Great research starts with great data.

Learn More
More >
Patent Analysis of

Sorghum-derived transcription regulatory elements predominantly active in root hair cells and uses thereof

Updated Time 12 June 2019

Patent Registration Data

Publication Number

US10000762

Application Number

US14/717477

Application Date

20 May 2015

Publication Date

19 June 2018

Current Assignee

THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY OF AGRICULTURE

Original Assignee (Applicant)

THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY OF AGRICULTURE

International Classification

C12N15/82

Cooperative Classification

C12N15/8227

Inventor

BAERSON, SCOTT R.,PAN, ZHIQIANG,POLASHOCK, JAMES J

Patent Images

This patent contains figures and images illustrating the invention and its embodiment.

US10000762 Sorghum-derived transcription regulatory elements predominantly 1 US10000762 Sorghum-derived transcription regulatory elements predominantly 2 US10000762 Sorghum-derived transcription regulatory elements predominantly 3
See all images <>

Abstract

Transcription regulatory elements, namely promoter and terminator sequences, obtained from Sorghum bicolor that drive RNA transcription predominately in root hair cells are described, as well as cassettes, expression vectors, and genetically modified plants containing these transcription regulatory elements. The genetically modified plants can be gymnosperms, dicots, or monocots. Methods of directing transcription of a heterologous polynucleotide under control of these transcription regulatory elements in a genetically modified plant's root hair cells are also provided.

Read more

Claims

1. A cassette comprising a promoter operably linked to a heterologous polynucleotide; wherein said promoter comprises SEQ ID NO: 7; wherein said promoter is capable of regulating transcription of said heterologous polynucleotide in a plant cell; and wherein said heterologous polynucleotide encodes a protein or RNA.

2. The cassette of claim 1, wherein said promoter is active predominantly in a plant's root hair cells.

3. The cassette of claim 1, wherein said protein or RNA confers improved disease resistance to a genetically altered plant comprising said cassette and producing said protein or RNA.

4. The cassette of claim 1, wherein said protein or RNA confers enhanced nutrient uptake into root hair cells of a genetically altered plant comprising said cassette and producing said protein or RNA.

5. The cassette of claim 1, wherein said protein or RNA confers improved resistance to colonization by soil-borne parasites to a genetically altered plant comprising said cassette and producing said protein or RNA.

6. The cassette of claim 1, wherein said protein or RNA promotes colonization of beneficial rhizosphere-associated microorganisms to the root system of a genetically altered plant comprising said cassette and producing said protein or RNA.

7. The cassette of claim 1, wherein said protein or RNA confers improved stress tolerance to a genetically altered plant comprising said cassette and producing said protein or RNA.

8. The cassette of claim 1, wherein said protein or RNA confers enhanced water uptake into root hair cells of a genetically altered plant comprising said cassette and producing said protein or RNA.

9. The cassette of claim 1, wherein said protein or RNA is useful in bioremediation mediated by root hair cells of a genetically altered plant comprising said cassette and producing said protein or RNA.

10. The cassette of claim 1, wherein said protein or RNA promotes allelochemical production by root hair cells of a genetically altered plant comprising said cassette and producing said protein or RNA.

11. The cassette of claim 1, wherein said protein or RNA increases nitrogen fixation mediated by root hair cells of a genetically altered plant comprising said cassette and producing said protein or RNA.

12. The cassette of claim 1, further comprising a terminator operably linked to the 3′ end of said heterologous polynucleotide; wherein said terminator has a DNA sequence selected from the group consisting of SEQ ID NO: 2, 4, 6, and 8 or a sequence that is at least 95% identical to SEQ ID NO: 2, 4, 6, and 8.

13. The cassette of claim 12, wherein said promoter is active predominantly in a plant's root hair cells.

14. The cassette of claim 12, wherein said protein or RNA confers improved disease resistance to a genetically altered plant comprising said cassette and producing said protein or RNA.

15. The cassette of claim 12, wherein said protein or RNA confers enhanced nutrient uptake into root hair cells of a genetically altered plant comprising said cassette and producing said protein or RNA.

16. The cassette of claim 12, wherein said protein or RNA confers improved resistance to colonization by soil-borne parasites to the root system of a genetically altered plant comprising said cassette and producing said protein or RNA.

17. The cassette of claim 12, wherein said protein or RNA promotes colonization of rhizosphere-associated microorganisms to the root system of a genetically altered plant comprising said cassette and producing said protein or RNA.

18. The cassette of claim 12, wherein said protein or RNA confers improved stress tolerance to a genetically altered plant comprising said cassette and producing said protein or RNA.

19. The cassette of claim 12, wherein said protein or RNA confers enhanced water uptake into root hair cells of a genetically altered plant comprising said cassette and producing said protein or RNA.

20. The cassette of claim 12, wherein said protein or RNA is useful in bioremediation mediated by root hair cells of a genetically altered plant comprising said cassette and producing said protein or RNA.

21. The cassette of claim 12, wherein said protein or RNA promotes allelochemical production by root hair cells of a genetically altered plant comprising said cassette and producing said protein or RNA.

22. The cassette of claim 12, wherein said protein or RNA increases nitrogen fixation mediated by root hair cells of a genetically altered plant comprising said cassette and producing said protein or RNA.

23. A genetically altered plant, part thereof, or its progeny comprising a cassette, wherein said cassette comprises a promoter operably linked to a heterologous polynucleotide; wherein said promoter comprises SEQ ID NO: 7; wherein said promoter is capable of regulating transcription of said heterologous polynucleotide in a plant cell; and wherein said heterologous polynucleotide encodes a protein or RNA.

24. The genetically altered plant, part thereof, or its progeny of claim 23 wherein said plant is selected from the group consisting of a gymnosperm, monocot, and dicot; and wherein said genetically altered plant, plant part or progeny comprises the cassette.

25. A genetically altered seed of said genetically altered plant or its progeny of claim 23; wherein said genetically altered seed comprises the cassette.

26. A genetically altered pollen of said genetically altered plant or its progeny of claim 23; wherein said genetically altered pollen comprises the cassette.

27. A genetically altered cell of said genetically altered plant or its progeny of claim 23; wherein said genetically altered cell comprises the cassette.

28. A genetically altered tissue culture comprising a plurality of said genetically altered cells of claim 27.

29. A genetically altered plant, part thereof, or its progeny comprising a cassette wherein said cassette comprises a promoter, a heterologous polynucleotide, and a terminator, wherein said promoter is operably linked to the 5′ end of said heterologous polynucleotide; wherein said terminator is operably linked to the 3′ end of said heterologous polynucleotide; wherein said promoter comprises SEQ ID NO: 7; wherein said terminator has a sequence selected from the group consisting of SEQ ID NO: 2, 4, 6, 8, and a sequence that is at least 95% identical thereof; and wherein said heterologous polynucleotide encodes a protein or RNA.

30. The genetically altered plant, part thereof, or its progeny of claim 29 wherein said plant is selected from the group consisting of a gymnosperm, monocot, and dicot; and wherein said genetically altered plant, plant part or progeny comprises the cassette.

31. A genetically altered cell from the genetically altered plant of claim 29; wherein said genetically altered cell comprises the cassette of claim 29.

32. A genetically altered tissue culture comprising a plurality of said genetically altered cells of claim 31.

33. A genetically altered seed from the genetically altered plant or its progeny of claim 29; wherein said genetically altered seed comprises the cassette.

34. A genetically altered pollen from the genetically altered plant or its progeny of claim 29; wherein said genetically altered pollen comprises the cassette.

35. A method of selectively directing transcription of a heterologous polynucleotide in root hair cells of a genetically altered plant and its progeny, said method comprising:(i) introducing a cassette into a wild-type plant cell to produce a genetically altered plant cell; wherein said cassette comprises a promoter and a heterologous polynucleotide; wherein said promoter is operably linked to the 5′ end of said heterologous polynucleotide; wherein said promoter comprises SEQ ID NO: 7; and wherein said promoter selectively directs transcription of said heterologous polynucleotide in said genetically altered plant's root hair cell; and(ii) selecting a genetically altered plant cell that contains said cassette;(iii) growing said genetically altered plant cell into said genetically altered plant; wherein said heterologous polynucleotide is transcribed predominantly in said root hair cells of said genetically altered plant.

36. The method of claim 35; wherein said introducing said cassette occurs via transforming said wild-type plant cell with said cassette.

37. The method of claim 35; wherein said wild-type plant is selected from the group consisting of a gymnosperm, monocot, and dicot.

38. The method of claim 35; wherein said cassette further comprises a terminator operably linked to the 3′ end of said heterologous polynucleotide, and wherein said terminator has a polynucleotide sequence selected from the group consisting of SEQ ID NO: 2, 4, 6, 8, and a sequence that is at least 95% identical thereto.

39. The method of claim 38; wherein said introducing said cassette occurs via transforming said wild-type plant cell with said cassette.

40. The method of claim 38; wherein said genetically altered plant is selected from the group of a gymnosperm, monocot, and dicot.

41. A method of producing a protein or RNA of interest predominantly in root hair cells of a genetically altered plant, said method comprising(i) introducing a cassette into a wild-type plant cell to produce a genetically altered plant cell; wherein said cassette comprises a promoter and a heterologous polynucleotide encoding said protein or RNA of interest; wherein said promoter is operably linked to said heterologous polynucleotide encoding said protein or RNA of interest; wherein said promoter comprises SEQ ID NO: 7; and wherein said promoter predominantly transcribes said heterologous polynucleotide encoding said protein or RNA of interest in a plant's root hair cell;(ii) selecting a genetically altered plant cell that contains said cassette; and(iii) allowing said genetically altered plant cell to grow into a genetically altered plant that produces said protein or RNA of interest in said genetically altered plant's root hair cells.

42. The method of claim 41, wherein said introducing said cassette occurs via transforming said wild-type plant cell with said cassette.

43. The method of claim 41 wherein said genetically altered plant is selected from the group of a gymnosperm, monocot, and dicot.

44. The method of claim 41; wherein said cassette further comprises a terminator operably linked to the 3′ end of said heterologous polynucleotide, and wherein said terminator has a polynucleotide sequence selected from the group consisting of SEQ ID NO: 2, 4, 6, 8, and a sequence that is at least 95% identical thereto.

45. The method of claim 44; wherein said introducing said cassette occurs via transforming said wild-type plant cell with said cassette.

46. The method of claim 44; wherein said genetically altered plant is selected from the group consisting of a gymnosperm, monocot, and dicot.

Read more

Claim Tree

  • 1
    1. A cassette comprising
    • a promoter operably linked to a heterologous polynucleotide
    • wherein said promoter comprises SEQ ID NO: 7
    • wherein said promoter is capable of regulating transcription of said heterologous polynucleotide in a plant cell
    • and wherein said heterologous polynucleotide encodes a protein or RNA.
    • 2. The cassette of claim 1, wherein
      • said promoter is active predominantly in a plant's root hair cells.
    • 3. The cassette of claim 1, wherein
      • said protein or RNA confers improved disease resistance to a genetically altered plant comprising
    • 4. The cassette of claim 1, wherein
      • said protein or RNA confers enhanced nutrient uptake into root hair cells of a genetically altered plant comprising
    • 5. The cassette of claim 1, wherein
      • said protein or RNA confers improved resistance to colonization by soil-borne parasites to a genetically altered plant comprising
    • 6. The cassette of claim 1, wherein
      • said protein or RNA promotes colonization of beneficial rhizosphere-associated microorganisms to the root system of a genetically altered plant comprising
    • 7. The cassette of claim 1, wherein
      • said protein or RNA confers improved stress tolerance to a genetically altered plant comprising
    • 8. The cassette of claim 1, wherein
      • said protein or RNA confers enhanced water uptake into root hair cells of a genetically altered plant comprising
    • 9. The cassette of claim 1, wherein
      • said protein or RNA is useful in bioremediation mediated by root hair cells of a genetically altered plant comprising
    • 10. The cassette of claim 1, wherein
      • said protein or RNA promotes allelochemical production by root hair cells of a genetically altered plant comprising
    • 11. The cassette of claim 1, wherein
      • said protein or RNA increases nitrogen fixation mediated by root hair cells of a genetically altered plant comprising
    • 12. The cassette of claim 1, further comprising
      • a terminator operably linked to the 3′ end of said heterologous polynucleotide
      • wherein said terminator has a DNA sequence selected from the group consisting of SEQ ID NO: 2, 4, 6, and 8 or a sequence that is at least 95% identical to SEQ ID NO: 2, 4, 6, and 8.
  • 23
    23. A genetically altered plant, part thereof, or its progeny comprising
    • a cassette, wherein said cassette comprises a promoter operably linked to a heterologous polynucleotide
    • wherein said promoter comprises SEQ ID NO: 7
    • wherein said promoter is capable of regulating transcription of said heterologous polynucleotide in a plant cell
    • and wherein said heterologous polynucleotide encodes a protein or RNA.
    • 24. The genetically altered plant, part thereof, or its progeny of claim 23 wherein
      • said plant is selected from the group consisting of
    • 25. A genetically altered seed of said genetically altered plant or its progeny of claim 23; wherein
      • said genetically altered seed comprises
    • 26. A genetically altered pollen of said genetically altered plant or its progeny of claim 23; wherein
      • said genetically altered pollen comprises
    • 27. A genetically altered cell of said genetically altered plant or its progeny of claim 23; wherein
      • said genetically altered cell comprises
  • 28
    28. A genetically altered tissue culture comprising
    • a plurality of said genetically altered cells of claim 27.
  • 29
    29. A genetically altered plant, part thereof, or its progeny comprising
    • a cassette wherein said cassette comprises a promoter, a heterologous polynucleotide, and a terminator, wherein said promoter is operably linked to the 5′ end of said heterologous polynucleotide
    • wherein said terminator is operably linked to the 3′ end of said heterologous polynucleotide
    • wherein said promoter comprises SEQ ID NO: 7
    • wherein said terminator has a sequence selected from the group consisting of SEQ ID NO: 2, 4, 6, 8, and a sequence that is at least 95% identical thereof
    • and wherein said heterologous polynucleotide encodes a protein or RNA.
    • 30. The genetically altered plant, part thereof, or its progeny of claim 29 wherein
      • said plant is selected from the group consisting of
    • 31. A genetically altered cell from the genetically altered plant of claim 29; wherein
      • said genetically altered cell comprises
    • 33. A genetically altered seed from the genetically altered plant or its progeny of claim 29; wherein
      • said genetically altered seed comprises
    • 34. A genetically altered pollen from the genetically altered plant or its progeny of claim 29; wherein
      • said genetically altered pollen comprises
  • 32
    32. A genetically altered tissue culture comprising
    • a plurality of said genetically altered cells of claim 31.
  • 35
    35. A method of selectively directing transcription of a heterologous polynucleotide in root hair cells of a genetically altered plant and its progeny, said method comprising:
    • (i) introducing a cassette into a wild-type plant cell to produce a genetically altered plant cell
    • wherein said cassette comprises a promoter and a heterologous polynucleotide
    • wherein said promoter is operably linked to the 5′ end of said heterologous polynucleotide
    • wherein said promoter comprises SEQ ID NO: 7
    • and wherein said promoter selectively directs transcription of said heterologous polynucleotide in said genetically altered plant's root hair cell
    • and(ii) selecting a genetically altered plant cell that contains said cassette
    • (iii) growing said genetically altered plant cell into said genetically altered plant
    • wherein said heterologous polynucleotide is transcribed predominantly in said root hair cells of said genetically altered plant.
    • 36. The method of claim 35; wherein
      • said introducing said cassette occurs via transforming said wild-type plant cell with said cassette.
    • 37. The method of claim 35; wherein
      • said wild-type plant is selected from the group consisting of
    • 38. The method of claim 35; wherein
      • said cassette further comprises
  • 41
    41. A method of producing a protein or RNA of interest predominantly in root hair cells of a genetically altered plant, said method comprising
    • (i) introducing a cassette into a wild-type plant cell to produce a genetically altered plant cell
    • wherein said cassette comprises a promoter and a heterologous polynucleotide encoding said protein or RNA of interest
    • wherein said promoter is operably linked to said heterologous polynucleotide encoding said protein or RNA of interest
    • wherein said promoter comprises SEQ ID NO: 7
    • and wherein said promoter predominantly transcribes said heterologous polynucleotide encoding said protein or RNA of interest in a plant's root hair cell
    • (ii) selecting a genetically altered plant cell that contains said cassette
    • and(iii) allowing said genetically altered plant cell to grow into a genetically altered plant that produces said protein or RNA of interest in said genetically altered plant's root hair cells.
    • 42. The method of claim 41, wherein
      • said introducing said cassette occurs via transforming said wild-type plant cell with said cassette.
    • 43. The method of claim 41 wherein
      • said genetically altered plant is selected from the group of a gymnosperm, monocot, and dicot.
    • 44. The method of claim 41; wherein
      • said cassette further comprises
See all independent claims <>

Description

BACKGROUND OF THE INVENTION

Field of the Invention

This invention relates to expression vectors containing transcription regulatory elements are active in root hair cells in gymnosperms, dicots, and monocots. This invention also relates to genetically altered plants that contain an expression vector containing a heterologous polynucleotide operably linked at the 3′ end and 5′ end to these transcription regulatory elements.

Description of Related Art

Genetically altered plants are being used to solve various agricultural problems, environmental, pest infestation, low yield, etc. One method of generating genetically altered plants, one operably links a promoter with a polynucleotide encoding the gene of interest and introduces the heterologous DNA into a wild-type plant to generate the desired genetically altered plant. Of course one may need to screen the transformed plants to select the genetically altered plant, and the genetically altered plant's progeny, for the desired trait/gene product.

A variety of different types or classes of promoters can be used in genetically altered plants. Promoters can be classified on the basis of characteristics, such as temporal or developmental range, levels of transgene expression, or tissue specificity. For example, a constitutive promoter continuously expresses a gene with minimal regulation. Therefore, promoters referred to as constitutive promoters are capable of transcribing operably linked polynucleotides efficiently and expressing those polynucleotides in multiple tissues.

Numerous promoters, which are active in plant cells, have been described in the literature. Non-exhaustive examples include the nopaline synthase (nos) promoter and octopine synthase (ocs) promoter which are carried on tumor-inducing plasmids of Agrobacterium tumefaciens (also known as Rhizobium radiobacter), and the caulimovirus promoters such as the Cauliflower Mosaic Virus (CaMV) 19S or 35S promoter (U.S. Pat. No. 5,352,605), CaMV 35S promoter with a duplicated enhancer (CaMVE35S, U.S. Pat. Nos. 5,164,316; 5,196,525; 5,322,938; 5,359,142; and 5,424,200), and the Figwort Mosaic Virus (FMV) 35S promoter (U.S. Pat. No. 5,378,619). These promoters and numerous others have been used in the creation of constructs for transgene expression (expression of heterologous DNA) in plants. Other useful promoters for expression of heterologous DNA are described, for example, in U.S. Pat. Nos. 5,391,725; 5,428,147; 5,447,858; 5,608,144; 5,614,399; 5,633,441; 6,232,526; and 5,633,435.

While previous work has provided a number of promoters useful to direct transcription in genetically altered plants, there is still a great need for novel promoters with beneficial expression characteristics. In particular, there is a need for promoters that are capable of directing expression of heterologous genes or polynucleotides in the root hair cells of genetically altered plants.

