ile Ala Val

180 185 190

Leu Cys Pro Met Leu Ile Ser Glu Ile Ala Pro Lys His Leu Arg Gly

195 200 205

Thr Leu Val Ser Cys Tyr Gln Leu Met Ile Thr Ala Gly Ile Phe Leu

210 215 220

Gly Tyr Cys Thr Asn Tyr Gly Thr Lys Ser Tyr Ser Asn Ser Val Gln

225 230 235 240

Trp Arg Val Pro Leu Gly Leu Cys Phe Ala Trp Ser Leu Phe Met Ile

245 250 255

Gly Ala Leu Thr Leu Val Pro Glu Ser Pro Arg Tyr Leu Cys Glu Val

260 265 270

Asn Lys Val Glu Asp Ala Lys Arg Ser Ile Ala Lys Ser Asn Lys Val

275 280 285

Ser Pro Glu Asp Pro Ala Val Gln Ala Glu Leu Asp Leu Ile Met Ala

290 295 300

Gly Ile Glu Ala Glu Lys Leu Ala Gly Asn Ala Ser Trp Gly Glu Leu

305 310 315 320

Phe Ser Thr Lys Thr Lys Val Phe Gln Arg Leu Leu Met Gly Val Phe

325 330 335

Val Gln Met Phe Gln Gln Leu Thr Gly Asn Asn Tyr Phe Phe Tyr Tyr

340 345 350

Gly Thr Val Ile Phe Lys Ser Val Gly Leu Asp Asp Ser Phe Glu Thr

355 360 365

Ser Ile Val Ile Gly Val Val Asn Phe Ala Ser Thr Phe Phe Ser Leu

370 375 380

Trp Thr Val Glu Asn Leu Gly His Arg Lys Cys Leu Leu Leu Gly Ala

385 390 395 400

Ala Thr Met Met Ala Cys Met Val Ile Tyr Ala Ser Val Gly Val Thr

405 410 415

Arg Leu Tyr Pro His Gly Lys Ser Gln Pro Ser Ser Lys Gly Ala Gly

420 425 430

Asn Cys Met Ile Val Phe Thr Cys Phe Tyr Ile Phe Cys Tyr Ala Thr

435 440 445

Thr Trp Ala Pro Val Ala Trp Val Ile Thr Ala Glu Ser Phe Pro Leu

450 455 460

Arg Val Lys Ser Lys Cys Met Ala Leu Ala Ser Ala Ser Asn Trp Val

465 470 475 480

Trp Gly Phe Leu Ile Ala Phe Phe Thr Pro Phe Ile Thr Ser Ala Ile

485 490 495

Asn Phe Tyr Tyr Gly Tyr Val Phe Met Gly Cys Leu Val Ala Met Phe

500 505 510

Phe Tyr Val Phe Phe Phe Val Pro Glu Thr Lys Gly Leu Ser Leu Glu

515 520 525

Glu Ile Gln Glu Leu Trp Glu Glu Gly Val Leu Pro Trp Lys Ser Glu

530 535 540

Gly Trp Ile Pro Ser Ser Arg Arg Gly Asn Asn Tyr Asp Leu Glu Asp

545 550 555 560

Leu Gln His Asp Asp Lys Pro Trp Tyr Lys Ala Met Leu Glu

565 570

<210> SEQ ID NO: 151

<211> LENGTH: 570

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: MISC_FEATURE

<222> LOCATION: (1)..(570)

<223> OTHER INFORMATION: Hxt1 (Fig. 10)