Plant technologies which target the root-soil interface or surrounding rhizosphere via genetic engineering require transcription regulatory elements capable of directing accurate and high-level expression of heterologous polynucleotides within root hair cells. Moreover, the use of root hair-specific transcription elements could circumvent adverse effects, such as, but not limited to, potential reductions in crop yield resulting from non-cell type-specific expression of inhibitory gene products.

A plant's root hairs account for a majority of the total surface area of the plant's root systems, and represent the primary sites for nutrient (including mineral) and water uptake, interactions with soil microbes, as well as infection by nitrogen-fixing rhizobia leading to nodulation in legumes. See, e.g., Grierson and Schiefelbein, Root Hairs pp. 1-22 in The Arabidopsis Book, Somerville and Meyerowitz (eds.), American Society of Plant Biologists, Rockville, Md. (2002) (doi/10.1199/tab.0032; www.aspb.org/publications/arabidopsis); and Libault, et al., Trends Plant Sci. 15:641-650 (2010). Thus, numerous biotechnological applications exist for highly active root hair-specific gene promoters, and other polynucleotide sequences influencing steady-state transcript levels within these cells.

A number of studies have involved functional characterization of root hair promoters using promoter:reporter gene fusion constructs (cassettes or expression vectors). See, e.g., Kim, et al., Plant Cell. 18:2958-2970 (2006); Won, et al., Plant Physiol. 150:1459-1473 (2009); and Zhiming, et al., Plant J. February 11. doi:10.1111/j. (2011). However, these studies' goal was the elucidation of regulatory networks involved in root hair transcription, or the physiological role of the associated gene product, rather than identifying highly active promoters for driving heterologous DNA expression.

The root hairs of Sorghum spp. represent a particularly intriguing experimental system, which, to all appearances, serve as high-throughput production “facilities” for allelochemical biosynthesis and rhizosecretion, in addition to the above-mentioned functions (Weston, et al., J. Chem. Ecol. 39:142-153 (2013); Baerson, et al., J. Biol. Chem. 283:3231-3247 (2008)). A prior gene ontology analysis of genes expressed in Sorghum bicolor genotype BTx623 root hair cells revealed that a major proportion of transcriptional activity was associated with “metabolism” (approximately 11.2% of all functions assigned), consistent with previous ultrastructural studies suggesting a high level of metabolic activity for this cell type, likely associated with exudate production and membrane biogenesis (Parker, et al., Plant Cell 12:1961-1974 (2000); Czarnota, et al., Weed Technol. 15:813-825 (2001); Czarnota, et al., Int. J. Plant Sci. 164:861-866 (2003); Baerson, et al. (2008)). Not surprisingly “cellular transport, transport mechanisms, and transport facilitation” was also identified as one of the major functional categories (approximately 7.9% of all functions assigned), given the pivotal role played by root hair cells in soil mineral and organic nutrient uptake (Cutter, The Epidermis in Plant Anatomy pp. 94-106, Clowes & Sons (London, England) (1978); Grierson and Schiefelbein (2002); Libault, et al. (2010)), and the additional specialization required of root hair cells of Sorghum spp. which synthesize and secrete large quantities of the allelochemical sorgoleone into the surrounding rhizosphere (Bertin, et al., Plant Soil 256:67-83 (2003); Weston, et al. (2013)).

As more genetically altered plants are developed in response to diseases and the need to increase yield for food products, a need exists for transcription regulatory elements capable of directing strong root hair-specific transgene expression. This invention is directed at promoters, used with or without specific 3′ flanking regions (terminators), which direct high-level root hair-specific expression of heterologous DNA in both monocotyledonous plants and dicotyledonous plants and the methods of using the same. The regulatory elements described herein deliver recombinant gene products to root hairs at significantly higher levels than is possible using prior art promoters. See, e.g., Kim, et al. (2006); Won, et al. (2009); and Zhiming, et al. (2011).

BRIEF DESCRIPTION OF THE INVENTION

It is an object of this invention to provide transcription regulatory elements (promoters and terminators) that are predominantly active in plant root hair cells. It is a further object of this invention that these transcription regulatory elements, and in particular, the promoters, are selectively active or selectively direct transcription only in root hair cells of a plant. It is a further object of this invention to have DNA that contain one or more of the promoters and that the promoters have a polynucleotide sequence of SEQ ID NO: 1, 3, 5, 7, 12, 16, 20, and 24, or a sequence that is at least 95% identical to SEQ ID NO: 1, 3, 5, 7, 12, 16, 20, and 24. It is another object of this invention to have DNA that contain one or more of the terminators (or 3′ flanking sequences) and that the terminators have a polynucleotide sequence of SEQ ID NO: 2, 4, 6, 8, 13, 17, 21, and 25, or a sequence that is at least 95% identical to SEQ ID NO: 2, 4, 6, 8, 13, 17, 21, and 25.

It is another object of this invention to have expression vectors and/or cassettes that contain one or more of the promoters described herein (SEQ ID NO: 1, 3, 5, 7, 12, 16, 20, and 24, or a sequence at least 95% identical to SEQ ID NO: 1, 3, 5, 7, 12, 16, 20, and 24) operably linked to a heterologous polynucleotide which encodes a gene of interest. Such an expression vector and/or cassette will predominantly express or selectively direct transcription of the gene of interest in a genetically altered plant's root hair cells. It is an optional object of this invention that the expression vector and/or cassette also contains one or more terminators described herein (SEQ ID NO: 2, 4, 6, 8, 13, 17, 21, and 25, or a sequence that is at least 95% identical to SEQ ID NO: 2, 4, 6, 8, 13, 17, 21, and 25) operably linked to the 3′ end of the heterologous polynucleotide. It is an optional object of this invention that the expression vector and/or cassette contains a prior art terminator instead of the terminators described herein. It is a further object of this invention that the heterologous polynucleotide (or gene of interest) improves disease resistance, enhances nutrient uptake, improves resistance to colonization by soil-borne parasites, enhances colonization of beneficial rhizosphere-associated microorganisms, improves stress tolerance, enhances water uptake, promotes bioremediation, reduces competition from neighboring plants via allelochemical production, enhances nitrogen fixation (increased efficacy of nitrogen fixation), or imparts any other desired phenotypic traits to the root hair cells in a genetically altered plant containing the expression vector and/or cassette. Also, the expression of the gene of interest predominantly in the root hair cells can affect the entire genetically altered plant.

It is an object of this invention to have a genetically altered plant, parts of the genetically altered plant, and progeny of the genetically altered plant that contain an expression vector or a cassette that contains one or more of the promoters described herein (SEQ ID NO: 1, 3, 5, 7, 12, 16, 20, and 24, or a sequence at least 95% identical to SEQ ID NO: 1, 3, 5, 7, 12, 16, 20, and 24) operably linked to a heterologous polynucleotide which encodes a gene of interest. It is an optional object of this invention that the expression vector and/or cassette also contains one or more of terminators described herein (SEQ ID NO: 2, 4, 6, 8, 13, 17, 21, and 25, or a sequence that is at least 95% identical to SEQ ID NO: 2, 4, 6, 8, 13, 17, 21, and 25) operably linked to the 3′ end of the heterologous polynucleotide. It is an optional object of this invention that the expression vector and/or cassette contains a prior art terminator instead of the terminators described herein. It is a further object of this invention that the heterologous polynucleotide (or gene of interest) improves disease resistance, enhances nutrient uptake, improves resistance to colonization by soil-borne parasites, enhances colonization of beneficial rhizosphere-associated microorganisms, improves stress tolerance, enhances water uptake, promotes bioremediation, reduces competition from neighboring plants via allelochemical production, enhances nitrogen fixation (increased efficacy of nitrogen fixation), or otherwise imparts any other desired phenotypic traits to the root hair cells in a genetically altered plant, parts thereof and progeny. It is another object of this invention that the plant can be a gymnosperm plant, monocot plant or a dicot plant. It is a further object of this invention that the part of the genetically altered plant can be a cell, tissue culture of the cells, pollen, seed, leaf, stem, etc.

It is an object of this invention to selectively direct transcription of a heterologous polynucleotide in the root hair cells of a genetically altered plant, or parts thereof, or its progeny, by (i) introducing an expression vector or a cassette into a wild-type plant, where the expression vector or cassette contains one or more of the promoters described herein (SEQ ID NO: 1, 3, 5, 7, 12, 16, 20, and 24, or a sequence at least 95% identical to SEQ ID NO: 1, 3, 5, 7, 12, 16, 20, and 24) operably linked to a heterologous polynucleotide which encodes a gene of interest, and (ii) selecting a genetically altered plant or part thereof that contains the expression vector or cassette, such that the heterologous polynucleotide is transcribed predominantly in the root hair cells of said genetically altered plant. It is an optional object of this invention that the expression vector or cassette contains one or more of the terminators described herein (SEQ ID NO: 2, 4, 6, 8, 13, 17, 21, and 25, or a sequence that is at least 95% identical to SEQ ID NO: 2, 4, 6, 8, 13, 17, 21, and 25) operably linked at the 3′ end of the heterologous polynucleotide. It is an optional object of this invention that the expression vector and/or cassette contains a prior art terminator instead of the terminators described herein. It is a further object of this invention that the promoter selectively directs transcription of the heterologous polynucleotide in a plant's root hair cell. It is a further object of this invention that the first step of “introducing” is performed by introgression or transformation of a wild-type plant with the expression vector or cassette. It is another object of the invention that the genetically altered plant is a gymnosperm plant, dicot plant, or monocot plant. It is a further object of this invention that the heterologous polynucleotide (or gene of interest) improves disease resistance, enhances nutrient uptake, improves resistance to colonization by soil-borne parasites, enhances colonization of beneficial rhizosphere-associated microorganisms, improves stress tolerance, enhances water uptake, promotes bioremediation, reduces competition from neighboring plants via allelochemical production, enhances nitrogen fixation (increases efficacy of nitrogen fixation), or imparts any other desired phenotypic traits to the root hair cells in the genetically altered plant, parts thereof and progeny.

It is another object of this invention to have a method for producing a gene of interest predominantly in the root hair cells of a genetically altered plant by (i) introducing an expression vector or a cassette into a wild-type plant such that the expression vector or cassette contains at least one of the promoters described herein (SEQ ID NO: 1, 3, 5, 7, 12, 16, 20, and 24, or a sequence at least 95% identical to SEQ ID NO: 1, 3, 5, 7, 12, 16, 20, and 24) operably linked to a polynucleotide encoding the gene of interest, (ii) selecting a genetically altered plant or part thereof that contains the expression vector or cassette, and (iii) allowing the genetically altered plant or part thereof to grow root hair cells so that the gene of interest is produced in the root hair cells of the genetically altered plant because the promoter predominantly transcribes the polynucleotide encoding the gene of interest in a plant's root hair cell. It is an optional object of this invention that the expression vector or cassette contains one or more of the terminators described herein (SEQ ID NO: 2, 4, 6, 8, 13, 17, 21, and 25, or a sequence that is at least 95% identical to SEQ ID NO: 2, 4, 6, 8, 13, 17, 21, and 25) operably linked at the 3′ end of the polynucleotide encoding the gene of interest. It is a further object of this invention that the first step of “introducing” is performed by introgression or transformation of a wild-type plant with the expression vector or cassette. It is another object of the invention that the genetically altered plant is a gymnosperm, dicot or monocot plant. It is an optional object of this invention that the expression vector or cassette contains one or more of the terminators described herein (SEQ ID NO: 2, 4, 6, 8, 13, 17, 21, and 25, or a sequence that is at least 95% identical to SEQ ID NO: 2, 4, 6, 8, 13, 17, 21, and 25) operably linked at the 3′ end of the heterologous polynucleotide. It is an optional object of this invention that the expression vector and/or cassette contains a prior art terminator instead of the terminators described herein. It is a further object of this invention that the heterologous polynucleotide (or gene of interest) improves disease resistance, enhances nutrient uptake, improves resistance to colonization by soil-borne parasites, enhances colonization of beneficial rhizosphere-associated microorganisms, improves stress tolerance, enhances water uptake, promotes bioremediation, reduces competition from neighboring plants via allelochemical production, enhances nitrogen fixation (increases efficacy of nitrogen fixation), or imparts any other desired phenotypic traits to the root hair cells in the genetically altered plant, parts thereof and progeny.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1A through FIG. 1D shows the relative expression determined by quantitative real-time RT-PCR of the 2_32 candidate sequences (FIG. 1A), the 2_36 candidate sequences (FIG. 1B), the 2_23 candidate sequences (FIG. 1C), and the 2_35 candidate sequences (FIG. 1D) in S. bicolor root hair, root, panicle, apex, stem, immature leaf, and mature leaf.

FIG. 2 shows a binary expression vector (p7N-2_32-GUS) constructed for evaluation of the 2_32 promoten:GUSPlus::2_32-3′ cassette, where “2_32 Pro” is promoter, “GUSPlus” is 0-glucuronidase, “bar” is neomycin phosphotransferase plant-selectable marker, “2_32 Ter” is 3′ flanking region, “NOS pro” is nopaline synthase promoter, “T35S” is CaMV 35S terminator, “pVS1 ORI” and “ColE1” are replication origins, “Sm/Sp” is streptomycin/spectinomycin bacterial-selectable marker, “LB” is left border, and “RB” is right border.

FIG. 3 shows a binary expression vector (p7N-2_36-GUS) constructed for evaluation of the 2_36 promoten:GUSPlus::2_36-3′ cassette, where “2_36 Pro” is promoter, “GUSPlus” is 0-glucuronidase, “bar” is neomycin phosphotransferase plant-selectable marker, “2_36 Ter” is 3′ flanking region, “NOS pro” is nopaline synthase promoter, “T35S” is CaMV 35S terminator, “pVS1 ORI” and “ColE1” are replication origins, “Sm/Sp” is streptomycin/spectinomycin bacterial-selectable marker, “LB” is left border, and “RB” is right border.

FIG. 4 shows a binary expression vector (p7N-2_23-GUS) constructed for evaluation of the of 2_23 promoten:GUSPlus::2_23-3′ cassette, where “2_23 Pro” is promoter, “GUSPlus” is β-glucuronidase, “bar” is neomycin phosphotransferase plant-selectable marker, “2_23 Ter” is 3′ flanking region, “NOS pro” is nopaline synthase promoter, “T35S” is CaMV 35S terminator, “pVS1 ORI” and “ColE1” are replication origins, “Sm/Sp” is streptomycin/spectinomycin bacterial-selectable marker, “LB” is left border, and “RB” is right border.

FIG. 5 shows a binary expression vector (p7N-2_35-GUS) constructed for evaluation of the 2_35 promoten:GUSPlus::2_35-3′ cassette, where “2_35 Pro” is promoter, “GUSPlus” is 0-glucuronidase, “bar” is neomycin phosphotransferase plant-selectable marker, “2_35 Ter” is 3′ flanking region, “NOS pro” is nopaline synthase promoter, “T35S” is CaMV 35S terminator, “pVS1 ORI” and “ColE1” are replication origins, “Sm/Sp” is streptomycin/spectinomycin bacterial-selectable marker, “LB” is left border, and “RB” is right border.

FIG. 6A through FIG. 6H show the expression patterns of GUSPlus in roots of genetically altered Oryza sativa (cv. Nipponbare) containing 2_32 promoter and 3′ sequences (FIG. 6A and FIG. 6E), 2_36 promoter and 3′ sequences (FIG. 6B and FIG. 6F), 2_23 promoter and 3′ sequences (FIG. 6C and FIG. 6G), 2_35 promoter and 3′ sequences (FIG. 6D and FIG. 6H). FIG. 6A through FIG. 6D are root segments of the 2-week-old genetically altered rice plants containing root hair-bearing trichoblasts; FIG. 6E though FIG. 6H are root apices of the 2-week-old genetically altered rice plants containing showing immature trichoblasts prior to root hair initiation.

FIG. 7A and FIG. 7B show histochemical localization of GUSPlus reporter gene activity in 10-day-old genetically altered A. thaliana seedlings containing the 2_32 promoten:GUSPlus::2_32-3′ cassette; FIG. 7A shows root hair-bearing trichoblasts, and FIG. 7B shows root apices containing immature trichoblasts prior to root hair initiation. FIG. 7C and FIG. 7D show histochemical localization of GUSPlus reporter gene activity in 10-day-old genetically altered A. thaliana seedlings containing the 2_36 promoter::GUSPlus::2_36-3′ cassette; FIG. 7C shows root hair-bearing trichoblasts, and FIG. 7D shows root apices containing immature trichoblasts prior to root hair initiation.

FIG. 8A and FIG. 8B illustrate the level of β-glucuronidase (GUS) activity in the root system of 2-week-old genetically altered rice seedlings (FIG. 8A) and 10-day-old genetically altered Arabidopsis seedlings (FIG. 8B). The rice and Arabidopsis are individually transformed with either the 2_32 promoten:GUSPlus::2_32-3′ cassette, 2_36 promoten:GUSPlus::2_36-3′ cassette, 2_23 promoten:GUSPlus::2_23-3′ cassette, or 2_35 promoten:GUSPlus::2_35-3′ cassette. GUS activity is measured fluorometrically, and specific activities are calculated based on extract protein concentrations. Box-whisker plots for each genetically altered plant indicate the minimum, first quantile, median, third quantile, and maximum GUS activities observed in populations representing multiple independent transformant lines.

DETAILED DESCRIPTION OF THE INVENTION

One of the goals of generating genetically altered plants is to produce plants with agronomically desirable characteristics or traits. Advances in genetic engineering have provided the requisite tools to transform plants to contain and express genes of interest. The technological advances in plant transformation and regeneration have enabled researchers to take an exogenous polynucleotide, such as a gene from a heterologous or native source, and incorporate that polynucleotide into a plant genome. The gene can then be expressed in a plant cell to exhibit the added characteristic or trait. In one approach, expression of a gene in a plant cell or a plant tissue that does not normally express such a gene may confer a desirable phenotypic effect. In another approach, transcription of a gene or part of a gene in an antisense orientation may produce a desirable effect by preventing or inhibiting expression of an endogenous gene.

The regulatory elements described herein are useful for selectively directing the expression of a heterologous polynucleotide in root hair cells; in particular they cause a heterologous polynucleotide to be transcribed into RNA in root hair cells in gymnosperm, monocot, and dicot plants. The regulatory elements are predominately active in root hair cells. The promoters described herein can be used individually, or in combination with the terminator (or 3′ flank region) sequences described herein or in combination with other terminator sequences. Further, this invention include promoters having a nucleotide sequence that is at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to the promoter sequences described herein and which still are active predominantly in root hair cells. This invention also includes terminators having a nucleotide sequence that is at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to the terminator sequences described herein.

The polynucleotide sequences of the promoters and terminators are as follows:

promoter sequence from 2_23 contig (Sb04g032670) is SEQ ID NO: 1;

3′ sequence (terminator) from 2_23 contig (Sb04g032670) is SEQ ID NO: 2;

promoter sequence from 2_32 contig (Sb05g000390) is SEQ ID NO: 3;

3′ sequence (terminator) from 2_32 contig (Sb05g000390) is SEQ ID NO: 4;

promoter sequence from 2_35 contig (Sb08g001960) is SEQ ID NO: 5;

3′ sequence (terminator) from 2_35 contig (Sb08g001960) is SEQ ID NO: 6;

promoter sequence from 2_36 contig (Sb01g027620) is SEQ ID NO: 7;

3′ sequence (terminator) from 2_36 contig (Sb01g027620) is SEQ ID NO: 8. In addition, the polynucleotide sequence of GUSPlus is SEQ ID NO: 9. See Table 2 for additional information about the contigs discussed herein.