<400> SEQENCE: 151

Met Asn Ser Thr Pro Asp Leu Ile Ser Pro Gln Lys Ser Asn Ser Ser

1 5 10 15

Asn Ser Tyr Glu Leu Glu Ser Gly Arg Ser Lys Ala Met Asn Thr Pro

20 25 30

Glu Gly Lys Asn Glu Ser Phe His Asp Asn Leu Ser Glu Ser Gln Val

35 40 45

Gln Pro Ala Val Ala Pro Pro Asn Thr Gly Lys Gly Val Tyr Val Thr

50 55 60

Val Ser Ile Cys Cys Val Met Val Ala Phe Gly Gly Phe Ile Phe Gly

65 70 75 80

Trp Asp Thr Gly Thr Ile Ser Gly Phe Val Ala Gln Thr Asp Phe Leu

85 90 95

Arg Arg Phe Gly Met Lys His His Asp Gly Ser His Tyr Leu Ser Lys

100 105 110

Val Arg Thr Gly Leu Ile Val Ser Ile Phe Asn Ile Gly Cys Ala Ile

115 120 125

Gly Gly Ile Val Leu Ala Lys Leu Gly Asp Met Tyr Gly Arg Arg Ile

130 135 140

Gly Leu Ile Val Val Val Val Ile Tyr Thr Ile Gly Ile Ile Ile Gln

145 150 155 160

Ile Ala Ser Ile Asn Lys Trp Tyr Gln Tyr Phe Ile Gly Arg Ile Ile

165 170 175

Ser Gly Leu Gly Val Gly Gly Ile Thr Val Leu Ser Pro Met Leu Ile

180 185 190

Ser Glu Val Ala Pro Ser Glu Met Arg Gly Thr Leu Val Ser Cys Tyr

195 200 205

Gln Val Met Ile Thr Leu Gly Ile Phe Leu Gly Tyr Cys Thr Asn Phe

210 215 220

Gly Thr Lys Asn Tyr Ser Asn Ser Val Gln Trp Arg Val Pro Leu Gly

225 230 235 240

Leu Cys Phe Ala Trp Ala Leu Phe Met Ile Gly Gly Met Met Phe Val

245 250 255

Pro Glu Ser Pro Arg Tyr Leu Val Glu Ala Gly Arg Ile Asp Glu Ala

260 265 270

Arg Ala Ser Leu Ala Lys Val Asn Lys Cys Pro Pro Asp His Pro Tyr

275 280 285

Ile Gln Tyr Glu Leu Glu Thr Ile Glu Ala Gly Val Glu Glu Met Arg

290 295 300

Ala Ala Gly Thr Ala Ser Trp Gly Glu Leu Phe Thr Gly Lys Pro Ala

305 310 315 320

Met Phe Gln Arg Thr Met Met Gly Ile Met Ile Gln Ser Leu Gln Gln

325 330 335

Leu Thr Gly Asp Asn Tyr Phe Phe Tyr Tyr Gly Thr Ile Val Phe Gln

340 345 350

Ala Val Gly Leu Ser Asp Ser Phe Glu Thr Ser Ile Val Phe Gly Val

355 360 365

Val Asn Phe Phe Ser Thr Cys Cys Ser Leu Tyr Thr Val Asp Arg Phe

370 375 380

Gly Arg Arg Asn Cys Leu Met Trp Gly Ala Val Gly Met Val Cys Cys

385 390 395 400

Tyr Val Val Tyr Ala Ser Val Gly Val Thr Arg Leu Trp Pro Asn Gly

405 410 415

Gln Asn Asn Gly Ser Ser Lys Gly Ala Gly Asn Cys Met Ile Cys Phe

420 425 430

Ala Cys Phe Tyr Ile Phe Cys Phe Ala Thr Thr Trp Ala Pro Ile Ala

435 440 445

Tyr Val Val Ile Ser Glu Cys Phe Pro Leu Arg Val Lys Ser Lys Cys

450 455 460

Met Ser Ile Ala Ser Ala Ala Asn Trp Ile Trp Gly Phe Leu Ile Ser

465 470 475 480

Phe Phe Thr Pro Phe Ile Thr Gly Ala Ile Asn Phe Tyr Tyr Gly Tyr

485 490 495

Val Phe Met Gly Cys Met Val Phe Ala Tyr Phe Tyr Val Phe Phe Phe

500 505 510

Val Pro Glu Thr Lys Gly Leu Ser Leu Glu Glu Val Asn Asp Met Tyr

515 520 525

Ala Glu Gly Val Leu Pro Trp Lys Ser Ala Ser Trp Val Pro Val Ser

530 535 540

Lys Arg Gly Ala Asp Tyr Asn Ala Asp Asp Leu Met His Asp Asp Gln

545 550 555 560

Pro Phe Tyr Lys Ser Leu Phe Ser Arg Lys

565 570

<210> SEQ ID NO: 152

<211> LENGTH: 541

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: MISC_FEATURE

<222> LOCATION: (1)..(541)

<223> OTHER INFORMATION: Hxt2 (Fig. 10)