The promoters and 3′ flanking regions (terminator) sequences in the present invention are selected using the steady-state transcript levels of their corresponding genes as a primary criterion, it is hypothesized these transcription regulatory elements are capable of driving significantly higher heterologous gene expression levels in root hair cells than previously characterized transcription regulatory elements. The transcription regulatory elements of this invention have a wide range of biotechnological applications, because they are an important tool for manipulating or regulating heterologous polynucleotide expression within a cell type critical to plant growth and optimal crop yields. Root hair cells are the majority of a plant's interface with its surrounding soil environment. Thus, numerous applications for these transcription regulatory elements exist, such as, but not limited to, expression of heterologous DNA in genetically altered plant for which the gene product (also called “gene of interest”) (i) promotes colonization of beneficial rhizosphere-associated microbes, (ii) is a transporter, channel, or other protein that facilitates more efficient water or nutrient uptake by the genetically altered plant compared to non-genetically altered plant, (iii) increases efficiency of nitrogen fixation in leguminous crops, (iv) is a protein useful in bioremediation (Wang, et al., Nature Biotechnology, 22:893-897 (2004)), (v) inhibits colonization by soil-borne pests such as parasitic nematodes (Huang, et al., Proc. Natl. Acad. Sci. USA 103(39):14302-14306 (2006)), (vi) inhibits competition from neighboring plants by facilitating allelochemical production (Duke, S. O., Trends in Biotechnology 21(5):192-195 (2003); Baerson, et al., Journal of Biological Chemistry, 283:3231-3247 (2008)).

One embodiment of this invention is a cassette containing one of the promoter sequences described herein (SEQ ID NO: 1, 3, 5, or 7); or containing a promoter sequence that are at least 95% identical to SEQ ID NO: 1, 3, 5, or 7; operably linked to a desired polynucleotide encoding a product of interest. Another embodiment of this invention is a cassette containing one of the promoter sequences described herein (SEQ ID NO: 1, 3, 5, 7); or containing a promoter sequence that are at least 95% identical to SEQ ID NO: 1, 3, 5, or 7; operably linked to a desired polynucleotide encoding a product of interest which, in turn, is operably linked to one of the terminator sequences described herein (SEQ ID NO: 2, 4, 6, or 8); or to a terminator sequence which is at least 95% identical to SEQ ID NO: 2, 4, 6, or 8; such that the promoter sequence is upstream of the desired polynucleotide and such that the terminator sequence is downstream of the desired polynucleotide. Another embodiment of this invention is one or more expression vectors or plasmids that contain such a cassette. Another embodiment of this invention is a genetically altered plant, parts thereof or progeny thereof, and/or a genetically altered plant cell that contains one or more of these cassettes or contains one or more expression vectors containing one or more of these cassettes. The genetically altered plant, parts thereof, or progeny; or genetically altered plant cell will preferentially transcribe the desired polynucleotide and produce the desired product in the genetically altered plant's root hair cells.

The promoter sequence(s) and the terminator sequence(s) of this invention are also referred to as transcription regulatory element(s). Further, a “3′” and “3′ flanking” sequence are also referred to as a “terminator” sequence. A “desired polynucleotide” is “heterologous” polynucleotide to the genetically altered plant (parts thereof, and/or cell); that is, the polynucleotide is not normally present in the non-genetically altered plant (wild-type plant), or, the polynucleotide is present in higher amount in the genetically altered plant (parts thereof, and/or cell) compared to the non-genetically altered plant (wild-type plant), or, the polynucleotide is transcribed in the genetically altered plant's root hair cells in a higher amount compared to the amount transcribed in the non-genetically altered plant (wild-type plant). Thus, the “desired polynucleotide” is also referred to as “heterologous polynucleotide” or “heterologous DNA” or “heterologous gene” or “heterologous gene polynucleotide” or “transcribable polynucleotide”. In one embodiment of this invention, the polynucleotide sequences that are operably linked to these transcription regulatory elements in wild-type, non-genetically altered plants and/or plant cells (and which are discussed in Table 2 below) are not considered “heterologous polynucleotides”.

In one embodiment, this invention involves using the transcription regulatory elements (promoter only or a promoter and terminator) described herein and/or cassettes containing these transcription regulatory elements in expression vectors to drive transcription of a heterologous polynucleotide in a genetically altered plant's root hair cells. In another embodiment, this invention also involves making genetically altered plants, parts thereof, and/or cell that contain an expression vector or cassette containing one or more of the transcription regulatory elements described herein operably linked to a heterologous polynucleotide and which will preferentially produce the encoded gene product in the genetically altered plant's root hair cells. A further embodiment of this invention involves genetically altered dicot plants containing a cassette which contains one of the promoters described herein operably linked to a heterologous polynucleotide and which is, in turn, operably linked to one of the terminators described herein or to a different terminator. Another embodiment of this invention involves genetically altered monocot plants containing a cassette which contains one of the promoters described herein operably linked to a heterologous polynucleotide and which is, in turn, operably linked to one of the terminators described herein or to a different terminator. Another embodiment of this invention involves genetically altered gymnosperm plants containing a cassette which contains one of the promoters described herein operably linked to a heterologous polynucleotide and which is, in turn, operably linked to one of the terminators described herein or to a different terminator. The cassette containing the promoter and heterologous polynucleotide and terminator can be located in a genetically altered plant cell's nucleus.

The polynucleotide sequences of the cassettes described in the examples below are as follows: 2_23 promoten:GUSPlus::2_23-3′ cassette is SEQ ID NO: 10; 2_32 promoten:GUSPlus::2_32-3′ cassette is SEQ ID NO: 14; 2_35 promoten:GUSPlus::2_35-3′ cassette is SEQ ID NO: 18; and 2_36 promoten:GUSPlus::2_36-3′ cassette is SEQ ID NO: 22. However, one of ordinary skill in the art understands that one can substitute a polynucleotide sequence encoding a desired protein, RNAi, rRNA, or other product for GUSPlus' polynucleotide sequence in these cassettes (i.e., a heterologous polynucleotide). In fact, it is highly likely that one of ordinary skill in the art would want to exchange GUSPlus' polynucleotide sequence for a heterologous polynucleotide sequence, and one of ordinary skill in the art would have the knowledge of how to construct such a cassette using information contained in the examples below or information that is well-known to one of ordinary skill in the art field.

Furthermore, one of ordinary skill in the art has the knowledge to construct a cassette containing a heterologous polynucleotide which is operably linked to a promoter sequence from one contig described herein (SEQ ID NO: 1, 3, 5, or 7), or a sequence that is at least 95% identical to SEQ ID NO: 1, 3, 5, or 7, and also operably linked to a terminator sequence from a different contig described herein (SEQ ID NO: 2, 4, 6, or 8), or a sequence that is at least 95% identical to SEQ ID NO: 2, 4, 6, or 8, or with a different terminator. Thus, as an example, one could pair the promoter sequence from contig 2_23 with the terminator sequence from contig 2_32, contig 2_35, or contig 2_36 with the desired heterologous polynucleotide sequence. Again, one of ordinary skill in the art would have the knowledge of how to construct such a cassette.

Finally, one of ordinary skill in the art has the knowledge to insert a cassette containing a promoter sequence described herein operably linked to a heterologous polynucleotide sequence operably linked to a terminator sequence described herein into a different expression vector than the plasmid described in Example 1 and then transformed the desired plant or plant cell with the new expression vector and generate a genetically altered plant containing the expression vector containing the desired cassette.

Because this invention involves production of genetically altered plants and involves recombinant DNA techniques, the following definitions are provided to assist in describing this invention. The terms “isolated”, “purified”, or “biologically pure” as used herein, refer to material that is substantially or essentially free from components that normally accompany the material in its native state or when the material is produced. In an exemplary embodiment, purity and homogeneity are determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A nucleic acid or particular bacteria that are the predominant species present in a preparation is substantially purified. In an exemplary embodiment, the term “purified” denotes that a nucleic acid or protein that gives rise to essentially one band in an electrophoretic gel. Typically, isolated nucleic acids or proteins have a level of purity expressed as a range. The lower end of the range of purity for the component is about 60%, about 70% or about 80% and the upper end of the range of purity is about 70%, about 80%, about 90% or more than about 90%.

The term “nucleic acid” as used herein, refers to a polymer of ribonucleotides or deoxyribonucleotides. Typically, “nucleic acid” polymers occur in either single- or double-stranded form, but are also known to form structures comprising three or more strands. The term “nucleic acid” includes naturally occurring nucleic acid polymers as well as nucleic acids comprising known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Exemplary analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, and peptide-nucleic acids (PNAs). “DNA”, “RNA”, “polynucleotides”, “polynucleotide sequence”, “oligonucleotide”, “nucleotide”, “nucleic acid”, “nucleic acid molecule”, “nucleic acid sequence”, “nucleic acid fragment”, and “isolated nucleic acid fragment” are used interchangeably herein.

For nucleic acids, sizes are given in either kilobases (kb) or base pairs (bp). Estimates are typically derived from agarose or acrylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences. For proteins, sizes are given in kilodaltons (kDa) or amino acid residue numbers. Proteins sizes are estimated from gel electrophoresis, from sequenced proteins, from derived amino acid sequences, or from published protein sequences.

Oligonucleotides and polynucleotides that are not commercially available can be chemically synthesized e.g., according to the solid phase phosphoramidite triester method first described by Beaucage and Caruthers, Tetrahedron Letts. 22:1859-1862 (1981), or using an automated synthesizer, as described in Van Devanter et al., Nucleic Acids Res. 12:6159-6168 (1984). Other methods for synthesizing oligonucleotides and polynucleotides are known in the art. Purification of oligonucleotides is by either native acrylamide gel electrophoresis or by anion-exchange HPLC as described in Pearson & Reanier, J. Chrom. 255:137-149 (1983).

The terms “identical” or percent “identity”, in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (e.g., 80%, 85% identity, 90% identity, 99%, or 100% identity), when compared and aligned for maximum correspondence over a designated region as measured using a sequence comparison algorithm or by manual alignment and visual inspection.

The phrase “high percent identical” or “high percent identity”, in the context of two polynucleotides or polypeptides, refers to two or more sequences or subsequences that have at least about 80%, identity, at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. In an exemplary embodiment, a high percent identity exists over a region of the sequences that is at least about 50 residues in length. In another exemplary embodiment, a high percent identity exists over a region of the sequences that is at least about 100 residues in length. In still another exemplary embodiment, a high percent identity exists over a region of the sequences that is at least about 150 residues or more in length. In one exemplary embodiment, the sequences are high percent identical over the entire length of the nucleic acid or protein sequence.

For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Ausubel et al. (eds.), Current Protocols in Molecular Biology, 1995 supplement).

The term “recombinant” when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, organism, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells may express genes/polynucleotides that are not found within the native (non-recombinant or wild-type) form of the cell or express native genes in an otherwise abnormal amount—over-expressed, under-expressed or not expressed at all—compared to the non-recombinant or wild-type cell or organism. In particular, one can alter the genomic DNA of a wild-type plant by molecular biology techniques that are well-known to one of ordinary skill in the art and generate a recombinant plant.

The terms “transgenic”, “transformed”, “transformation”, and “transfection” are similar in meaning to “recombinant”. “Transformation”, “transgenic”, and “transfection” refer to the transfer of a polynucleotide into a host organism or into a cell. Such a transfer of polynucleotides can result in genetically stable inheritance of the polynucleotides or in the polynucleotides remaining extra-chromosomally (not integrated into the chromosome of the cell). Genetically stable inheritance may potentially require the transgenic organism or cell to be subjected for a period of time to one or more conditions which require the transcription of some or all of the transferred polynucleotide in order for the transgenic organism or cell to live and/or grow. Polynucleotides that are transformed into a cell but are not integrated into the host's chromosome remain as an expression vector within the cell. One may need to grow the cell under certain growth or environmental conditions in order for the expression vector to remain in the cell or the cell's progeny. Further, for expression to occur the organism or cell may need to be kept under certain conditions. Genetically altered organisms or cells containing the recombinant polynucleotide can be referred to as “transgenic” or “transformed” organisms or cells or simply as “transformants”, as well as recombinant organisms or cells.

A genetically altered organism is any organism with any changes to its genetic material, whether in the nucleus or cytoplasm (organelle). As such, a genetically altered organism can be a recombinant or transformed organism. A genetically altered organism can also be an organism that was subjected to one or more mutagens or the progeny of an organism that was subjected to one or more mutagens and has mutations in its DNA caused by the one or more mutagens, as compared to the wild-type organism (i.e, organism not subjected to the mutagens). Also, an organism that has been bred to incorporate a mutation into its genetic material is a genetically altered organism. For the purposes of this invention, the organism is a plant.

As used herein, the term “promoter” refers to a polynucleotide that in its native state is located upstream or 5′ to a translational start codon of an open reading frame (or protein-coding region) and that is involved in recognition and binding of RNA polymerase and other proteins (trans-acting transcription factors) to initiate transcription. A “plant promoter” is a native or non-native promoter that is functional in plant cells. The promoters described herein are predominately functional in root hair cells and thus are considered “tissue-specific promoters”. A plant promoter can be used as a 5′ regulatory element for modulating expression of a particular desired polynucleotide (heterologous polynucleotide) operably linked thereto. When operably linked to a transcribeable polynucleotide, a promoter typically causes the transcribable polynucleotide to be transcribed in a manner that is similar to that of which the promoter is normally associated. In one embodiment, a promoter having the sequence of SEQ ID NO: 1, 3, 5, or 7, or a sequence which is at least 95% identical thereto, is operably linked to a transcribable polynucleotide (a gene or polynucleotide of interest). This polynucleotide of interest, when transcribed, provides a desirable characteristic associated with plant morphology, physiology, growth and development, yield, nutritional enhancement, disease or pest resistance, or environmental or chemical tolerance.

Plant promoters can include promoters produced through the manipulation of known promoters to produce artificial, chimeric, or hybrid promoters. Such promoters can also combine cis-elements from one or more promoters, for example, by adding a heterologous regulatory element to an active promoter with its own partial or complete regulatory elements. Thus, the design, construction, and use of chimeric or hybrid promoters containing at least one cis-element of SEQ ID NO: 1, 3, 5, or 7 for modulating the expression of operably linked polynucleotide sequences is encompassed by the present invention. The term “cis-element” refers to a cis-acting transcriptional regulatory element that confers an aspect of the overall control of gene expression. A cis-element may function to bind transcription factors, trans-acting protein factors that regulate transcription. Some cis-elements bind more than one transcription factor, and transcription factors may interact with different affinities with more than one cis-element. The promoters of the present invention desirably contain cis-elements that can confer or modulate gene expression.

The term “vector” refers to DNA, RNA, a protein, or polypeptide that was be introduced into a host cell or organism. The polynucleotides, protein, and polypeptide which are to be introduced into a host can be therapeutic or prophylactic in nature; can encode or be an antigen; can be regulatory in nature; etc. There are various types of vectors including virus, plasmid, bacteriophages, cosmids, and bacteria.

An expression vector is nucleic acid capable of replicating in a selected host cell or organism. An expression vector can replicate as an autonomous structure, or alternatively can integrate, in whole or in part, into the host cell chromosomes or the nucleic acids of an organelle, or it is used as a shuttle for delivering foreign DNA to cells, and thus replicate along with the host cell genome. Thus, an expression vector are polynucleotides capable of replicating in a selected host cell, organelle, or organism, e.g., a plasmid, virus, artificial chromosome, nucleic acid fragment, and for which certain genes on the expression vector (including genes of interest) are transcribed and translated into a polypeptide or protein within the cell, organelle or organism; or any suitable construct known in the art, which comprises an “expression cassette”. In contrast, as described in the examples herein, a “cassette” is a polynucleotide containing a section of an expression vector. The use of the cassettes assists in the assembly of the expression vectors. An expression vector is a replicon, such as plasmid, phage, virus, chimeric virus, or cosmid, and which contains the desired polynucleotide sequence operably linked to the expression control sequence(s).

A heterologous polynucleotide sequence is operably linked to one or more transcription regulatory elements (e.g., promoter, terminator and, optionally, enhancer) such that the transcription regulatory elements control and regulate the transcription and/or translation of that heterologous polynucleotide sequence. A cassette can have the heterologous polynucleotide operably linked to one or more transcription regulatory elements. As used herein, the term “operably linked” refers to a first polynucleotide, such as a promoter, connected with a second transcribable polynucleotide, such as a gene of interest, where the polynucleotides are arranged such that the first polynucleotide affects the transcription of the second polynucleotide. In some embodiments, the two polynucleotide molecules are part of a single contiguous polynucleotide. In other embodiments, the two polynucleotides are adjacent. For example, a promoter is operably linked to a gene of interest if the promoter regulates or mediates transcription of the gene of interest in a cell. Similarly a terminator is operably linked to the polynucleotide of interest if the terminator regulates or mediates transcription of the polynucleotide of interest, and in particular, the termination of transcription. Constructs of the present invention would typically contain a promoter operably linked to a transcribable polynucleotide operably linked to a terminator.

Thus, constructs (cassette or expression vector) of the present invention contain one or more of the promoters described herein (having the sequence of SEQ ID NOs: 1, 3, 5, and/or 7, or a sequence that is at least 95% identical thereto), operably linked to a transcribable polynucleotide and, optionally, operably linked to one or more of the terminators described herein (have the sequence of SEQ ID NOs: 2, 4, 6, and/or 8, or a sequence that is at least 95% identical thereto) or to a heterologous terminator, so as to direct transcription of the transcribable polynucleotide in a root hair cell upon introduction of the construct into a plant cell. In some cases, the transcribable polynucleotide encodes a protein-coding region of a gene, and the promoter provides for transcription of a functional mRNA molecule that is translated and expressed as a protein product. Constructs may also transcribe antisense RNA or other similar inhibitory RNA in order to inhibit expression of a specific RNA molecule of interest in a root hair cell.

Exemplary heterologous polynucleotide for incorporation into constructs of the present invention include, for example, desired polynucleotides from a species other than the target plant's species, or even desired polynucleotides that originate with or are present in the same plant species, but are incorporated into the genetically altered plant cells by genetic engineering methods rather than classical reproduction or breeding techniques or by a combination of genetic engineering methods followed by breeding techniques. Heterologous polynucleotides refer to any polynucleotide molecule that is introduced into a recipient cell and is transcribed at levels that differ from the wild-type cell. A heterologous polynucleotide can include a polynucleotide that is already present in the plant cell, polynucleotide from another plant, polynucleotide from a different organism, or a polynucleotide generated externally, such as a polynucleotide containing an antisense message of a gene, or a polynucleotide encoding an artificial or modified version of a gene.

In one embodiment, the heterologous polynucleotide which is operably linked to a promoter and, optionally, to a terminator described herein encodes a gene of interest. As used herein, “gene of interest” refers to any heterologous polynucleotide that, upon transcription and, optionally, translation, imparts a desirable characteristic associated with plant morphology, physiology, growth and development, yield, nutritional enhancement, disease or pest resistance, or environmental or chemical tolerance. The expression of a gene of interest is desirable in order to confer an important trait to the genetically altered plant cell, plant, parts thereof and/or progeny. A gene of interest that provides a beneficial agronomic trait to crop plants includes, but is not limited to, polynucleotides that encode herbicide resistance (U.S. Pat. Nos. 5,633,435 and 5,463,175), increased yield (U.S. Pat. No. 5,716,837), insect control (U.S. Pat. Nos. 6,063,597; 6,063,756; 6,093,695; 5,942,664; and 6,110,464), fungal disease resistance (U.S. Pat. Nos. 5,516,671; 5,773,696; 6,121,436; 6,316,407, and 6,506,962), virus resistance (U.S. Pat. Nos. 5,304,730 and 6,013,864), nematode resistance (U.S. Pat. No. 6,228,992), bacterial disease resistance (U.S. Pat. No. 5,516,671), starch production (U.S. Pat. Nos. 5,750,876 and 6,476,295), modified oils production (U.S. Pat. No. 6,444,876), high oil production (U.S. Pat. Nos. 5,608,149 and 6,476,295), modified fatty acid content (U.S. Pat. No. 6,537,750), high protein production (U.S. Pat. No. 6,380,466), fruit ripening (U.S. Pat. No. 5,512,466), enhanced animal and human nutrition (U.S. Pat. Nos. 5,985,605 and 6,171,640), biopolymers (U.S. Pat. Nos. 5,958,745 and 6,946,588), environmental stress resistance (U.S. Pat. No. 6,072,103), pharmaceutical peptides (U.S. Pat. No. 6,080,560), improved processing traits (U.S. Pat. No. 6,476,295), improved digestibility (U.S. Pat. No. 6,531,648) low raffinose (U.S. Pat. No. 6,166,292), industrial enzyme production (U.S. Pat. No. 5,543,576), improved flavor (U.S. Pat. No. 6,011,199), nitrogen fixation (U.S. Pat. No. 5,229,114), hybrid seed production (U.S. Pat. No. 5,689,041), and biofuel production (U.S. Pat. No. 5,998,700). For the purposes of this invention, plant “nutrients” include minerals and organic compounds that plants need. It is understood that the expression of the gene of interest predominately in the root hair cells of a genetically altered plant can affect the entire genetically altered plant. For example, the predominant expression in root hair cells of certain protein(s) may enhance the genetically altered plant's resistance to environmental stress; the impact is not limited to simply the root hair cells.

Alternatively, a heterologous polynucleotide can affect the plant's phenotype by encoding a non-translated RNA that causes targeted inhibition of expression of an endogenous gene, for example, by antisense and inhibitory RNA, or RNA interference-mediated mechanisms. The non-translated RNA could also be a catalytic RNA molecule (i.e., a ribozyme) engineered to cleave a desired endogenous mRNA product. For the purposes of this invention, the gene of interest includes within its definition a non-translated RNA because such a non-translated RNA affects the characteristics of the genetically altered plant cell, plant, parts thereof, and/or progeny containing the construct described herein. Thus, any heterologous polynucleotide that encodes a protein or mRNA that expresses a phenotype or morphology change of interest is useful for the practice of the present invention.

Transformation and generation of genetically altered monocotyledonous and dicotyledonous plant cells is well known in the art. See, e.g., Weising, et al., Ann. Rev. Genet. 22:421-477 (1988); U.S. Pat. No. 5,679,558; Agrobacterium Protocols, ed: Gartland, Humana Press Inc. (1995); and Wang, et al. Acta Hort. 461:401-408 (1998). The choice of method varies with the type of plant to be transformed, the particular application and/or the desired result. The appropriate transformation technique is readily chosen by the skilled practitioner.

Exemplary transformation/transfection methods available to those skilled in the art include, but are not limited to: direct uptake of foreign DNA constructs (see, e.g., EP 295959); techniques of electroporation (see, e.g., Fromm et al., Nature 319:791 (1986)); and high-velocity ballistic bombardment with metal particles coated with the nucleic acid constructs (see, e.g., Kline, et al., Nature 327:70 (1987) and U.S. Pat. No. 4,945,050). Specific methods to transform heterologous genes into commercially important crops (to make genetically altered plants) are published for rapeseed (De Block, et al., Plant Physiol. 91:694-701 (1989)); sunflower (Everett, et al., Bio/Technology 5:1201 (1987)); soybean (McCabe, et al., Bio/Technology 6:923 (1988), Hinchee, et al., Bio/Technology 6:915 (1988), Chee, et al., Plant Physiol. 91:1212-1218 (1989), and Christou, et al., Proc. Natl. Acad. Sci USA 86:7500-7504 (1989)); rice (Hiei, et al., Plant J. 6:271-282 (1994)), and corn (Gordon-Kamm, et al., Plant Cell 2:603-618 (1990), and Fromm, et al., Biotechnology 8:833-839 (1990)). Other known methods are disclosed in U.S. Pat. Nos. 5,597,945; 5,589,615; 5,750,871; 5,268,526; 5,262,316; and 5,569,831.

One exemplary method includes employing Agrobacterium tumefaciens (Rhizobium radiobacter) or Agrobacterium rhizogenes as the transforming agent to transfer heterologous DNA into the plant. Agrobacterium tumefaciens-meditated transformation techniques are well described in the scientific literature. See, e.g., Horsch, et al. Science 233:496-498 (1984), and Fraley, et al. Proc. Natl. Acad. Sci. USA 80:4803 (1983). Typically, a plant cell, an explant, a meristem or a seed is infected with Agrobacterium tumefaciens transformed with the expression vector/construct which contains the heterologous nucleic acid operably linked to a promoter. Under appropriate conditions known in the art, the transformed plant cells are grown to form shoots, roots, and develop further into genetically altered plants. In some embodiments, the heterologous nucleic acid can be introduced into plant cells, by means of the Ti plasmid of Agrobacterium tumefaciens. The Ti plasmid is transmitted to plant cells upon infection by Agrobacterium tumefaciens, and is stably integrated into the plant genome. See, e.g., Horsch, et al. (1984), and Fraley, et al. (1983).

Transformed plant cells which are derived by any of the above transformation techniques can be cultured to regenerate a whole plant which possesses the desired transformed phenotype. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, in Handbook of Plant Cell Culture, pp. 124-176, MacMillan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, in Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Regeneration can also be obtained from plant callus, explants, organs, or parts thereof. Such regeneration techniques are described generally in Klee, et al., Ann. Rev. of Plant Phys. 38:467-486 (1987).

Once a genetically altered plant has been generated, one can breed it with a wild-type plant and screen for heterozygous F1 generation plants containing the genetic change present in the parent genetically altered plant. Then F2 generation plants can be generated which are homozygous for the genetic alteration. These heterozygous F1 generation plants and homozygous F2 plants, progeny of the original genetically altered plant, are considered genetically altered plants, having the altered genomic material from the genetically altered parent plant.

Marker-assisted selection is a method of selecting desirable individuals in a breeding scheme based on DNA molecular marker patterns instead of, or in addition to, their phenotypic traits. Marker-assisted selection provides a useful tool that allows for efficient selection of desirable crop traits and is well known in the art (see, e.g., Podlich, et al., Crop Sci. 44:1560-1571 (2004); Ribaut and Hoisington, Trends in Plant Science 3:236-238 (1998); Knapp, S., Crop Science 38:1164-1174 (1998); Hospital, F., Marker-assisted breeding, pp 30-59, in Plant molecular breeding, H. J. Newbury (ed.), Blackwell Publishing and CRC Press (Oxford and Boca Raton).

After one obtains a genetically altered plant containing a heterologous polynucleotide operably linked to a promoter described herein and a terminator described herein, one can efficiently breed the genetically altered plant with other plants containing desired traits. One can use molecular markers (i.e., polynucleotide probes) based on the sequence of the promoter described herein, terminator described herein, heterologous polynucleotide, and/or another sequence in the expression vector to determine which offspring of crosses between the genetically altered plant and the other plant possess the expression vector containing the desired cassette. This process is known as Marker Assisted Rapid Trait Introgression (MARTI). Briefly, MARTI involves (1) crossing the genetically altered plant (containing the expression vector containing the cassette described herein) with a plant line having desired phenotype/genotype (“elite parent”) for introgression to obtain F1 offspring. The F1 generation is heterozygous for cassette. (2) Next, an F1 plant is be backcrossed to the elite parent, producing BC1F1 which genetically produces 50% wild-type and 50% heterozygote for the cassette. (3) PCR using the polynucleotide probe is performed to select the heterozygote genetically altered plants containing the cassette. (4) Selected heterozygotes are then backcrossed to the elite parent to perform further introgression. (5) This process of MARTI is performed for several more cycles. (6) Next, the heterozygote genetically altered plant is self-pollinated to produce BC6F2 generation. The BC6F2 generation produces a phenotypic segregation ratio of 3 wild-type parent plants to 1 genetically altered plant. (7) One selects the genetically altered plants at the BC6F2 generation at the seedling stage using PCR with the polynucleotide probe and can optionally be combined with phenotypic selection at maturity. These cycles of crossing and selection can be achieved in a span of 2 to 2.5 years (depending on the plant), as compared to many more years for conventional backcrossing introgression method now in use. Thus, the application of MARTI using PCR with a polynucleotide probe significantly reduces the time to introgress the desired genetic alteration into elite lines for producing commercial hybrids. The final product is an inbred plant line almost identical (99%) to the original elite in-bred parent plant that is the homozygous for the heterologous polynucleotide encoding the desired product.

Many techniques involving molecular biology discussed herein are well-known to one of ordinary skill in the art and are described in, e.g., Green and Sambrook, Molecular Cloning, A Laboratory Manual 4th ed. 2012, Cold Spring Harbor Laboratory; Ausubel et al. (eds.), Current Protocols in Molecular Biology, 1994—current, John Wiley & Sons; and Kriegler, Gene Transfer and Expression: A Laboratory Manual (1993). Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology maybe found in e.g., Benjamin Lewin, Genes IX, Oxford University Press, 2007 (ISBN 0763740632); Krebs, et al. (eds.), The Encyclopedia of Molecular Biology, Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

The term “plant” includes whole plants, plant organs, progeny of whole plants or plant organs, embryos, somatic embryos, embryo-like structures, protocorms, protocorm-like bodies (PLBs), and suspensions of plant cells. Plant organs comprise, e.g., shoot vegetative organs/structures (e.g., leaves, stems and tubers), roots, flowers and floral organs/structures (e.g., bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit (the mature ovary), plant tissue (e.g., vascular tissue, ground tissue, and the like) and cells (e.g., guard cells, egg cells, trichomes and the like). The class of plants that can be used in the method of the invention is generally as broad as the class of higher and lower plants amenable to the molecular biology and plant breeding techniques described herein, specifically gymnosperms and angiosperms (monocotyledonous (monocots) and dicotyledonous (dicots) plants). It includes plants of a variety of ploidy levels, including aneuploid, polyploid, diploid, haploid and hemizygous. The genetically altered plants described herein can be monocot plant, and more particularly, monocot crops, such as, but not limited to, sorghum, maize, wheat, rice, barley, oats, rye, millet, and triticale. The genetically altered plants described herein can also be dicot plants, and more particularly, dicot crops, such as apple, pear, peach, plum, orange, lemon, lime, grapefruit, pomegranate, olive, peanut, cotton, tobacco, cucumber, carrot, potato, celery, tomato, legume (beans), raspberry, blackberry, blackberry, strawberry, blueberry, etc. Also, the genetically altered plants (or plants with altered genomic DNA) can be horticultural plants such as rose, marigold, primrose, dogwood, pansy, geranium, etc. Other plants include, but are not limited to, grasses, oak, walnut, pecan, poplar, etc. The genetically altered plants described herein can also be gymnosperms, such as but not limited to cycads, conifers (redwoods, sequoias, pines, fir and hemlock), and ginkgo.

The terms “approximately” and “about” refer to a quantity, level, value or amount that varies by as much as 30%, or in another embodiment by as much as 20%, and in a third embodiment by as much as 10% to a reference quantity, level, value or amount. As used herein, the singular form “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a bacterium” includes both a single bacterium and a plurality of bacteria.

Having now generally described this invention, the same will be better understood by reference to certain specific examples and the accompanying drawings, which are included herein only to further illustrate the invention and are not intended to limit the scope of the invention as defined by the claims. The examples and drawings describe at least one, but not all embodiments, of the inventions claimed. Indeed, these inventions may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements.

Example 1. High-Throughput Sequence Analysis of S. bicolor Transcripts

Seeds of S. bicolor genotype BTx623 are purchased from Crosbyton Seed Company (Crosbyton, Tex.). Seeds are germinated and grown for eight days in the dark under soil-free conditions using a capillary mat system devised by Czarnota, et al. (2001). Root hairs are isolated from dark-grown 8-day-old seedling root systems using the method devised by Bucher, et al., Plant Mol. Biol. 35:497-508 (1997), involving immersion in liquid nitrogen with gentle stirring, followed by filtration through a 250 μM aluminum mesh to remove root system debris. Purity of the root hair preparations is assessed by bright-field microscopy, and only highly enriched preparations are retained for subsequent RNA extraction and sequence analysis. Root hair preparations are stored at −80° C. prior to RNA extraction. Total RNAs are isolated from root hairs using TRIzol® Reagent (Invitrogen Corp., Carlsbad, Calif.) per manufacturer's recommended protocol, with an additional homogenization step of 30 seconds at 25,000 rpm using a hand-held homogenizer. RNAs are then re-purified using RNeasy Plant Mini-Kit (Qiagen, Inc., Germantown, Md.), including an “on column” DNase I treatment using a RNase-Free DNase kit (Qiagen, Inc., Germantown, Md.) according to manufacturer's recommended protocol, to remove residual DNA contamination. RNA purity is determined spectrophotometrically, and integrity is assessed by agarose gel electrophoresis.

For Sanger EST analysis, polyA+ mRNA is prepared from root hair total RNA using an Oligotex mRNA Midi Kit (Qiagen, Inc., Germantown, Md.), and used for construction of a directional cDNA library with the Uni-Zap XR cDNA library construction kit (Stratagene, Santa Clara, Calif.), per manufacturer's recommended protocol. 5′ DNA sequencing reactions are performed using ABI BigDye Terminator Cycle Sequence Ready Reaction kits (Applied Biosystems, Foster City, Calif.) as previously described (Pratt, et al., Plant Physiol. 139:869-884 (2005)). High throughput sequence data are also generated using total RNAs prepared as described above for Sanger EST analysis, and strand-specific libraries are constructed for 3 biological replicate root hair samples using the procedure described by Zhong and coworkers (High-Throughput Illumina Strand-Specific RNA Sequencing Library Preparation. Cold Spring Harb. Protoc. doi:10.1101/pdb.prot5652 (2011)). Library aliquots are analyzed using an Illumina HiSeq 2500 System (Illumina Inc., San Diego, Calif.) as single-end reads for 150 cycles and are mapped to the S. bicolor genotype BTx623 genome v1.4 (www.phytozome.org). The EST analysis indicated that over 10,000 different mRNAs are present in the sorghum root hair cells.

In an expressed sequence tag study, the number of sequence tags corresponding to a particular sequence is directly proportional to how highly expressed that sequence is. Thus, to identify highly expressed root hair-specific gene candidates for follow-up promoten:reporter studies, all expressed sequences identified are first ranked by sequence count. The top 100 of these sequences (out of the more than 10,000 sequences expressed in the sorghum root hair cells) are then used for BLASTN analyses against all other publicly-available S. bicolor EST libraries. From these efforts, eight sequences are identified as exhibiting a highly root hair-preferential expression.

Out of these eight sequences, steady-state transcript accumulation levels for four of the sequences (see Table 2, infra) are assessed to confirm that these sequences are expressed primarily in S. bicolor root hair cells using quantitative real-time RT-PCR using the protocol previously described Baerson, et al. (J. Biol. Chem. 280:21867-21881 (2005)). The steady-state levels of the endogenous transcripts corresponding to contigs 2_36, 2_35, 2_32, and 2_23 (loci nos. Sb01g027620, Sb08g001960, Sb05g000390, Sb04g032670, respectively; see Table 2) are determined in various S. bicolor tissues via qRT-PCR using gene-specific primers (see FIG. 1A though FIG. 1D). Immature leaves and shoot apices from S. bicolor genotype BTx623 are isolated from seedlings maintained in a growth chamber at 28° C. for 8 days in standard (approximately 20×40 cm) nursery flats using Premier Pro Mix PGX potting media (Hummert International, Earth City, Mo.) under a combination of cool-white fluorescent and incandescent lighting at an intensity of approximately 400 μmol m−2 s−1 and a 16-hour photoperiod. Developing panicles, mature leaves, and culm (stem) tissues are isolated from 10-week-old greenhouse-grown plants. At the time of harvest, panicles are partially exerted from flag leaf sheaths, just prior to anthesis. All harvested S. bicolor tissues are directly flash-frozen in liquid nitrogen and stored at −80° C. prior to analysis.

Total RNAs are isolated from 0.5 g aliquots of flash-frozen S. bicolor genotype BTx623 tissues using the above described protocol. Quantitative real-time PCR reactions are performed in triplicate using the GenAmp® 7300 Sequence Detection System (Life Technologies, Carlsbad, Calif.) as previously described in Baerson, et al. (2005). First strand cDNAs are synthesized from 2 μg of total RNA in a 100 μL reaction volume using the TaqMan Reverse Transcription Reagents Kit (Life Technologies, Carlsbad, Calif.) per manufacturer's recommended protocol. Independent PCR reactions are performed using the same cDNA for both the gene of interest (loci nos. Sb01g027620, Sb08g001960, Sb05g000390, or Sb04g032670), and 18S rRNA as an internal control, using the SYBR® Green PCR Master Mix (Life Technologies, Carlsbad, Calif.). Gene-specific primer pairs are designed for all sequences using Primer Express v.3.0.1 software (Life Technologies, Carlsbad, Calif.). See Table 1 for primer information and Table 2 for more information about the genes.


TABLE 1
Gene & Primer
Sequence
Sb01g027620; forward primer
5′-TTGCCGATTCAGTGCTCCTGTTCGT-3′
(SEQ ID NO: 26)
Sb01g027620; reverse primer
5′-CGTGCAACAACATCGCACCAAGGA-3′
(SEQ ID NO: 27)
Sb08g001960; forward primer
5′-ATCCAGGGCTACAAGAAGGG-3′
(SEQ ID NO: 28)
Sb08g001960; reverse primer
5′-CGACAGGTGATGATGGCGAA-3′
(SEQ ID NO: 29)
Sb05g000390; forward primer
5′-ATACTACCGGGAGCCACACAAG-3′
(SEQ ID NO: 30)
Sb05g000390; reverse primer
5′-CCAAGGAGGTGAAGTGGCAG-3′
(SEQ ID NO: 31)
Sb04g032670; forward primer
5′-AATGATGCGTTGTTATTTGATTGCTT-3′
(SEQ ID NO: 32)
Sb04g032670; reverse primer
5′-TGGTGACTGCTGTACTATGTGG-3′
(SEQ ID NO: 33)
18S rRNA; forward primer
5′-GGCTCGAAGACGATCAGATACC-3′
(SEQ ID NO: 34)
18S rRNA; reverse primer
5′-TCGGCATCGTTTATGGTT-3′
(SEQ ID NO: 35)

A dissociation curve is generated at the end of each PCR cycle to verify that a single product is amplified using software provided with the GeneAmp® 7300 sequence detection system. A negative control reaction in the absence of template (no template control) is also routinely performed in triplicate for each primer pair. The change in fluorescence of SYBR® Green I dye in every cycle is monitored by the GenAmp® 7300 system software, and the threshold cycle (CT) above background for each reaction is calculated. The CT value of 18S rRNA is subtracted from that of the gene of interest to obtain a ΔCT value. The CT value of an arbitrary calibrator (e.g., the tissue sample from which the largest ΔCT values are obtained) is subtracted from the ΔCT value to obtain a ΔΔCT value. The fold-changes in expression level relative to the calibrator are calculated as 2−ΔΔCT. The value provides the relative expression levels for each sequence, and is expressed as mean±S.D. from assays performed in triplicate.