<400> SEQENCE: 152

Met Ser Glu Phe Ala Thr Ser Arg Val Glu Ser Gly Ser Gln Gln Thr

1 5 10 15

Ser Ile His Ser Thr Pro Ile Val Gln Lys Leu Glu Thr Asp Glu Ser

20 25 30

Pro Ile Gln Thr Lys Ser Glu Tyr Thr Asn Ala Glu Leu Pro Ala Lys

35 40 45

Pro Ile Ala Ala Tyr Trp Thr Val Ile Cys Leu Cys Leu Met Ile Ala

50 55 60

Phe Gly Gly Phe Val Phe Gly Trp Asp Thr Gly Thr Ile Ser Gly Phe

65 70 75 80

Val Asn Gln Thr Asp Phe Lys Arg Arg Phe Gly Gln Met Lys Ser Asp

85 90 95

Gly Thr Tyr Tyr Leu Ser Asp Val Arg Thr Gly Leu Ile Val Gly Ile

100 105 110

Phe Asn Ile Gly Cys Ala Phe Gly Gly Leu Thr Leu Gly Arg Leu Gly

115 120 125

Asp Met Tyr Gly Arg Arg Ile Gly Leu Met Cys Val Val Leu Val Tyr

130 135 140

Ile Val Gly Ile Val Ile Gln Ile Ala Ser Ser Asp Lys Trp Tyr Gln

145 150 155 160

Tyr Phe Ile Gly Arg Ile Ile Ser Gly Met Gly Val Gly Gly Ile Ala

165 170 175

Val Leu Ser Pro Thr Leu Ile Ser Glu Thr Ala Pro Lys His Ile Arg

180 185 190

Gly Thr Cys Val Ser Phe Tyr Gln Leu Met Ile Thr Leu Gly Ile Phe

195 200 205

Leu Gly Tyr Cys Thr Asn Tyr Gly Thr Lys Asp Tyr Ser Asn Ser Val

210 215 220

Gln Trp Arg Val Pro Leu Gly Leu Asn Phe Ala Phe Ala Ile Phe Met

225 230 235 240

Ile Ala Gly Met Leu Met Val Pro Glu Ser Pro Arg Phe Leu Val Glu

245 250 255

Lys Gly Arg Tyr Glu Asp Ala Lys Arg Ser Leu Ala Lys Ser Asn Lys

260 265 270

Val Thr Ile Glu Asp Pro Ser Ile Val Ala Glu Met Asp Thr Ile Met

275 280 285

Ala Asn Val Glu Thr Glu Arg Leu Ala Gly Asn Ala Ser Trp Gly Glu

290 295 300

Leu Phe Ser Asn Lys Gly Ala Ile Leu Pro Arg Val Ile Met Gly Ile

305 310 315 320

Met Ile Gln Ser Leu Gln Gln Leu Thr Gly Asn Asn Tyr Phe Phe Tyr

325 330 335

Tyr Gly Thr Thr Ile Phe Asn Ala Val Gly Met Lys Asp Ser Phe Gln

340 345 350

Thr Ser Ile Val Leu Gly Ile Val Asn Phe Ala Ser Thr Phe Val Ala

355 360 365

Leu Tyr Thr Val Asp Lys Phe Gly Arg Arg Lys Cys Leu Leu Gly Gly

370 375 380

Ser Ala Ser Met Ala Ile Cys Phe Val Ile Phe Ser Thr Val Gly Val

385 390 395 400

Thr Ser Leu Tyr Pro Asn Gly Lys Asp Gln Pro Ser Ser Lys Ala Ala

405 410 415

Gly Asn Val Met Ile Val Phe Thr Cys Leu Phe Ile Phe Phe Phe Ala

420 425 430

Ile Ser Trp Ala Pro Ile Ala Tyr Val Ile Val Ala Glu Ser Tyr Pro

435 440 445

Leu Arg Val Lys Asn Arg Ala Met Ala Ile Ala Val Gly Ala Asn Trp

450 455 460

Ile Trp Gly Phe Leu Ile Gly Phe Phe Thr Pro Phe Ile Thr Ser Ala

465 470 475 480

Ile Gly Phe Ser Tyr Gly Tyr Val Phe Met Gly Cys Leu Val Phe Ser

485 490 495

Phe Phe Tyr Val Phe Phe Phe Val Cys Glu Thr Lys Gly Leu Thr Leu

500 505 510

Glu Glu Val Asn Glu Met Tyr Val Glu Gly Val Lys Pro Trp Lys Ser

515 520 525

Gly Ser Trp Ile Ser Lys Glu Lys Arg Val Ser Glu Glu

530 535 540

<210> SEQ ID NO: 153

<211> LENGTH: 567

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: MISC_FEATURE

<222> LOCATION: (1)..(567)