The steady-state levels of the endogenous transcripts corresponding to contigs 2_36 (FIG. 1A), 2_35 (FIG. 1B), 2_32 (FIG. 1C), and 2_23 (FIG. 1D) (loci nos. Sb01g027620, Sb08g001960, Sb05g000390, Sb04g032670, respectively, in Table 2), the highest steady-state transcript levels occurred in root hairs. For each contig gene, some transcriptional expression is also detected in whole seedling roots which is expected given the presence of root hairs cells in those samples. Thus, the results of the qRT-PCR analyses (FIG. 1A though FIG. 1D) are consistent with the root hair-preferential expression patterns for contigs 2_36, 2_35, 2_32, and 2_23 inferred from the initial transcriptome studies.

Information regarding these four contigs is located in Table 2, infra. Interestingly, the sequence for contig ID no. 2_32, which is found to be the most highly expressed root-hair specific sequence (FIG. 1A), corresponds to fatty acid desaturase (SbDES3) which generates the unusual 16:3Δ9,12,15 fatty acid required for biosynthesis of the allelochemical sorgoleone (Pan, et al., J. Biol. Chem. 282:4326-4335 (2007)).


TABLE 2
%,
Total
Contig
Locus
Sanger
FPKM,
FPKM,
FPKM,
FPKM,
Putative
E-
ID
ID
ESTs
RH-a
RH-b
RH-c
mean
Function
value
Source
2_32
Sb05g000390
0.4572
1.68E+04
1.33E+04
1.60E+04
1.54E+04
Fatty acid
0.0
ABN49521
desaturase
(S. bicolor)
DES3
2_35
Sb08g001960
0.4572
3.74E+03
2.23E+03
3.74E+03
3.23E+03
γ-tocopherol
 4E−123
ABE41797
methyltransferase
(Z. mays)
2_36
Sb01g027620
0.4389
1.03E+04
1.17E+04
1.25E+04
1.15E+04
Glutathione
9E−71
AAM94545
S-transferase
(O. sativa)
2_23
Sb04g032670
0.3658
2.57E+03
2.67E+03
2.07E+03
2.44E+03
Root-specific
1E−36
BAD25630
protein RCc3
(O. sativa)

Example 2. Cassette and Expression Vector Construction

The sequences corresponding to contig ID numbers 2_36, 2_35, 2_32, and 2_23 (Table 2) are chosen for further evaluation in promoter::reporter gene::terminator experiments using the models Arabidopsis and rice. Approximately 2.5 kb of 5′ flanking sequence (promoter), and 1.5 kb of 3′ flanking sequence (terminator) (both relative to the predicted start and stop codons, respectively) are identified by alignment with the S. bicolor genotype BTx623 genomic sequence (www.phytozome.org), and used for the construction of binary vectors containing promoter::reporter gene::3′ sequence cassettes using β-glucuronidase (GUSPlus, also referred to herein as “GUS”) as the reporter gene (Jefferson, et al., EMBO J. 6:3901-3907 (1987)). The promoter::GUSPlus::3′-flanking region (terminator) cassettes are assembled by overlap-extension PCR or fusion PCR (see, Shevchuk, et al., Nucleic Acids Res. 32:e19 (2004)) to avoid inclusion of extraneous sequences. This method can be used to operably link any gene of interest to any of the promoters and terminator sequences described herein. The enhanced ‘GUSPlus’ coding sequence used for all promoter::reporter gene::terminator cassettes is amplified from pCAMBIA1305.1 (CAMBIA, Canberra, Australia), and the assembled cassettes are cloned into the binary vector p7P-Nos (DNA Cloning Service, Hamburg, Germany). p7P-Nos contains the bar gene as the plant selectable marker driven by the relatively weak A. tumefaciens nopaline synthase (NOS) promoter, which reduces the possibility of cross-activation of adjacent root hair-specific promoters within the same T-DNA (see FIG. 2 though FIG. 5).

The promoter and 3′ flanking sequence (terminator) regions of selected putative root hair-specific genes (contig ID numbers 2_36, 2_35, 2_32, and 2_23) are initially obtained via PCR amplification using S. bicolor genotype BTx623 genomic DNA as template. The forward and reverse PCR primer sequences used for amplification of all promoter and terminator regions from genomic DNA are shown in Table 3. All PCR reactions are performed using PfuUltra High-Fidelity DNA Polymerase (Stratagene, Santa Clara, Calif.) per manufacturer's recommended protocol. The PCR products obtained are gel purified using a QIAquick Gel Extraction Kit (Qiagen Inc., Valencia, Calif.) according to the manufacturer's recommended protocol, then used as templates for a second round of PCR amplifications leading to the assembly of GUSPlus expression cassettes (described below).


TABLE 3
Primers used for initial amplification of fragments
from S. bicolor BTx623 genomic DNA
Primer
Description
Primer sequence (5′−> 3′)
2_32_pF
2_32 promoter 5′ (forward)
GCCGGAGCCACCCGTCATGGAGC
(SEQ ID NO: 36)
2_32_pR
2_32 promoter 3 (reverse)
GGCTGGCGGTTGTGGTGGTGAACAAGC
(SEQ ID NO: 37)
2_32_tF
2_32 terminator 5′ (forward)
TGACTTGCATCATTGCTGGGAGG
(SEQ ID NO: 38)
2_32_tR
2_32 terminator 3′ (reverse)
AAGAGGACGACGTCGGCGGCGT
(SEQ ID NO: 39)
2_35_pF
2_35 promoter 5′ (forward)
CCTCTACCTTTCATCAAGCTTCC
(SEQ ID NO: 40)
2_35_pR
2_35 promoter 3′ (reverse)
GCCCGATGAAGTATATGTAGACG
(SEQ ID NO: 41)
2_35_tF
2_35 terminator 5′ (forward)
TAGCAGAGGAACTTACTGTCACAACG
(SEQ ID NO: 42)
2_35_tR
2_35 terminator 3′ (reverse)
AAGTTGCAACTCATCTCCAACT
(SEQ ID NO: 43)
2_36_pF
2_36 promoter 5′ (forward)
ACAGTCTGATCTGACCTTCCTGA
(SEQ ID NO: 44)
2_36_pR
2_36 promoter 3′ (reverse)
CATTTCCTCCTCCCTAGCTTCTA
(SEQ ID NO: 45)
2_36_tF
2_36 terminator 5′ (forward)
TGAACCAACATACTCGATCGGTTCCT
(SEQ ID NO: 46)
2_36_tR
2_36 terminator 3′ (reverse)
CCATGCAACCTTAGCACCACGTCA
(SEQ ID NO: 47)
2_23_pF
2_23 promoter 5′ (forward)
GTATGGCGAATGCAAACCAC
(SEQ ID NO: 48)
2_23_pR
2_23 promoter 3′ (reverse)
TATTGCTCGATCACACCAGCTC
(SEQ ID NO: 49)
2_23_tF
2_23 terminator 5′ (forward)
GATCTCAGCCTCATCCTCAACTAC
(SEQ ID NO: 50)
2_23_tR
2_23 terminator 3′ (reverse)
CTGGCTGATATTGGGCTATGTG
(SEQ ID NO: 51)

In the second round of PCR, the various terminator/promoter-containing PCR fragments obtained from genomic DNA templates (described above) are re-amplified (used as templates) in PCR reactions using primers which add flanking restriction enzyme sites to the 5′ ends of promoter fragments and 3′ ends of terminator fragments, facilitating ligation of the final transgene cassettes with appropriately-digested transformation vector DNA. In addition, a fragment containing the GUSPlus coding sequence is generated via PCR using plasmid pCAMBIA1305.1 as template. All of these second round PCR reactions are performed using PfuUltra High-Fidelity DNA Polymerase (Stratagene, Santa Clara, Calif.), followed by gel purification of the resulting PCR products using a QIAquick Gel Extraction Kit, per manufacturer's instructions. The forward and reverse PCR primer sequences used for generation of these second round promoter, terminator, and GUSPlus-containing fragment are shown in Table 4 below.

Fusion PCR (see, e.g., Shevchuk, et al. (2004)) is next performed using the gel-purified promoter-, GUSPlus-, and terminator-containing fragments generated in the second PCR round (described above) as so-called “megaprimers” (Shevchuk, et al. (2004)), to obtain the final promoter::GUSPlus::terminator cassettes containing flanking restriction enzyme sites. The use of this approach enables the attachment of the promoters and terminators to the GUSPlus coding sequences without the addition of extraneous sequences, thus preserving the original sequence context present within the endogenous S. bicolor genes. The previously made second round PCR-generated promoter, GUSPlus, and terminator fragments are combined in equimolar quantities such that the total DNA amounts are 400 ng. The PCR reaction mixtures (25 μl final volume) consist of the three fragments, 1× reaction buffer, 0.2 mM dNTPs and 1 unit of PfuUltra High-fidelity DNA Polymerase (Stratagene, Santa Clara, Calif.). The thermal profile used for these reactions consist of 15 seconds at 95° C., 15 seconds at 65° C., followed by 5 minutes at 72° C. for 15 cycles. Next, 5 μl of each (unpurified) PCR reaction are then used as template in a final round of PCR, and these (50 μl final volume) PCR reactions contain 1× reaction buffer, 0.2 mM dNTPs, 2 units of PfuUltra High-fidelity DNA Polymerase, and 5 pM each of forward and reverse primer appropriate for the cassette being generated (see Table 4). The thermal profile used for these final round PCR reactions consists of 15 seconds at 95° C., 15 seconds at 65° C., followed by 8 minutes at 72° C. for 25 cycles. The forward and reverse primers used in this final PCR amplification step are complementary to the 5′ and 3′ promoter::GUSPlus::terminator cassettes, and are identical to the primer sequences used for the second round PCR reactions (described above) but, here, restriction enzyme sites have already been introduced into the 5′ ends of promoter sequences, and 3′ ends of the terminator sequences. For example, the forward and reverse primers used in this final PCR step for assembly of the 2_36 promoter::GUSPlus::2_36 terminator cassette are 2_36_pFA and 2_36_tRB, respectively, and the primers for assembly of the 2_32 promoten:GUSPlus::2_26 terminator cassette are 2_32_pFH and 2_32_tRE, respectively (Table 4). The nucleotide sequences of the final assembled cassettes are confirmed by DNA sequence analysis.

The DNA sequence for 2_23 promoten:GUSPlus::2_23-3′ cassette is SEQ ID NO: 10. The sequence for the SfiI-2_23 promoter::GUS-plus::2_23 terminator—SfiI cassette is in SEQ ID NO: 11. The DNA sequence for SfiI—2_23 promoter is in SEQ ID NO: 12. The DNA sequence for 2_23 terminator—SfiI is in SEQ ID NO: 13.

The DNA sequence for 2_32 promoten:GUSPlus::2_32-3′ cassette is SEQ ID NO: 14. The sequence for the HindIII—2_32 promoten:GUSPlus::2_32 terminator—EcoRI cassette is in SEQ ID NO: 15. The sequence for the HindIII—2_32 promoter is SEQ ID NO: 16. The sequence for 2_32 terminator—EcoRI is SEQ ID NO: 17.

The DNA sequence for 2_35 promoten:GUSPlus::2_35-3′ cassette is SEQ ID NO: 18. The sequence for the SfiI—2_35 promoter::GUS-plus::2_35 terminator—SfiI cassette is in SEQ ID NO: 19. The DNA sequence for SfiI—2_35 promoter is SEQ ID NO: 20. The DNA sequence for 2_35 terminator—SfiI is SEQ ID NO: 21.

The DNA sequence for 2_36 promoten:GUSPlus::2_36-3′ cassette is SEQ ID NO: 22. The sequence for the SfiI-2_36 promoter::GUS-plus::2_36 terminator—SfiI cassette is in SEQ ID NO: 23. The sequence of SfiI-2_36 promoter is in SEQ ID NO: 24. The sequence of 2_36 terminator—SfiI is in SEQ ID NO: 25.


TABLE 4
Primers used for generation of Fusion PCR templates and amplification of final
assembled transgene cassettes
Primer
Description
Primer sequence (5′−> 3′)
2_32_pFH
HindIII-2_32 promoter 5′ (forward)
cgcaagcTTAGCTAGATCGGATGGTTAAGA
(SEQ ID NO: 52)
2_32_pgR
2_32 promoter 3′ (reverse)
TTACCCTCAGATCTACCATGGCTGGCGGTTGTGGTGGTG
(SEQ ID NO: 53)
2_32_pgF
GUSPlus-5′ fusion w/2_32 (forward)
CACCACCACAACCGCCAGCCATGGTAGATCTGAGGGTAA
(SEQ ID NO: 54)
2_32_gtR
GUSPlus-3′ fusion w/2_32 (reverse)
CCTCCCAGCAATGATGCAAGTCACACGTGATGGTGATGG
(SEQ ID NO: 55)
2_32_gtF
2_32 terminator 5′ (forward)
CCATCACCATCACGTGTGACTTGCATCATTGCTGGGAGG
(SEQ ID NO: 56)
2_32_tRE
2_32 terminator-EcoRI 3′ (reverse)
ccgaattcTCGAGATTTTATTCTCGCAGGTAGAGGCAG
(SEQ ID NO: 57)
2_35_pFA
SfiI-2_35 promoter 5′ (forward)
gcggcccttaaGGCCTCTGGGTACTGCTATTGAG
(SEQ ID NO: 58)
2_35_pgR
2_35 promoter 3′ (reverse)
GAAATTTACCCTCAGATCTACCATCGACGACGACGCACGACGTAC
(SEQ ID NO: 59)
2_35_pgF
GUSPlus-5′ fusion w/2_35 (forward)
GTACGTCGTGCGTCGTCGTCGATGGTAGATCTGAGGGTAAATTTC
(SEQ ID NO: 60)
2_35_gtR
GUSPlus-3′ fusion w/2_35 (reverse)
CGTTGTGACAGTAAGTTCCTCTGCTATCACACGTGATGGTGATGG
(SEQ ID NO: 61)
2_35_gtF
2_35 terminator 5′ (forward)
CCATCACCATCACGTGTGATAGCAGAGGAACTTACTGTCACAACG
(SEQ ID NO: 62)
2_35_tRB
2_35 terminator-SfiI 3′ (reverse)
gcggccatggcGGCCAAGTTGCAACTCATCTCCAACTC
(SEQ ID NO: 63)
2_36_pFA
SifI-2_36 promoter 5′ (forward)
gcggcccttaaggccCAATATGCATCGGCATCTTG
(SEQ ID NO: 64)
2_36_pgR
2_36 promoter 3′ (reverse)
TTTACCCTCAGATCTACCATTTCCTCCTCCCTAGCTTCTATTCTT
(SEQ ID NO: 65)
2_36_pgF
GUSPlus-5′ fusion w/2_36 (forward)
AAGAATAGAAGCTAGGGAGGAGGAAATGGTAGATCTGAGGGTAAA
(SEQ ID NO: 66)
2_36_gtR
GUSPlus-3′ fusion w/w_36 (reverse)
AGGAACCGATCGAGTATGTTGGTTCACACGTGATGGTGATGGTGA
(SEQ ID NO: 67)
2_36_gtF
2_36 terminator 5′ (forward)
TCACCATCACCATCACGTGTGAACCAACATACTCGATCGGTTCCT
(SEQ ID NO: 68)
2_36_tRB
2_36 terminator-SfiI 3′ (reverse)
gcggccatggcggccATGCAACCTTAGCACCACGTCA
(SEQ ID NO: 69)
2_23_pFA
SfiI-2_23 promoter 5′ (forward)
gcggcccttaaggccACACTAGAATCACTCTCCCACTC
(SEQ ID NO: 70)
2_23_pgR
2_23 promoter 3′ (reverse)
AAATTTACCCTCAGATCTACCATTATTGCTCGATCACACCAGCTC
(SEQ ID NO: 71)
2_23_pgF
GUSPlus-5′ fusion w/2_23 (forward)
GAGCTGGTGTGATCGAGCAATAATGGTAGATCTGAGGGTAAATTT
(SEQ ID NO: 72)
2_23_gtR
GUSPlus-3′ fusion w/2_23 (reverse)
GCGCTGAGATCCAGGCGCTCATCACACGTGATGGTGATGGTGATG
(SEQ ID NO: 73)
2_23_gtF
2_23 terminator 5′ (forward)
CATCACCATCACCATCACGTGTGATGAGCGCCTGGATCTCAGCGC
(SEQ ID NO: 74)
2_23_tRB
SfiI-2_23 terminator 3′ (reverse)
gcggccatggcggccGGGGTGCGAATACCATAGAAAC
(SEQ ID NO: 75)
*start and stop codons are underlined; and added nucleotides introducing flanking restriction enzymes sites are shown in lowercase

The resulting cassettes are then gel-purified, digested with SfiI, and ligated to SfiI-digested binary vector p7N (DNA Cloning Service, Hamburg, Germany). In the case of sequence 2_32, the promoter::GUSPlus::terminator cassette is subcloned into p7N using flanking HindIII and EcoRI restriction sites (see Table 4). p7N, in which the plant selection marker phosphinothricin acetyl transferase (bar) is driven by the relatively weak A. tumefaciens nopaline synthase promoter, is chosen as the backbone for these constructs to avoid potential cross-activation from the CAMV 35S promoter typically used to drive plant-selectable marker expression.

The four binary vectors, p7N-2_32-GUS (FIG. 2), p7N-2_36-GUS (FIG. 3), p7N-2_23-GUS (FIG. 4), and p7N-2_35-GUS (FIG. 5) are made. In all binary vectors, “bar” is neomycin phosphotransferase plant-selectable marker, “NOS pro” is nopaline synthase promoter, “T35S” is CaMV 35S terminator, “pVS1 ORI” and “ColE1” are replication origins, “Sm/Sp” is streptomycin/spectinomycin bacterial-selectable marker, “LB” is left border, and “RB” is right border. For each binary vector, the promoter region and terminator region are obtained from the indicated contig (Table 2); 2_32 (FIG. 2), 2_36 (FIG. 3), 2_23 (FIG. 4), and 2_35 (FIG. 5), respectively.

Example 3. Generation of Genetically Altered Plants

The four binary vectors made in Example 2, supra, are used to transform Arabidopsis thaliana (ecotype Col-0) and Oryza sativa (cv. Nipponbare) to assess trangene expression in both a dicotyledonous and monocotyledonous host plant. Arabidopsis transformants are generated using the ‘floral dip’ method (Clough and Bent, Plant J. 16:735-743 (1998)) with individual genetically altered A. tumefaciens LBA4404 strains harboring one of each of the binary vectors described in Example 2. For generation of rice transformants, Agrobacterium-mediated transformation of embryogenic calli is performed as previously described (agron-www.agron.iastate.edu/ptf/protocol/Rice.PDF; updated Jun. 26, 2006) with recombinant A. tumefaciens EHA101 strains harboring one of each of the four binary vectors described in Example 2, supra.