<223> OTHER INFORMATION: Hxt3 (Fig. 10)

<400> SEQENCE: 153

Met Asn Ser Thr Pro Asp Leu Ile Ser Pro Gln Lys Ser Ser Glu Asn

1 5 10 15

Ser Asn Ala Asp Leu Pro Ser Asn Ser Ser Gln Val Met Asn Met Pro

20 25 30

Glu Glu Lys Gly Val Gln Asp Asp Phe Gln Ala Glu Ala Asp Gln Val

35 40 45

Leu Thr Asn Pro Asn Thr Gly Lys Gly Ala Tyr Val Thr Val Ser Ile

50 55 60

Cys Cys Val Met Val Ala Phe Gly Gly Phe Val Phe Gly Trp Asp Thr

65 70 75 80

Gly Thr Ile Ser Gly Phe Val Ala Gln Thr Asp Phe Leu Arg Arg Phe

85 90 95

Gly Met Lys His Lys Asp Gly Ser Tyr Tyr Leu Ser Lys Val Arg Thr

100 105 110

Gly Leu Ile Val Ser Ile Phe Asn Ile Gly Cys Ala Ile Gly Gly Ile

115 120 125

Ile Leu Ala Lys Leu Gly Asp Met Tyr Gly Arg Lys Met Gly Leu Ile

130 135 140

Val Val Val Val Ile Tyr Ile Ile Gly Ile Ile Ile Gln Ile Ala Ser

145 150 155 160

Ile Asn Lys Trp Tyr Gln Tyr Phe Ile Gly Arg Ile Ile Ser Gly Leu

165 170 175

Gly Val Gly Gly Ile Ala Val Leu Ser Pro Met Leu Ile Ser Glu Val

180 185 190

Ala Pro Lys Glu Met Arg Gly Ala Leu Val Ser Cys Tyr Gln Leu Met

195 200 205

Val Thr Leu Gly Ile Phe Leu Gly Tyr Cys Thr Asn Phe Gly Thr Lys

210 215 220

Asn Tyr Ser Asn Ser Val Gln Trp Arg Val Pro Leu Gly Leu Cys Phe

225 230 235 240

Ala Trp Ala Leu Phe Met Ile Gly Gly Met Thr Phe Val Pro Glu Ser

245 250 255

Pro Arg Tyr Leu Val Glu Ala Gly Gln Ile Asp Glu Ala Arg Ala Ser

260 265 270

Leu Ser Lys Val Asn Lys Val Ala Pro Asp His Pro Phe Ile Gln Gln

275 280 285

Glu Leu Glu Val Ile Glu Ala Ser Val Glu Glu Ala Arg Ala Ala Gly

290 295 300

Ser Ala Ser Trp Gly Glu Leu Phe Thr Gly Lys Pro Ala Met Phe Lys

305 310 315 320

Arg Thr Met Ile Gly Ile Met Ile Gln Ser Leu Gln Gln Leu Thr Gly

325 330 335

Asp Asn Tyr Phe Phe Tyr Tyr Gly Thr Thr Val Phe Asn Ala Val Gly

340 345 350

Met Ser Asp Ser Phe Glu Thr Ser Ile Val Phe Gly Val Val Asn Phe

355 360 365

Phe Ser Thr Cys Cys Ser Leu Tyr Thr Val Asp Arg Phe Gly Arg Arg

370 375 380

Asn Cys Leu Met Trp Gly Ala Val Gly Met Val Cys Cys Tyr Val Val

385 390 395 400

Tyr Ala Ser Val Gly Val Thr Arg Leu Trp Pro Asn Gly Glu Gly Asn

405 410 415

Gly Ser Ser Lys Gly Ala Gly Asn Cys Met Ile Val Phe Ala Cys Phe

420 425 430

Tyr Ile Phe Cys Phe Ala Thr Thr Trp Ala Pro Ile Ala Tyr Val Val

435 440 445

Ile Ser Glu Thr Phe Pro Leu Arg Val Lys Ser Lys Ala Met Ser Ile

450 455 460

Ala Thr Ala Ala Asn Trp Leu Trp Gly Phe Leu Ile Gly Phe Phe Thr

465 470 475 480

Pro Phe Ile Thr Gly Ala Ile Asn Phe Tyr Tyr Gly Tyr Val Phe Met

485 490 495

Gly Cys Met Val Phe Ala Tyr Phe Tyr Val Phe Phe Phe Val Pro Glu

500 505 510

Thr Lys Gly Leu Thr Leu Glu Glu Val Asn Asp Met Tyr Ala Glu Gly

515 520 525

Val Leu Pro Trp Lys Ser Ala Ser Trp Val Pro Thr Ser Gln Arg Gly

530 535 540

Ala Asn Tyr Asp Ala Asp Ala Leu Met His Asp Asp Gln Pro Phe Tyr

545 550 555 560

Lys Lys Met Phe Gly Lys Lys

565

<210> SEQ ID NO: 154

<211> LENGTH: 560

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: MISC_FEATURE

<222> LOCATION: (1)..(560)

<223> OTHER INFORMATION: Hxt4SC (Fig. 10)

<400> SEQENCE: 154

Met Ser Glu Glu Ala Ala Tyr Gln Glu Asp Thr Ala Val Gln Asn Thr

1 5 10 15

Pro Ala Asp Ala Leu Ser Pro Val Glu Ser Asp Ser Asn Ser Ala Leu

20 25 30

Ser Thr Pro Ser Asn Lys Ala Glu Arg Asp Asp Met Lys Asp Phe Asp

35 40 45

Glu Asn His Glu Glu Ser Asn Asn Tyr Val Glu Ile Pro Lys Lys Pro

50 55 60

Ala Ser Ala Tyr Val Thr Val Ser Ile Cys Cys Leu Met Val Ala Phe

65 70 75 80

Gly Gly Phe Val Phe Gly Trp Asp Thr Gly Thr Ile Ser Gly Phe Val

85 90 95

Ala Gln Thr Asp Phe Ile Arg Arg Phe Gly Met Lys His His Asp Gly

100 105 110

Thr Tyr Tyr Leu Ser Lys Val Arg Thr Gly Leu Ile Val Ser Ile Phe

115 120 125

Asn Ile Gly Cys Ala Ile Gly Gly Ile Ile Leu Ala Lys Leu Gly Asp

130 135 140

Met Tyr Gly Arg Lys Met Gly Leu Ile Val Val Val Val Ile Tyr Ile

145 150 155 160

Ile Gly Ile Ile Ile Gln Ile Ala Ser Ile Asn Lys Trp Tyr Gln Tyr

165 170 175

Phe Ile Gly Arg Ile Ile Ser Gly Leu Gly Val Gly Gly Ile Ala Val

180 185 190

Leu Ser Pro Met Leu Ile Ser Glu Val Ser Pro Lys His Ile Arg Gly

195 200 205

Thr Leu Val Ser Cys Tyr Gln Leu Met Ile Thr Leu Gly Ile Phe Leu

210 215 220

Gly Tyr Cys Thr Asn Tyr Gly Thr Lys Thr Tyr Thr Asn Ser Val Gln

225 230 235 240

Trp Arg Val Pro Leu Gly Leu Gly Phe Ala Trp Ala Leu Phe Met Ile

245 250 255

Gly Gly Met Thr Phe Val Pro Glu Ser Pro Arg Tyr Leu Val Glu Val

260 265 270

Gly Lys Ile Glu Glu Ala Lys Arg Ser Ile Ala Leu Ser Asn Lys Val

275 280 285

Ser Ala Asp Asp Pro Ala Val Met Ala Glu Val Glu Val Val Gln Ala

290 295 300

Thr Val Glu Ala Glu Lys Leu Ala Gly Asn Ala Ser Trp Gly Glu Ile

305 310 315 320

Phe Ser Thr Lys Thr Lys Val Phe Gln Arg Leu Ile Met Gly Ala Met

325 330 335

Ile Gln Ser Leu Gln Gln Leu Thr Gly Asp Asn Tyr Phe Phe Tyr Tyr

340 345 350

Gly Thr Thr Val Phe Thr Ala Val Gly Leu Glu Asp Ser Phe Glu Thr

355 360 365

Ser Ile Val Leu Gly Ile Val Asn Phe Ala Ser Thr Phe Val Gly Ile

370 375 380

Phe Leu Val Glu Arg Tyr Gly Arg Arg Arg Cys Leu Leu Trp Gly Ala

385 390 395 400

Ala Ser Met Thr Ala Cys Met Val Val Phe Ala Ser Val Gly Val Thr

405 410 415

Arg Leu Trp Pro Asn Gly Lys Lys Asn Gly Ser Ser Lys Gly Ala Gly

420 425 430

Asn Cys Met Ile Val Phe Thr Cys Phe Tyr Leu Phe Cys Phe Ala Thr

435 440 445

Thr Trp Ala Pro Ile Pro Phe Val Val Asn Ser Glu Thr Phe Pro Leu

450 455 460

Arg Val Lys Ser Lys Cys Met Ala Ile Ala Gln Ala Cys Asn Trp Ile

465 470 475 480

Trp Gly Phe Leu Ile Gly Phe Phe Thr Pro Phe Ile Ser Gly Ala Ile

485 490 495

Asp Phe Tyr Tyr Gly Tyr Val Phe Met Gly Cys Leu Val Phe Ser Tyr

500 505 510

Phe Tyr Val Phe Phe Phe Val Pro Glu Thr Lys Gly Leu Thr Leu Glu

515 520 525

Glu Val Asn Thr Leu Trp Glu Glu Gly Val Leu Pro Trp Lys Ser Pro

530 535 540

Ser Trp Phe His Gln Thr Arg Glu Val Leu Thr Thr Thr Leu Met Ile

545 550 555 560

<210> SEQ ID NO: 155

<211> LENGTH: 581

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: MISC_FEATURE

<222> LOCATION: (1)..(581)

<223> OTHER INFORMATION: Hxt4RN (Fig. 10)