Example 4. Assessment of Root Hair-Specific Promoter and Terminator Sequences in Genetically Altered Plants

The spatio-temporal expression patterns and expression levels for each of the genetically altered plants are analyzed by histochemical localization and quantitative fluorimetric assays, using well-known in the art procedures (Jefferson, et al. (1987)). For both genetically altered A. thaliana and genetically altered O. sativa, a minimum of ten independent events are analyzed for each binary vector construct.

O. sativa (cv. Nipponbare) seedlings are maintained in growth chambers for 2 weeks at 25° C. under a combination of cool-white fluorescent and incandescent lighting at an intensity of approximately 400 μmol m−2 s−1 and a 16-hour photoperiod. To facilitate root system harvests, rice seedlings are grown using the synthetic medium Profile Greens (Profile Products LLC, Buffalo Grove, Ill.) and are fertilized twice weekly using Peters Excel 15-5-15 Cal-Mag (J.R. Peters, Inc., Allentown, Pa.) at 200 ppm nitrogen adjusted to pH 5.7. For harvests, pots containing genetically altered seedlings are briefly submerged in distilled, deionized water to remove all synthetic media from root systems, which are then excised, gently blotted on Kimwipes, and then either directly submerged in X-Gluc solution (Sigma-Aldrich Co., St. Louis, Mo.) for histochemical analyses, or flash-frozen in liquid nitrogen and stored at −80° C. prior to use in β-glucuronidase enzyme assays.

For all experiments, aseptically germinated Arabidopsis thaliana (Col-0) seedlings are maintained in a growth chamber at 21° C. under a 16-hour photoperiod and light intensity of 150 μmol m−2 s−1. Seeds are first surface-sterilized in 70% ethanol for 5 minutes, then rinsed 2 times in sterile, distilled water, followed by treatment with 0.5× bleach (3% sodium hypochlorite) and 0.05% Tween-20 for 10 minutes, then finally rinsed 4 times in sterile, distilled water. Following surface-sterilization, seeds are placed on top of an approximately 2.0 cm-high stack of 9.0 cm #4 Whatman filter discs and allowed to air dry in a sterile hood. Approximately 40 seeds are distributed evenly over the surface of a sterile 0.3 inn microporous membrane raft supported by a buoyant float (Osmotek Ltd., Rehovat, Israel). Seeded floats are then placed on liquid Germination Media (0.5× Murashige and Skoog salts, 1× Gamborg's B5 vitamin, and 1.0% sucrose (w/v), adjusted to pH 5.7 with KOH) in Lifeguard™ tissue culture vessels with 4.0 cm vented lids (Osmotek Ltd., Rehovat, Israel), cold-treated for three days, then transferred to growth chambers. After ten days, total seedling root systems are briefly washed in distilled, deionized water, gently blotted on Kimwipes, and then either directly submerged in X-Gluc solution (for histochemical analyses), or flash-frozen in liquid nitrogen and stored at −80° C. prior to use in β-glucuronidase enzyme assays.

Fluorometric quantitation and histochemical localization of β-glucuronidase (GUS) activity in genetically altered A. thaliana or O. sativa tissue isolated above are determined as follows. Extracts prepared from root systems of either 10-day-old genetically altered A. thaliana or 2-week-old genetically altered O. sativa transformed seedlings are fluorometrically assayed for GUS activity using the protocol described previously by Jefferson, et al. (1987). Fluorometric measurements are made using a Tecan SpectraFluor Plus microplate reader (Tecan Systems, Inc., San Jose, Calif.) calibrated with freshly prepared 4-methylumbelliferone standards dissolved in 0.2 M Na2CO3. The protein concentrations of extracts are determined using a Bio-Rad protein assay kit (Bio-Rad Laboratories, Inc., Hercules, Calif.) with bovine serum albumin standards. Histochemical localization of GUS activity is performed in overnight incubations at 37° C. in a humidified chamber, as described by Jefferson, et al. (1987). Following incubation in X-Gluc solution, tissues are cleared with 70% ethanol overnight with gentle shaking at room temperature, and stored in 70% ethanol at 4° C. prior to photomicroscopy.

For genetically altered O. sativa plants, two week old roots containing 2_32 promoter and 3′ sequences (FIG. 6A and FIG. E), 2_36 promoter and 3′ sequences (FIG. 6B and FIG. 6F), 2_23 promoter and 3′ sequences (FIG. 6C and FIG. G), 2_35 promoter and 3′ sequences (FIG. 6D and FIG. 6H) clearly have GUS activity within root hairs (FIG. 6A through FIG. 6D), and within developing trichoblasts proximal to the root apices (FIG. 6E through FIG. 6H). Significantly, the observation that all four expression vectors encoding GUSPlus operably linked to the specific promoter and 3′ flanking sequences are active in both immature and mature, root hair-bearing trichoblasts indicates that transcription activity is not restricted to specific developmental stages in this cell type.

A similar analysis performed using 10-day old seedlings' roots from genetically altered A. thaliana containing either 2_32 promoten:GUSPlus::2_32-3′ cassette (FIG. 7A and FIG. 7B) or 2_36 promoter::GUSPlus::2_36-3′ cassette (FIG. 7C and FIG. 7D) indicates that these two promoter/terminator combinations accurately directed root hair-specific expression in a dicotyledonous plant. FIG. 7A and FIG. 7C show genetically altered A. thaliana root segments containing root hair-bearing trichoblasts transformed with 2_32 promoten:GUSPlus::2_32-3′ cassette (FIG. 7A) or 2_36 promoten:GUSPlus::2_36-3′ cassette (FIG. 7C). FIG. 7B and FIG. 7D show genetically altered A. thaliana root apices showing immature trichoblasts prior to root hair initiation transformed with 2_32 promoter::GUSPlus::2_32-3′ cassette (FIG. 7B) or 2_36 promoten:GUSPlus::2_36-3′ cassette (FIG. 7D). This transcription expression in a dicot suggests evolutionary conservation of the regulatory mechanisms controlling the expression of at least two genes investigated.

For 10-day old seedlings' roots from genetically altered A. thaliana containing either 2_35 promoten:GUSPlus::2_35-3′ cassette or 2_23 promoten:GUSPlus::2_23-3′ cassette, very faint staining is, however, inconsistently observed following overnight incubations, suggesting that these promoter/3′ flanking sequence combinations might accurately direct expression in Arabidopsis at levels below the limit of detection of the histochemical assay employed.

In contrast to rice, Arabidopsis trichoblasts develop in columns along the root axis and undergo extensive cell elongation (Dolan and Costa, J. Experimental Botany 52:413-417 (2001)), hence GUS histochemical staining appears as stripes along the surfaces of Arabidopsis roots (see FIG. 7A though FIG. 7D). As is observed in the genetically altered rice, in genetically altered Arabidopsis containing the 2_32 promoten:GUSPlus::2_32-3′ cassette or the 2_36 promoten:GUSPlus::2_36-3′ cassette, staining is clearly visible in mature, root hair-bearing trichoblasts as well as immature trichoblast cells in proximity to root apices.

β-Glucuronidase (GUS) activity levels in roots of the genetically altered plants are also determined for experimental groups comprised of multiple, independent transgenic events harboring each promoter::GUSPlus::3′ region expression vectors in both rice and Arabidopsis, to examine the relative strength of each root hair-specific promoter/3′ flanking region combination (see FIG. 8A and FIG. 8B). For these experiments, quantitative fluorometric assays are performed to determine GUS activity levels in genetically altered seedlings grown either in synthetic media (rice) or aeroponically (Arabidopsis) as described above to circumvent the potential loss of root hair cells during root system harvests. Significant differences in GUS activity levels directed by each promoter::GUSPlus::3′ region cassette are then identified via non-parametric analysis of variance using the Kruskal-Wallis test (for overall significance) and the Mann-Whitney U test (for performing pairwise comparisons; p<0.05). As seen in FIG. 8A and FIG. 8B, box-whisker plots of GUS activity for each genetically altered plant indicate the minimum, first quantile, median, third quantile, and maximum GUS activities observed in populations representing multiple independent transformant lines.

As shown in FIG. 8A, the highest median GUS specific activity levels are found in populations of genetically altered rice seedlings containing the 2_32 promoten:GUSPlus::2_32-3′ and 2_36 promoten:GUSPlus::2_36-3′ cassettes, which are both significantly more active than populations of genetically altered rice seedlings containing either the 2_23 promoten:GUSPlus::2_23-3′ or 2_35 promoten:GUSPlus::2_35-3′ cassettes. Although median GUS activity values are higher for 2_32 promoten:GUSPlus::2_32-3′ cassette transformed rice relative to 2_36 promoten:GUSPlus::2_36-3′ transformed rice, these differences are determined to be insignificant (p>0.05). Additionally, median GUS activity levels determined for 2_23 promoten:GUSPlus::2_23-3′ cassette transformed rice are significantly higher than those levels observed with 2_35 promoter::GUSPlus::2_35-3′ cassette transformed rice. Taken together, the data indicate a hierarchy of 2_32 promoten:GUSPlus::2_32-3′ cassette=2_36 promoten:GUSPlus::2_36-3′ cassette>2_23 promoten:GUSPlus::2_23-3′ cassette>2_35 promoten:GUSPlus::2_35-3′ cassette for relative promoter/3′ flanking combination activity in genetically altered rice plants. Of further significance, these results are in general agreement with the RNA-seq mean FPKM values determined for the respective endogenous transcripts (see Table 2), indicating that the use of the approximately 2.5 kb promoter and 1.5 kb 3′-flanking sequence in the transgene cassettes accurately confer the transcriptional activities of the endogenous S. bicolor genes.

As seen within the genetically altered rice transformant populations, genetically altered Arabidopsis plant seedlings harboring either the 2_32 promoten:GUSPlus::2_32-3′ and 2_36 promoten:GUSPlus::2_36-3′ cassettes exhibit significantly higher median GUS activity levels in roots than the roots of the genetically altered Arabidopsis plant seedlings carrying the 2_23 promoten:GUSPlus::2_23-3′ or 2_35 promoten:GUSPlus::2_35-3′ cassettes. See FIG. 8B. However, the roots of genetically altered Arabidopsis plant seedlings containing 2_36 promoten:GUSPlus::2_36-3′ cassette also exhibit significantly higher median GUS activity levels than the roots of genetically altered Arabidopsis plant seedlings containing 2_32 promoten:GUSPlus::2_32-3′ cassette (FIG. 8B). In contrast with the results obtained from genetically altered rice (FIG. 8A), the median GUS activity levels in roots for 2_35 promoter::GUSPlus::2_35-3′ cassette transformed Arabidopsis plant seedlings are higher than 2_23 promoter::GUSPlus::2_23-3′ cassette transformed Arabidopsis seedling roots, however these differences are determined to be statistically insignificant (FIG. 8B). Additionally, the data indicate a hierarchy of 2_36 promoten:GUSPlus::2_36-3′>2_32 promoten:GUSPlus::2_32-3′>2_35 promoten:GUSPlus::2_35-3′=2_23 promoten:GUSPlus::2_23-3′ for relative promoter/3′ flanking combination activity in the dicotyledonous model Arabidopsis. Taken together, the data clearly indicate that both the 2_32 promoten:GUSPlus::2_32-3′ and 2_36 promoten:GUSPlus::2_36-3′ cassettes exhibit the highest root hair-specific activity in both a representative monocot and dicot host among the four expression vector constructs, and the 2_23 promoten:GUSPlus::2_23-3′ and 2_35 promoten:GUSPlus::2_35-3′ cassettes would, perhaps, be more suitable for situations when lower levels of heterologous gene expression is required or desired.

Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which these inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation. All documents cited herein are incorporated by reference.