<400> SEQENCE: 155

Met Ser Glu Glu Ala Ala Tyr Gln Glu Asp Thr Ala Val Gln Asn Thr

1 5 10 15

Pro Ala Asp Ala Leu Ser Pro Val Glu Ser Asp Ser Asn Ser Ala Leu

20 25 30

Ser Thr Pro Ser Asn Lys Ala Glu Arg Asp Asp Met Lys Asp Phe Asp

35 40 45

Glu Asn His Glu Glu Ser Asn Asn Tyr Val Glu Ile Pro Lys Lys Pro

50 55 60

Ala Ser Ala Tyr Val Thr Val Ser Ile Cys Cys Leu Met Val Ala Phe

65 70 75 80

Gly Gly Phe Val Phe Gly Trp Asp Thr Gly Thr Ile Ser Gly Phe Val

85 90 95

Ala Gln Thr Asp Phe Ile Arg Arg Phe Gly Met Lys His His Asp Gly

100 105 110

Thr Tyr Tyr Leu Ser Lys Val Arg Thr Gly Leu Ile Val Ser Ile Ile

115 120 125

Asn Ile Gly Cys Ala Ile Gly Gly Ile Ile Leu Ser Lys Leu Gly Asp

130 135 140

Met Tyr Gly Arg Lys Met Gly Leu Ile Val Val Val Val Ile Tyr Ile

145 150 155 160

Ile Gly Ile Ile Ile Gln Ile Ala Ser Ile Asn Lys Trp Tyr Gln Tyr

165 170 175

Phe Ile Gly Arg Ile Ile Ser Gly Leu Gly Val Gly Gly Ile Ala Val

180 185 190

Leu Ser Pro Met Leu Ile Ser Glu Val Ser Pro Lys His Ile Arg Gly

195 200 205

Thr Leu Val Ser Cys Tyr Gln Leu Met Ile Thr Leu Gly Ile Phe Leu

210 215 220

Gly Tyr Cys Thr Asn Tyr Gly Thr Lys Thr Tyr Thr Asn Ser Val Gln

225 230 235 240

Trp Arg Val Pro Leu Gly Leu Gly Phe Ala Trp Ala Leu Phe Met Ile

245 250 255

Gly Gly Met Thr Leu Val Pro Glu Ser Pro Arg Tyr Leu Val Glu Val

260 265 270

Gly Lys Ile Glu Glu Ala Lys Arg Ser Ile Ala Leu Ser Asn Lys Val

275 280 285

Asn Ala Asp Asp Pro Ala Val Met Ala Glu Val Glu Val Val Gln Ala

290 295 300

Thr Val Glu Ala Glu Lys Leu Ala Gly Asn Ala Ser Trp Gly Glu Ile

305 310 315 320

Phe Ser Thr Lys Thr Lys Val Phe Gln Arg Leu Ile Met Gly Ala Met

325 330 335

Ile Gln Ser Leu Gln Gln Leu Thr Gly Asp Asn Tyr Phe Phe Tyr Tyr

340 345 350

Gly Thr Thr Val Phe Thr Ala Val Gly Leu Glu Asp Ser Phe Glu Thr

355 360 365

Ser Ile Val Leu Gly Ile Val Asn Phe Ala Ser Thr Phe Val Gly Ile

370 375 380

Phe Leu Val Glu Arg Tyr Gly Arg Arg Arg Cys Leu Leu Trp Gly Ala

385 390 395 400

Ala Ser Met Thr Ala Cys Met Val Val Phe Ala Ser Val Gly Val Thr

405 410 415

Arg Leu Trp Pro Asn Gly Lys Lys Asn Gly Ser Ser Lys Gly Ala Gly

420 425 430

Asn Cys Met Ile Val Phe Thr Cys Phe Tyr Leu Phe Cys Phe Ala Thr

435 440 445

Thr Trp Ala Pro Ile Pro Phe Val Val Asn Ser Glu Thr Phe Pro Leu

450 455 460

Arg Val Lys Ser Lys Cys Met Ala Ile Ala Gln Ala Cys Asn Trp Ile

465 470 475 480

Trp Gly Phe Leu Ile Gly Phe Phe Thr Pro Phe Ile Ser Gly Ala Ile

485 490 495

Asp Phe Tyr Tyr Gly Tyr Val Phe Met Gly Cys Leu Val Phe Ser Tyr

500 505 510

Phe Tyr Val Phe Phe Phe Val Pro Glu Thr Lys Gly Leu Thr Leu Glu

515 520 525

Glu Val Asn Thr Leu Trp Glu Glu Gly Val Leu Pro Trp Lys Ser Pro

530 535 540

Ser Trp Val Pro Pro Asn Lys Arg Gly Thr Asp Tyr Asn Ala Asp Asp

545 550 555 560

Leu Met His Asp Gly Ser Thr His Phe Thr Arg Arg Cys Ser Glu Lys

565 570 575

Ser Arg Ser Val Asn

580

<210> SEQ ID NO: 156

<211> LENGTH: 592

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: MISC_FEATURE

<222> LOCATION: (1)..(592)

<223> OTHER INFORMATION: Hxt5 (Fig. 10)

<400> SEQENCE: 156

Met Ser Glu Leu Glu Asn Ala His Gln Gly Pro Leu Glu Gly Ser Ala

1 5 10 15

Thr Val Ser Thr Asn Ser Asn Ser Tyr Asn Glu Lys Ser Gly Asn Ser

20 25 30

Thr Ala Pro Gly Thr Ala Gly Tyr Asn Asp Asn Leu Ala Gln Ala Lys

35 40 45

Pro Val Ser Ser Tyr Ile Ser His Glu Gly Pro Pro Lys Asp Glu Leu

50 55 60

Glu Glu Leu Gln Lys Glu Val Asp Lys Gln Leu Glu Lys Lys Ser Lys

65 70 75 80

Ser Asp Leu Leu Phe Val Ser Val Cys Cys Leu Met Val Ala Phe Gly

85 90 95

Gly Phe Val Phe Gly Trp Asp Thr Gly Thr Ile Ser Gly Phe Val Arg

100 105 110

Gln Thr Asp Phe Ile Arg Arg Phe Gly Ser Thr Arg Ala Asn Gly Thr

115 120 125

Thr Tyr Leu Ser Asp Val Arg Thr Gly Leu Met Val Ser Ile Phe Asn

130 135 140

Ile Gly Cys Ala Ile Gly Gly Ile Val Leu Ser Lys Leu Gly Asp Met

145 150 155 160

Tyr Gly Arg Lys Ile Gly Leu Met Thr Val Val Val Ile Tyr Ser Ile

165 170 175

Gly Ile Ile Ile Gln Ile Ala Ser Ile Asp Lys Trp Tyr Gln Tyr Phe

180 185 190

Ile Gly Arg Ile Ile Ser Gly Leu Gly Val Gly Gly Ile Thr Val Leu

195 200 205

Ala Pro Met Leu Ile Ser Glu Val Ser Pro Lys Gln Leu Arg Gly Thr

210 215 220

Leu Val Ser Cys Tyr Gln Leu Met Ile Thr Phe Gly Ile Phe Leu Gly

225 230 235 240

Tyr Cys Thr Asn Phe Gly Thr Lys Asn Tyr Ser Asn Ser Val Gln Trp

245 250 255

Arg Val Pro Leu Gly Leu Cys Phe Ala Trp Ser Ile Phe Met Ile Val

260 265 270

Gly Met Thr Phe Val Pro Glu Ser Pro Arg Tyr Leu Val Glu Val Gly

275 280 285

Lys Ile Glu Glu Ala Lys Arg Ser Leu Ala Arg Ala Asn Lys Thr Thr

290 295 300

Glu Asp Ser Pro Leu Val Thr Leu Glu Met Glu Asn Tyr Gln Ser Ser

305 310 315 320

Ile Glu Ala Glu Arg Leu Ala Gly Ser Ala Ser Trp Gly Glu Leu Val

325 330 335

Thr Gly Lys Pro Gln Met Phe Arg Arg Thr Leu Met Gly Met Met Ile

340 345 350

Gln Ser Leu Gln Gln Leu Thr Gly Asp Asn Tyr Phe Phe Tyr Tyr Gly

355 360 365