<160> NUMBER OF SEQ ID NOS: 75

<210> SEQ ID NO: 1

<211> LENGTH: 2500

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 1

acactagaat cactctccca ctcaatcaga tgatcactat caagcataag tgagttagag 60

ggctcccaag cgccaccaca taagccacca aggccctagt gggctcagca actagccaaa 120

gggcggccac acttctattt atagccacaa gggctaaaca agccgttgcc ccttcactag 180

gcaaaacgcg ggggcgtcgg acgcaccacc ccagtgtccg tagctcatga agcagccacg 240

tgctactagt cgtttgaact taaccgttgc cgccaacggc taactcacac gtgccgaggg 300

ataggacgtt ctggcacaac ttgtcggacg ctagcacctc acgtccgacg ctgcttagag 360

agttcccaaa cttggttaca caccatcgga cgtgtctgac gggtgatcat cggacgcgtg 420

ccagcgtcct acacgtacac ctcgcaaaac gttgcgtgcg ttggacactc attagtactc 480

ggtcagcatc cgacacaaaa ccttcggaca tgccaatgca cagtgcaact ctatcacaca 540

ttgtcgaacg caggtctagc gtccaacgct gccaagtctt gctcaagctt agctgtcaca 600

cgcggtctct cgcttcaaag cctccgactt gcccttcaca catgcaatca gtccgtcaag 660

ccaagcctta tctagatctt ctccatcttg gtcacatgac tccatgtcat gtctcatatg 720

caatgagctc ctccatcatt acatattcac ctatagacta atctcctgtg tatctcacat 780

aaaaactatt agtccaccta agttattcaa ttaccaaaac caaacaagaa ccttttagcg 840

ggtaactttg acaaaaagtt tgaagacaca acagatgtca atgatgtgca tgatccggat 900

gactttggcc atgattttca gtgaggaaga gaaaggctat agaacataga taaggcatga 960

ctgtgtttgt gatcgaggga ggtagtttag taaagaattt ttggtgtata ttataaagaa 1020

agtagtgata aaaaggatag tttttggtgt ctacactaat aaattaatca agcatgcatg 1080

gacccaacta tatatcctaa tcctaatggt ataatggtaa ataatccatt catggtccat 1140

gatccttgga tttgggtcca tggcaattca aaaactagct atctctctct ctctctctta 1200

gtctctctgc caaagatatt tgaagcacat tctgacggca ataaaaaaag acgtaaaact 1260

agcgggcgat gaactcattc accattacaa ccattaaatt taatgcaaat taagtaccgg 1320

tttaatatag aaaattatga ataacatgtt ttgtgacatc tgacatgtgc atgtgtgtac 1380

atgtttctaa ttatcatgat tttaatcata gaaaacaaag gacggtttgc aacaacatac 1440

ccaacgacac taaagctgac gctagttgcc atagaggttg tctatgtagc acaaccaagc 1500

taggatttag tgaggggtct acctagaagg cgcatccgac aaagaagacg agaaagacga 1560

tgtggtggca agggagcccc tcctcggatg gctgcatggg aaggcgctca caacaaggat 1620

ggtggtggat ggagacgagg aaaaaggtcg agccagggaa gaagaacgga gatggtgcca 1680

gacctcgact gtgaaatcta ggaccagtgc ctcttgtgaa atcatttgtg cagcagtgtt 1740

acttttccga gctaagaagg ttggtccatg tggctcaaat taaagttgat ggataggcca 1800

gtgatcaagc aatgtagacc caaaggttgt gtccgaaatt ttcatttacg tttcaatgtg 1860

gtttctaaaa aaataatttc aatgctacac caaaacataa gaattataga gttttgtcgt 1920

ggctttgaaa cttcttccaa tcgtgctagt ttaatttgta tatcaggacc atgctattcc 1980

tctggccttg gttcttgcgc atccattcta aatgagcacg cgccacgcca cacattcctt 2040

cttaatcacc agctgcttcg ctagcttgac atccaatgtc ctgggcacca ctccgtcgga 2100

tccgccagga tgcccagctg aaatgatgcc taatgatcat atgaaaacaa atattagtat 2160

acgagctggc catttgcgga gccaaccgaa gtcgtcgtgc acaaaatatt tgataccgta 2220

tcacggaaaa cactaaatat acgatgtagg caataatcta gaacggactc ttcctcaccg 2280

gtcgggttca cctgtatata tttgaatatg atgactcggt tcatttgaac actatcgtgc 2340

ctagtagtgc accgatttct taatcctaag gctggactat aagtatccct ggtaacaccc 2400

cgtgatcaaa gcatcgcaaa ctagctgcta atcacttgtc aagagctctc tgaccatatt 2460

agctctagag tgatccgcga gctggtgtga tcgagcaata 2500

<210> SEQ ID NO: 2

<211> LENGTH: 1660

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 2

tgagcgcctg gatctcagcg ccttgagaca tcttgtcttt taatttcagc tcggttttaa 60

tgatgcgttg ttatttgatt gcttttccac gtagtatgat gtacgactag tcagcataca 120

tgcatgcacg catggccggc cgtgctgtca aattgtattt ttttcatttg ttgaaaaaaa 180

gccggcgatc acttgtatgc cggtgctaag ttccaatcaa gtttggtttg cgatttattt 240

cacagtttcg catgcatgtt ctggttatat tctagtcgta cttgagcata tgaaaacgta 300

ctgtctacca cgtacttatt ctcttgagtg tcactgagaa ggaatgtgtg ttggtaagct 360

ttcttgaatc tgacaaatta tgtaaaataa atattatcaa tatttacatc ttcacgtagt 420

ttataataaa aatatattta ccgatctatc taatgatact aattttacac cataaatact 480

aatatttctg tatatatatt tagtcaaaat ttaaaatgtt taacttctca gaaggtgaga 540

atgatactat ttgtcagacg gtggtgcggg gtgtcggaca aaaatcagac ggtggcgcag 600

tgcatgcggc cactagcagc ggtgcgcgat ccacacttcc tccagcgcag cgtttggggc 660

aatcggcgat ggcacgcagg ccctatgtcg gtagtacgct gctcccttcc tctagtgagc 720

gtggatccga cgagcggatc cagcgacaat ggcagcacgt gaatgggctc ggcgggcctt 780

gtggataggc ttggagggcc tcatcgatgc gcatgccatt tcttattttg ttaacacaga 840

tgagcaagtg tccgcctgca taaatcttga tttatactgg tgttgaagga gaggcagacg 900

tactggctgc ccgactccaa aaaccaatta tggtcaccta ggaaaattgc tattgtggtg 960

gtgttaaccg ataaaacatc taaagctatt tttttagaag ctactgcttt cacagtataa 1020

ttttcacacc ttgaacccta cttcttgctt tcagttattc caacttccaa atgggtggaa 1080

atatagcaac atttcataat catttcaaga gagattagat tggataggta tgaggggctc 1140

atcctcctta tcttttgcat ttagcaattt cttttaaact ttaatagcta caaacttata 1200

ggagaggctt tacatttcca atggcagtaa gaggggctcg acgccgctcg actacgtgct 1260

agatccaccc ctaataggtt ttgtagttgc tttaaccaaa caacttataa tttttctaga 1320

gcgcatagct cacatgagct ttttcatagt tatctggtga cagttgaact atacagaccc 1380

ggagttaagt cgtctgcgaa ctaagagcca ctcaactgcc tcctctcttc ctcatccatg 1440

catgagccac taatgcatca ctcttccgtc cccatggatg atgcacaccg cttcgccgcc 1500

tctgtccctc agccatgctt gtcttgcttt gccacctgtg tcttttctcc atgtgcgtta 1560

tacatgggcg gatccatata ggatctactg ggtgcggcca cacccagaca aaaatacaaa 1620

atatgctata ctttgcatgt ttctatggta ttcgcacccc 1660

<210> SEQ ID NO: 3

<211> LENGTH: 2543

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 3

ttagctagat cggatggtta agaacctagt aagaggaact taagttgtag gctagaacca 60

aaatttagta gacctagagc cagctctagt taaattgtaa gggtgcgcat aactccataa 120

tccataattc tagccaccca ttgtgtcgcc gacccagagt cccagactag gaatcgacgc 180

ggacaggcag gcagccctct ccgactccgt gggcaccgtc gtcgcagcta ctcgttgctc 240

cgtctacgaa agaatcaatt tttaaagttg ttctaagtca aactttttaa actttaacca 300

aatttctaga aaaaaatact aagatttatg gtatcaaatt agtatcatta gattcactat 360

agaatatatt ttcatatgat acgtatttta tatcatagat ttgttaccat tttctataaa 420

attagtcaaa cttaaaaaag tttgacggat acggattcta agaattgatt cttttatgga 480

cagagggagt acatacagca ggctgtgtct gtgcaaacgt ccggcttcta cgacgggcgg 540

ccaggttgag gtcttgttta gatccaaaaa gtttttggat tttaacactc actttcattt 600

ttatttgaca aacattgtcc aatcatagag taactagact taaaagattc gtctcgcaat 660

ttacagacaa attgtgcaat tagttttttt tatcatattt aatgctctat gaatatacca 720

taagattcga tgtgataaaa aatcttaaaa aaattgtttt tttagtaaac taaacaatgc 780

cgtgccgtgg gcgtgggcgt ggagaacatg caatgcattg catggggaac atcgatgaac 840

caaagttaat gggcacacta aactgcatgc cccagacaca gttttaaaat ttatttacta 900

atatagcaac aaaaaaaaac aaatatatgc acgcccgcac gcacgtcctg tgcatatata 960

tatgcacgga cgctattcaa atcaacaggg agaggacagt ttggtcggtg gagtatctat 1020

ctacactaaa aaataccgcc ctcctctact cagctcgtcc ccgatttttt taactcctcc 1080

tccaaatcac aatcagatat caaatcaaat caaatcattc taaatcgaaa aaaaaagaaa 1140

atattaaatc aaatcaagaa aaaatataag tcaaatacac agaatatccc atcatgctca 1200

tcttgtcctt ggatattttg actctctcct ccaaatcaga atcggatatc aaatcaaatc 1260

aaatcgttct aaaaccgaat aaaaaaaaga aaatatcaaa ccaaatgaaa tgaaatcgag 1320

aaaaaaaaaa tcaaatatgc agggtatcgt agtaccatcc tactctgttc agctcatccc 1380

caaatttttt ttgccttgct cctcgaaatc agaatcgaat atcaaatcat tctaaatcca 1440

aatcagaaaa agaaatatca aaccaaatta aatgaaatca taaaaaaata taagtcaaat 1500

atgcaaagta tcattttgac tcgctcctcc aaatgagatc gaatatcaaa atcgaatcaa 1560

attgtttgaa atctgaattt taaaaaataa aatatcaaac caaatcaaat gaaatcggaa 1620

aaaaatacaa gtaaaataca cagggtattg tcgtaccacc ctgctttact caacttgtcc 1680

ttggattttt ttgcatgtct cctccaaatc agaatcggat atcaaatcat atcgttccaa 1740

atccgaattg gaaagaagaa aatatcaaac caaatcaaat gaaatagaaa aaaaatacaa 1800

gttagtgtgt tgttgcaact gtattgaaac ttgacctctt gccgcctgcg cgagggctcg 1860

tgaactagca ggctgtcact gtaaaaataa tagtatcagg tacaataaca gtgtgattcg 1920

actgttatat cattcatata cacgtaaaag cggagagaga aagcaatgct tttgttgatg 1980

agcttgtgac gcatgtcaag acgctttttc taagcagagg ttaactcttc ccatcctatc 2040

cttgtatatt gaataagaaa acaatattta gactatagaa agggactaat tgttgtatgt 2100

gctagactct aaataaactt gtctaataat gacttggctt ggcttataga taaattttat 2160

taggcttgct ctaaaacctg ccctcacaca tgatccgaaa cttgtggggc aataaaaagc 2220

gaaactattc tgtatattaa gctcgtgctt tgtgctacct gaaaaaaaat acaaacaggt 2280

aagccattgc gtaacaaaaa aaaaatgaaa agaacaaaga aacaattaag aaatccgcct 2340

acctgatcgt gcattgtgct cggttactaa tgtacttttt aaaaattgga atggatggat 2400

ggttttcctc tgactggctg gctggctgcc tgctgcttat aggagtacta tataagtaga 2460

cgcatgcagt acccaaacga cgacgccgcc accaccgcaa aagcagcaaa accttagctt 2520

gttcaccacc acaaccgcca gcc 2543

<210> SEQ ID NO: 4

<211> LENGTH: 901

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 4

cttgcatcat tgctgggagg gatccattcc atgcctgcgc tttgccagct gggaataatg 60

atagatgccc gtacgtacgt ctcgatatgc atacggttga tgttggtgtt gaatacctcg 120

cgctctcgta ttcgtatacg gagtagtagg tgaagtcagt tggtgcaatg tattccatct 180

gttcgtggcc tatatattat gcaaaaaaat aatgtcagaa taattaaatc acatgtgtga 240

gattgaataa ataaccaatt tctccgcatc gtttatatat taattgtaca gtatatatag 300

taggatcagg agtaatgcat gcttagctac tctatatacc tctcaaaaac gattgtgtac 360

tataaattca taataggcga aggacctgct gtataaacgc tgctggggtt accggccggg 420

catatacata tcctcctttc ttatcagcaa ggcctgctgt actaaattca taataaggac 480

cccagcagcg tttcgatcgt cgacatacat atctcctacc tacagcttct tcgacggaca 540

aaacttggtg tcttgctgtg gatttataat gggcttggcc catatacatt tagtaaatca 600

ataaactcgg tgtataatta atacaatacg ggatatattg ataaaacatt aactagactt 660

atatggttgg attttatcct tctatattga gaagttgaga aaagtacaaa ggcgtgccac 720

acgtgcgcgc actgccgccg cccaggccgt gccgccaatc aaaactcata ataacgtgag 780

tttcttcttt tgtattatca cgattaatct ttgtctgtta cgaactcttt gcttgtttgt 840

ctgtctcttg agttgactgc gatcccttct cctgcctcta cctgcgagaa taaaatctcg 900

a 901

<210> SEQ ID NO: 5

<211> LENGTH: 2521

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 5

tctgggtact gctattgagg ccttgtctcc caaaatgggg cttgaatatg catgagtata 60

agaagacaga ataacttgaa cacatgtcaa caagggacca acaatcaaag tattatattg 120

tattcaagta tactttgcta ttatatctta tagaatatat tatatattct ccaacgccat 180

aatttcataa tagatgggta gccacggttc atcctgggct aagtttcaac ccaactggaa 240

caatttgtaa ctttattgtg tcgtaattgt atcagcttat ggggttagcc attctaccct 300

atgtaataat atatgtttat atgttgcaat gcttatggtc ctaaggtttc actaagtgct 360

tatcattgtt ggctgcatca ccgccagtct gttagaaaaa aggacatcac gccaggttta 420

taaaccaact gtagtgaata tagcgacata atttgagata tcattgggat ttacatatcg 480

tttctttttt ttttcttttc acaaagcact tagccactta ggacacttcc tttcttcctt 540

ccttccttta agctggacta ggaaacacaa agagtctggg ccttgacgat agcatggatt 600

gggacgactt tgtcttttgg gcttcttggt catcatcgtc tccatgcgtg tgccaccagc 660

gttcccgttg ccctcctcat cctttctgac agatgccccc ttggtaccgt gacatttctc 720

tcttcttgag aaccggcttg acccaagcca gtgccaccgg aaaaatgagc ttcagcacgt 780

gctcattctc ctaggttgac gtacacaagt gcacgggcca ttctgaccaa tgaacaagaa 840

cttgattgaa acagaaactt catcattgcg tctacacact tagcataatg attagtccta 900

agatttcatt aattattaaa atcaaactag ggctttcata tgggtacgta ccctatgtct 960

acttgaagca ggccttgaca caagagtcca agaaggcata ttccatagtt ctacgattgt 1020

cgtcggtgtc ctcttggtaa cagcgattcc ctccttggtc aatctgctgg tgatcgcgat 1080

gaccctgtca atgagatcgg aggagacatc gggcaacaac ctcctcttta agactcggtc 1140

acctgacctt tgttgagatc atcccaacac aaactgctaa aaatctcggt tcacgatttg 1200

atccatcatc tgaagcaagt gcaaacataa ttgctgattt tgtgtcaaat gagaaatata 1260

atgcaatagt gatgtgaagt atataccctt cttttttttt aggaaacgct aatggtttga 1320

tgacaatttt gttgtgcttt ttactttctt ttcacattta ttttgtactt ctgatttttt 1380

aaagtgtaaa acacaattac tttgaagaat tgggaaacaa tcagctcatg actccagcag 1440

taaaaaaggt taaactcgaa aaaaagggga aaatgatggt ttcatccgtg actttgaaga 1500

ttcatgaatc ggagtaaaaa aagaagaatt gtgaatcaca aaccctttgg ctcttgtatt 1560

cgaaaaagtg ggtcctgtta ctcctgtagg tgtcatatgt gacaaaaatt atcatagctc 1620

aaagaaaaaa aactgtaaac aaaaatggct acccacctgt ttcgtgacgt ggtggctctt 1680

gtacatatat atagggggtg tttgagattg ctctgctcca aattttttta gctccgcttt 1740

atgtttttta gtcaaacagt ttcaggtcca cgcactcagt tttaaaaaaa tggtggagtt 1800

gtgagagcac ctagagaggt actctacaaa ctccggtttt ttgtgaagct gtttcatggt 1860

ggagtttgtg gagcagagtt cgtgaagcaa tgccaaacac ctagtaacat ggtgttgtac 1920

gtggccgaaa ccaccgtagt tgaaaaaaca aaaaccgtgg aagcaaaagc cgctataggg 1980

taacttaata agctcattaa catacggtaa cacaaacaaa gaagaagttt tcacacgtgt 2040

gtgttatatt tttctgttca gattacccaa gatcggagat acgtttttga attaggattc 2100

ctttcggcgg agagacgttt ttgaattagt aaaaataaaa atataaaaga tacgctgccg 2160

atgcgttttc gatacatatt ggagaagtat cagaaaacaa aataaaaata acacaaaatc 2220

tgatagtcgt gaggggatat gtatatcagc ctggtcaact cacgccggcc ggtactactc 2280

tgtgagggct gccactactg cttatcggag aagtattcat cagaaaataa aaacaaaaaa 2340

cctgatactc gaggatatgc tacgtatcac aactcacgca gatacgacgg ctagctgaac 2400

agcccacacc cacaccctct ttataaatgc atggctcatg cggcgctgct ccatattgct 2460

cccattcatc ctcgtcctcc acgagcctgg ctcacaggct gtacgtcgtg cgtcgtcgtc 2520

g 2521

<210> SEQ ID NO: 6

<211> LENGTH: 1441

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 6

tagcagagga acttactgtc acaacgcctc tgccaagtcc aataatgtgg atccgtggcc 60

ccatggccgt ctacttatct atactgtact tgaatcaata atctccttgg acatatttgc 120

catgacatgt caaataattt ctacacgact tttgatttat ggatcaaaaa actgttgcaa 180

ccttgctctt cttgttttac tcttttttta tcttttttta tttcctaagt tgttgtactg 240

tgttttcctc tttttaattt caataaatct cctatagggg ctaaggcccc tccagttctt 300

tttttaaaaa ataattttta ccacttgtgg agatattcta aattcactgt tcataggctt 360

ccatttgtat tgatcgagac attgagtgga gtgccctatc cttccacccc accctctgct 420

ggtcctcttt attaagggat ccgtctatat ttgacttgag tgatgtccgt gttttgtaaa 480

ctaaatagtg aatttatacg tatcgtgtag ctttaggaag acgacactta tagacacgag 540

ggttatactg gtcaggcggc cgcagcccta cgtctagtct caaagatggt ttaagtctgt 600

gtttctcgat tgaatgcttt gaagttctta cgataggtta agtaagctaa ggaagagagg 660

taggagggag gagtgaggtg aacgaatgat gagtacatgc ccgatcttct gagaggtaac 720

tggtaagttt gatttgtgga gatctcgacg ttggcgatcc ggcttcaaac cagacacgat 780

tcgaaccctg caaccgttac accactgatc cgttggttat caaccaagca caacttgatt 840

gacctcgcca agaaggcttt tcctgcaagc gaatcgaaga acacaagcaa gaaggtttaa 900

acatgcaatc tgaaattgca aatatgaatg acacgaatat caatagaggg ttcaagaact 960

cggtttcaaa ggactaatcg acgcagtgga ggagattaag aacgggagca ctggatcatt 1020

gtaaaaggat ttgtcaccac agttacaatg aacgattcag tttctcgatg gaaaactaaa 1080

ctctaaacaa aacccaagtc tcgacagctt gcggctgcgt ggaatataaa agagaggcgt 1140

cctaggattg gaaggcgacc agggatggtg cccacaactt gggcttaagg tctgactcat 1200

tacatagcca agttggctta aaatagatga cgcatcaact tatcgtagtc acacagatta 1260

atccacgtgt catctggagc tgggacaaga tccaaaacga tgacatcgtc gtcccctttc 1320

caatgagtcc aagatctccc tatttcgatg tcgtatgaag aagttatgat cgaaacatta 1380

acgacgtgtc tgctgaattc gagggtgacg tgacagctga gttggagatg agttgcaact 1440

t 1441

<210> SEQ ID NO: 7

<211> LENGTH: 2620

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 7

caatatgcat cggcatcttg ccgatgaggc ggctgcggat ctggcacctg atggcgaacc 60

tccacgtgtc tgttcgggac gtgatctgta cggaacattg tattgatcac ctgtcctcca 120

atctgcggac caccaaactg ctgtccaccg attggctgtc ctccgaattg ctgtccaaaa 180

ttcattggct ggttgggaat cccctgacct tggaacccgg gatagacctg cccttgctgg 240

aaccctgtag tctggtaact ctgctggggc gattgtggaa aggcttgctg tccaaaccat 300

ccactattag cgttcatcgg catagatgct gccgatgatt ggtaattggg taccgtcgtt 360

gaattgacat accccgactg ggccgcagac ctctgttgta tcagcattga ctttgccgat 420

gcgttgggca tctggaacat tgaatcttga ggatttccag tgtgaggcct tgcagtagtg 480

gttgtggtat accgaggact ctggttcatc ggcgcattgg gaggtgccga tgtcatagga 540

gttttgcccc tcatgtcagt tatctgtgat gttcccggtg tcacctctgg aggcataccg 600

taaccccacc agttgggagg aagagtcaac cctgacattg ccaatgccaa catatctgtt 660

gtcagtttat gctgcccaac tgaaatctgt gggttggttg ccatcggcat agatagtgca 720

ccagtagtcc ccgatgtact tggagggacg gcagattgtg cacttgcatt cgtcaaggca 780

gccgacggag ccgtgacctc tggtgccgtt ggctgatgat gggaggggcc cacatactct 840

ggtgggattt gtccttcctt gaaagtcctt gccacggcat tgaaaaccgt attagacagt 900