Thr Thr Ile Phe Gln Ala Val Gly Leu Glu Asp Ser Phe Glu Thr Ala

370 375 380

Ile Val Leu Gly Val Val Asn Phe Val Ser Thr Phe Phe Ser Leu Tyr

385 390 395 400

Thr Val Asp Arg Phe Gly Arg Arg Asn Cys Leu Leu Trp Gly Cys Val

405 410 415

Gly Met Ile Cys Cys Tyr Val Val Tyr Ala Ser Val Gly Val Thr Arg

420 425 430

Leu Trp Pro Asn Gly Gln Asp Gln Pro Ser Ser Lys Gly Ala Gly Asn

435 440 445

Cys Met Ile Val Phe Ala Cys Phe Tyr Ile Phe Cys Phe Ala Thr Thr

450 455 460

Trp Ala Pro Val Ala Tyr Val Leu Ile Ser Glu Ser Tyr Pro Leu Arg

465 470 475 480

Val Arg Gly Lys Ala Met Ser Ile Ala Ser Ala Cys Asn Trp Ile Trp

485 490 495

Gly Phe Leu Ile Ser Phe Phe Thr Pro Phe Ile Thr Ser Ala Ile Asn

500 505 510

Phe Tyr Tyr Gly Tyr Val Phe Met Gly Cys Met Val Phe Ala Tyr Phe

515 520 525

Tyr Val Phe Phe Phe Val Pro Glu Thr Lys Gly Leu Thr Leu Glu Glu

530 535 540

Val Asn Glu Met Tyr Glu Glu Asn Val Leu Pro Trp Lys Ser Thr Lys

545 550 555 560

Trp Ile Pro Pro Ser Arg Arg Thr Thr Asp Tyr Asp Leu Asp Ala Thr

565 570 575

Arg Asn Asp Pro Arg Pro Phe Tyr Lys Arg Met Phe Thr Lys Glu Lys

580 585 590

<210> SEQ ID NO: 157

<211> LENGTH: 570

<212> TYPE: PRT

<213> ORGANISM: Saccharomyces cerevisiae

<220> FEATURE:

<221> NAME/KEY: MISC_FEATURE

<222> LOCATION: (1)..(570)

<223> OTHER INFORMATION: Hxt6/7 (Fig. 10)

<400> SEQENCE: 157

Met Ser Gln Asp Ala Ala Ile Ala Glu Gln Thr Pro Val Glu His Leu

1 5 10 15

Ser Ala Val Asp Ser Ala Ser His Ser Val Leu Ser Thr Pro Ser Asn

20 25 30

Lys Ala Glu Arg Asp Glu Ile Lys Ala Tyr Gly Glu Gly Glu Glu His

35 40 45

Glu Pro Val Val Glu Ile Pro Lys Arg Pro Ala Ser Ala Tyr Val Thr

50 55 60

Val Ser Ile Met Cys Ile Met Ile Ala Phe Gly Gly Phe Val Phe Gly

65 70 75 80

Trp Asp Thr Gly Thr Ile Ser Gly Phe Ile Asn Gln Thr Asp Phe Ile

85 90 95

Arg Arg Phe Gly Met Lys His Lys Asp Gly Thr Asn Tyr Leu