acaccagctt ggttaatcaa cgctcgattg atggcattgt caaccatatc ttgaagcttg 960

ccaggattgg cgtcaaaggt aacctgccgt ggtgccggca gcgcatcttt ctgaaccact 1020

tcgccgctcc tgtttatgct gaaagacctc aggcattgct gcttgaactc ttccatggct 1080

tgggcaatag cttgcttctg ctcatccttg aggttggcct ccgtcacggg gatgacgttc 1140

tcttgatcga ggtcagagat cgacatgttg atcttgatct tgaatctgtc ccaccgggcg 1200

tgccaaaaga tgtgttgatg caaaagctga tctgcaaaca caaagggcta atacccgatt 1260

tcaacgttaa ggcgtgccag ccgatttgac cttactatcg gcaaaggtga taactcgaat 1320

actttggtcc cgacaacagc gatgcgccca gatgccacgg ccaagaggta ttcacgcgga 1380

acttgagaac acgccgagct taagtcgacg aattcctaag aactcgtaat aaaaaggaaa 1440

aagtatgaca aagtcgtcga aatagtagat gctggaatat gagtaaaaac ttgtgtttga 1500

ttgattgata gatcattaca aggccctagg gtctatattt ataccctgct caaagagtta 1560

caaccagaca caattagaat tcgaattcca aattacacgg aatccgtata caaaacgatg 1620

taaataatta aggaaataac aaaactatcc cccgtgacaa actgaaactc ctccacacaa 1680

cgaccggcag cttccggact ccctcttttg catcatcggc agaccctttg ccatagtcat 1740

cggcagactt tcttatctag ccatcggcac aatcacatca ctgtctgtag acttagtcac 1800

gttcagcttc tccttcatcg gcaactatcc tcatcggcaa cccaccctgt agacagcata 1860

ctgccacctt atcctgccat cctagacaca tgcccaaaaa cggtgtcaac agtacttggt 1920

gtcttggtga ttgaatacta tcagcgaatc aggtcaacga tctactagca attaacaata 1980

tatcatttct taatcttttg ctagttccgt ttcaattaga aaactatctc taccactcat 2040

ctgcatgcta ttgttcttaa ttaattactt gatatatatg gagcatatct ctaccactct 2100

catctgcaca tgctaatata atatatagtg atttgcacga ttcacaatca ataatttgca 2160

tgataatata ctggaacacg tgaaccagag gcacttacgg ccgcgtgttt attacttaat 2220

ttgccatata agatactata tgattccttt cacagattgg cagagatatg acatgtgtta 2280

tcttattctg tgattaacta tgtatatatg cccgggattt aatttttgcc tgatccgaaa 2340

caaatgggga accactactg cgtcgcattc ctcgcataag atatattcta cagtaataaa 2400

caacgacgtc tgcccacaga acgaaatcgc tcgaagcctc aaaacgacgg acggagtaac 2460

caatgcatgc ccaagctctc tatatatatt cgcttgaacg tctctccaat cacatcacac 2520

ggcgagctag ctaggaaaca aacacacatc aacatacagc aaacattaga caagaatcaa 2580

acacgttcgc aggaaaagaa tagaagctag ggaggaggaa 2620

<210> SEQ ID NO: 8

<211> LENGTH: 1483

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 8

accaacatac tcgatcggtt cctatatatg ctcgatgaag gtttacgtgg tgccatatat 60

tgccgattca gtgctcctgt tcgttcgtcc ttggtgcgat gttgttgcac gtgcggtata 120

tgatctgttt agtttatttt atctactatg aggtgtgaaa aggctattat gacctatgtg 180

ttttagaaaa atatgttatg agctatgtgg tgtggaaaat aaagctcttg tgagttttgt 240

gttgtgttgt gaaaaaagct ataaactgtt tctttgtaat aaatatgaaa cctgtcccct 300

tttttatctc ctttgaaaca gctataatac aaaatgcatc tctattgcaa tgaataatcc 360

tcttcaaaga gagaggtgcc ctcaggaata caggtggtgc atggctttcg tcagctcatg 420

ccgtaaggta ttgggttaag tctcgcaacg agcgtaaccc ttgtgttgat gtctagtcca 480

gtgtagctga cattgctaaa atgcatcaac ttggtgctaa aaataggaga acatatagca 540

ttataaagac tgcttaccaa ggggtttaat ataatgtgtc caagaataaa atttacaaac 600

ctcataaatg accccggtta tggtatttgt catggcaatt gcctgttcga ggtatgcaga 660

ttttcttatg cggccagcct tgagcggtga acagtactgc gggttcgtct tcaagggaag 720

tttcatattt ggagacaata ggttggacag agacagcctg tgctttggaa ccaggctcag 780

caagttgact tgtcgccttc acttgctcaa cttgggtgat gaggacaagg ccgctataca 840

tatagccatg cttagagaat cacatgcaga ccaagtagat caacaagggg acctgaatgg 900

agaagaaggt ctaaagctta tacggtttca gtcaccggtg gaagcctaaa tcaagttcga 960

gtccacctcg gaatctagga gcagtctgta gtaaaacgga tgcccaggaa acattctgat 1020

tctgtttttg atgatccaca tatggatgaa aagataattt gataagctaa ctaatggctt 1080

tagtttcacg tcaaaattca tccgaagtca acaggaatcg tcaaaacaag ttagcatcca 1140

gaatctgcaa gggtgctgcg tcactgtttt tggtccgttg ggttgtgtat catcattgag 1200

tccattagga gaggcgtcca gagggagtga cgaccctaac accttataat cagtaaccgc 1260

caccctcatt aggatttggg ttattctatt tacaatagtt tcactatcat tggtttttaa 1320

gaccccaact ttgtgagatt aatcattcat ttgcaaattt agttgcattt ttttgttctt 1380

gcttgtgttc tttgatttgc aggcaaggat tagccttctt ggcgaggtcg aacgtgcagc 1440

gccggtcaat aacctgagat gacgtggtgc taaggttgca tgg 1483

<210> SEQ ID NO: 9

<211> LENGTH: 2053

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: GUSPlus coding sequence

<400> SEQENCE: 9

atggtagatc tgagggtaaa tttctagttt ttctccttca ttttcttggt taggaccctt 60

ttctcttttt atttttttga gctttgatct ttctttaaac tgatctattt tttaattgat 120

tggttatggt gtaaatatta catagcttta actgataatc tgattacttt atttcgtgtg 180

tctatgatga tgatgatagt tacagaaccg acgaactagt ctgtacccga tcaacaccga 240

gacccgtggc gtcttcgacc tcaatggcgt ctggaacttc aagctggact acgggaaagg 300

actggaagag aagtggtacg aaagcaagct gaccgacact attagtatgg ccgtcccaag 360

cagttacaat gacattggcg tgaccaagga aatccgcaac catatcggat atgtctggta 420

cgaacgtgag ttcacggtgc cggcctatct gaaggatcag cgtatcgtgc tccgcttcgg 480

ctctgcaact cacaaagcaa ttgtctatgt caatggtgag ctggtcgtgg agcacaaggg 540

cggattcctg ccattcgaag cggaaatcaa caactcgctg cgtgatggca tgaatcgcgt 600

caccgtcgcc gtggacaaca tcctcgacga tagcaccctc ccggtggggc tgtacagcga 660

gcgccacgaa gagggcctcg gaaaagtcat tcgtaacaag ccgaacttcg acttcttcaa 720

ctatgcaggc ctgcaccgtc cggtgaaaat ctacacgacc ccgtttacgt acgtcgagga 780

catctcggtt gtgaccgact tcaatggccc aaccgggact gtgacctata cggtggactt 840

tcaaggcaaa gccgagaccg tgaaagtgtc ggtcgtggat gaggaaggca aagtggtcgc 900

aagcaccgag ggcctgagcg gtaacgtgga gattccgaat gtcatcctct gggaaccact 960

gaacacgtat ctctaccaga tcaaagtgga actggtgaac gacggactga ccatcgatgt 1020

ctatgaagag ccgttcggcg tgcggaccgt ggaagtcaac gacggcaagt tcctcatcaa 1080

caacaaaccg ttctacttca agggctttgg caaacatgag gacactccta tcaacggccg 1140

tggctttaac gaagcgagca atgtgatgga tttcaatatc ctcaaatgga tcggcgccaa 1200

cagcttccgg accgcacact atccgtactc tgaagagttg atgcgtcttg cggatcgcga 1260

gggtctggtc gtgatcgacg agactccggc agttggcgtg cacctcaact tcatggccac 1320

cacgggactc ggcgaaggca gcgagcgcgt cagtacctgg gagaagattc ggacgtttga 1380

gcaccatcaa gacgttctcc gtgaactggt gtctcgtgac aagaaccatc caagcgtcgt 1440

gatgtggagc atcgccaacg aggcggcgac tgaggaagag ggcgcgtacg agtacttcaa 1500

gccgttggtg gagctgacca aggaactcga cccacagaag cgtccggtca cgatcgtgct 1560

gtttgtgatg gctaccccgg agacggacaa agtcgccgaa ctgattgacg tcatcgcgct 1620

caatcgctat aacggatggt acttcgatgg cggtgatctc gaagcggcca aagtccatct 1680

ccgccaggaa tttcacgcgt ggaacaagcg ttgcccagga aagccgatca tgatcactga 1740

gtacggcgca gacaccgttg cgggctttca cgacattgat ccagtgatgt tcaccgagga 1800

atatcaagtc gagtactacc aggcgaacca cgtcgtgttc gatgagtttg agaacttcgt 1860

gggtgagcaa gcgtggaact tcgcggactt cgcgacctct cagggcgtga tgcgcgtcca 1920

aggaaacaag aagggcgtgt tcactcgtga ccgcaagccg aagctcgccg cgcacgtctt 1980

tcgcgagcgc tggaccaaca ttccagattt cggctacaag aacgctagcc atcaccatca 2040

ccatcacgtg tga 2053

<210> SEQ ID NO: 10

<211> LENGTH: 6213

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_23 promoter::GUSPlus::2_2-3′ cassette

<400> SEQENCE: 10

acactagaat cactctccca ctcaatcaga tgatcactat caagcataag tgagttagag 60

ggctcccaag cgccaccaca taagccacca aggccctagt gggctcagca actagccaaa 120

gggcggccac acttctattt atagccacaa gggctaaaca agccgttgcc ccttcactag 180

gcaaaacgcg ggggcgtcgg acgcaccacc ccagtgtccg tagctcatga agcagccacg 240

tgctactagt cgtttgaact taaccgttgc cgccaacggc taactcacac gtgccgaggg 300

ataggacgtt ctggcacaac ttgtcggacg ctagcacctc acgtccgacg ctgcttagag 360

agttcccaaa cttggttaca caccatcgga cgtgtctgac gggtgatcat cggacgcgtg 420

ccagcgtcct acacgtacac ctcgcaaaac gttgcgtgcg ttggacactc attagtactc 480

ggtcagcatc cgacacaaaa ccttcggaca tgccaatgca cagtgcaact ctatcacaca 540

ttgtcgaacg caggtctagc gtccaacgct gccaagtctt gctcaagctt agctgtcaca 600

cgcggtctct cgcttcaaag cctccgactt gcccttcaca catgcaatca gtccgtcaag 660

ccaagcctta tctagatctt ctccatcttg gtcacatgac tccatgtcat gtctcatatg 720

caatgagctc ctccatcatt acatattcac ctatagacta atctcctgtg tatctcacat 780

aaaaactatt agtccaccta agttattcaa ttaccaaaac caaacaagaa ccttttagcg 840

ggtaactttg acaaaaagtt tgaagacaca acagatgtca atgatgtgca tgatccggat 900

gactttggcc atgattttca gtgaggaaga gaaaggctat agaacataga taaggcatga 960

ctgtgtttgt gatcgaggga ggtagtttag taaagaattt ttggtgtata ttataaagaa 1020

agtagtgata aaaaggatag tttttggtgt ctacactaat aaattaatca agcatgcatg 1080

gacccaacta tatatcctaa tcctaatggt ataatggtaa ataatccatt catggtccat 1140

gatccttgga tttgggtcca tggcaattca aaaactagct atctctctct ctctctctta 1200

gtctctctgc caaagatatt tgaagcacat tctgacggca ataaaaaaag acgtaaaact 1260

agcgggcgat gaactcattc accattacaa ccattaaatt taatgcaaat taagtaccgg 1320

tttaatatag aaaattatga ataacatgtt ttgtgacatc tgacatgtgc atgtgtgtac 1380

atgtttctaa ttatcatgat tttaatcata gaaaacaaag gacggtttgc aacaacatac 1440

ccaacgacac taaagctgac gctagttgcc atagaggttg tctatgtagc acaaccaagc 1500

taggatttag tgaggggtct acctagaagg cgcatccgac aaagaagacg agaaagacga 1560

tgtggtggca agggagcccc tcctcggatg gctgcatggg aaggcgctca caacaaggat 1620

ggtggtggat ggagacgagg aaaaaggtcg agccagggaa gaagaacgga gatggtgcca 1680

gacctcgact gtgaaatcta ggaccagtgc ctcttgtgaa atcatttgtg cagcagtgtt 1740

acttttccga gctaagaagg ttggtccatg tggctcaaat taaagttgat ggataggcca 1800

gtgatcaagc aatgtagacc caaaggttgt gtccgaaatt ttcatttacg tttcaatgtg 1860

gtttctaaaa aaataatttc aatgctacac caaaacataa gaattataga gttttgtcgt 1920

ggctttgaaa cttcttccaa tcgtgctagt ttaatttgta tatcaggacc atgctattcc 1980

tctggccttg gttcttgcgc atccattcta aatgagcacg cgccacgcca cacattcctt 2040

cttaatcacc agctgcttcg ctagcttgac atccaatgtc ctgggcacca ctccgtcgga 2100

tccgccagga tgcccagctg aaatgatgcc taatgatcat atgaaaacaa atattagtat 2160

acgagctggc catttgcgga gccaaccgaa gtcgtcgtgc acaaaatatt tgataccgta 2220

tcacggaaaa cactaaatat acgatgtagg caataatcta gaacggactc ttcctcaccg 2280

gtcgggttca cctgtatata tttgaatatg atgactcggt tcatttgaac actatcgtgc 2340

ctagtagtgc accgatttct taatcctaag gctggactat aagtatccct ggtaacaccc 2400

cgtgatcaaa gcatcgcaaa ctagctgcta atcacttgtc aagagctctc tgaccatatt 2460

agctctagag tgatccgcga gctggtgtga tcgagcaata atggtagatc tgagggtaaa 2520

tttctagttt ttctccttca ttttcttggt taggaccctt ttctcttttt atttttttga 2580

gctttgatct ttctttaaac tgatctattt tttaattgat tggttatggt gtaaatatta 2640

catagcttta actgataatc tgattacttt atttcgtgtg tctatgatga tgatgatagt 2700

tacagaaccg acgaactagt ctgtacccga tcaacaccga gacccgtggc gtcttcgacc 2760

tcaatggcgt ctggaacttc aagctggact acgggaaagg actggaagag aagtggtacg 2820

aaagcaagct gaccgacact attagtatgg ccgtcccaag cagttacaat gacattggcg 2880

tgaccaagga aatccgcaac catatcggat atgtctggta cgaacgtgag ttcacggtgc 2940

cggcctatct gaaggatcag cgtatcgtgc tccgcttcgg ctctgcaact cacaaagcaa 3000

ttgtctatgt caatggtgag ctggtcgtgg agcacaaggg cggattcctg ccattcgaag 3060

cggaaatcaa caactcgctg cgtgatggca tgaatcgcgt caccgtcgcc gtggacaaca 3120

tcctcgacga tagcaccctc ccggtggggc tgtacagcga gcgccacgaa gagggcctcg 3180

gaaaagtcat tcgtaacaag ccgaacttcg acttcttcaa ctatgcaggc ctgcaccgtc 3240

cggtgaaaat ctacacgacc ccgtttacgt acgtcgagga catctcggtt gtgaccgact 3300

tcaatggccc aaccgggact gtgacctata cggtggactt tcaaggcaaa gccgagaccg 3360

tgaaagtgtc ggtcgtggat gaggaaggca aagtggtcgc aagcaccgag ggcctgagcg 3420

gtaacgtgga gattccgaat gtcatcctct gggaaccact gaacacgtat ctctaccaga 3480

tcaaagtgga actggtgaac gacggactga ccatcgatgt ctatgaagag ccgttcggcg 3540

tgcggaccgt ggaagtcaac gacggcaagt tcctcatcaa caacaaaccg ttctacttca 3600

agggctttgg caaacatgag gacactccta tcaacggccg tggctttaac gaagcgagca 3660

atgtgatgga tttcaatatc ctcaaatgga tcggcgccaa cagcttccgg accgcacact 3720

atccgtactc tgaagagttg atgcgtcttg cggatcgcga gggtctggtc gtgatcgacg 3780

agactccggc agttggcgtg cacctcaact tcatggccac cacgggactc ggcgaaggca 3840

gcgagcgcgt cagtacctgg gagaagattc ggacgtttga gcaccatcaa gacgttctcc 3900

gtgaactggt gtctcgtgac aagaaccatc caagcgtcgt gatgtggagc atcgccaacg 3960

aggcggcgac tgaggaagag ggcgcgtacg agtacttcaa gccgttggtg gagctgacca 4020

aggaactcga cccacagaag cgtccggtca cgatcgtgct gtttgtgatg gctaccccgg 4080

agacggacaa agtcgccgaa ctgattgacg tcatcgcgct caatcgctat aacggatggt 4140

acttcgatgg cggtgatctc gaagcggcca aagtccatct ccgccaggaa tttcacgcgt 4200

ggaacaagcg ttgcccagga aagccgatca tgatcactga gtacggcgca gacaccgttg 4260

cgggctttca cgacattgat ccagtgatgt tcaccgagga atatcaagtc gagtactacc 4320

aggcgaacca cgtcgtgttc gatgagtttg agaacttcgt gggtgagcaa gcgtggaact 4380

tcgcggactt cgcgacctct cagggcgtga tgcgcgtcca aggaaacaag aagggcgtgt 4440

tcactcgtga ccgcaagccg aagctcgccg cgcacgtctt tcgcgagcgc tggaccaaca 4500

ttccagattt cggctacaag aacgctagcc atcaccatca ccatcacgtg tgatgagcgc 4560

ctggatctca gcgccttgag acatcttgtc ttttaatttc agctcggttt taatgatgcg 4620

ttgttatttg attgcttttc cacgtagtat gatgtacgac tagtcagcat acatgcatgc 4680

acgcatggcc ggccgtgctg tcaaattgta tttttttcat ttgttgaaaa aaagccggcg 4740

atcacttgta tgccggtgct aagttccaat caagtttggt ttgcgattta tttcacagtt 4800

tcgcatgcat gttctggtta tattctagtc gtacttgagc atatgaaaac gtactgtcta 4860

ccacgtactt attctcttga gtgtcactga gaaggaatgt gtgttggtaa gctttcttga 4920

atctgacaaa ttatgtaaaa taaatattat caatatttac atcttcacgt agtttataat 4980

aaaaatatat ttaccgatct atctaatgat actaatttta caccataaat actaatattt 5040

ctgtatatat atttagtcaa aatttaaaat gtttaacttc tcagaaggtg agaatgatac 5100

tatttgtcag acggtggtgc ggggtgtcgg acaaaaatca gacggtggcg cagtgcatgc 5160

ggccactagc agcggtgcgc gatccacact tcctccagcg cagcgtttgg ggcaatcggc 5220

gatggcacgc aggccctatg tcggtagtac gctgctccct tcctctagtg agcgtggatc 5280

cgacgagcgg atccagcgac aatggcagca cgtgaatggg ctcggcgggc cttgtggata 5340

ggcttggagg gcctcatcga tgcgcatgcc atttcttatt ttgttaacac agatgagcaa 5400

gtgtccgcct gcataaatct tgatttatac tggtgttgaa ggagaggcag acgtactggc 5460

tgcccgactc caaaaaccaa ttatggtcac ctaggaaaat tgctattgtg gtggtgttaa 5520

ccgataaaac atctaaagct atttttttag aagctactgc tttcacagta taattttcac 5580

accttgaacc ctacttcttg ctttcagtta ttccaacttc caaatgggtg gaaatatagc 5640

aacatttcat aatcatttca agagagatta gattggatag gtatgagggg ctcatcctcc 5700

ttatcttttg catttagcaa tttcttttaa actttaatag ctacaaactt ataggagagg 5760

ctttacattt ccaatggcag taagaggggc tcgacgccgc tcgactacgt gctagatcca 5820

cccctaatag gttttgtagt tgctttaacc aaacaactta taatttttct agagcgcata 5880

gctcacatga gctttttcat agttatctgg tgacagttga actatacaga cccggagtta 5940

agtcgtctgc gaactaagag ccactcaact gcctcctctc ttcctcatcc atgcatgagc 6000

cactaatgca tcactcttcc gtccccatgg atgatgcaca ccgcttcgcc gcctctgtcc 6060

ctcagccatg cttgtcttgc tttgccacct gtgtcttttc tccatgtgcg ttatacatgg 6120

gcggatccat ataggatcta ctgggtgcgg ccacacccag acaaaaatac aaaatatgct 6180

atactttgca tgtttctatg gtattcgcac ccc 6213

<210> SEQ ID NO: 11

<211> LENGTH: 6243

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: SfiI-2_23 promoter::GUS-plus::2_23 terminator-

SfiI cassette

<400> SEQENCE: 11

gcggccctta aggccacact agaatcactc tcccactcaa tcagatgatc actatcaagc 60

ataagtgagt tagagggctc ccaagcgcca ccacataagc caccaaggcc ctagtgggct 120

cagcaactag ccaaagggcg gccacacttc tatttatagc cacaagggct aaacaagccg 180

ttgccccttc actaggcaaa acgcgggggc gtcggacgca ccaccccagt gtccgtagct 240

catgaagcag ccacgtgcta ctagtcgttt gaacttaacc gttgccgcca acggctaact 300

cacacgtgcc gagggatagg acgttctggc acaacttgtc ggacgctagc acctcacgtc 360

cgacgctgct tagagagttc ccaaacttgg ttacacacca tcggacgtgt ctgacgggtg 420

atcatcggac gcgtgccagc gtcctacacg tacacctcgc aaaacgttgc gtgcgttgga 480

cactcattag tactcggtca gcatccgaca caaaaccttc ggacatgcca atgcacagtg 540

caactctatc acacattgtc gaacgcaggt ctagcgtcca acgctgccaa gtcttgctca 600

agcttagctg tcacacgcgg tctctcgctt caaagcctcc gacttgccct tcacacatgc 660

aatcagtccg tcaagccaag ccttatctag atcttctcca tcttggtcac atgactccat 720

gtcatgtctc atatgcaatg agctcctcca tcattacata ttcacctata gactaatctc 780

ctgtgtatct cacataaaaa ctattagtcc acctaagtta ttcaattacc aaaaccaaac 840

aagaaccttt tagcgggtaa ctttgacaaa aagtttgaag acacaacaga tgtcaatgat 900

gtgcatgatc cggatgactt tggccatgat tttcagtgag gaagagaaag gctatagaac 960

atagataagg catgactgtg tttgtgatcg agggaggtag tttagtaaag aatttttggt 1020

gtatattata aagaaagtag tgataaaaag gatagttttt ggtgtctaca ctaataaatt 1080

aatcaagcat gcatggaccc aactatatat cctaatccta atggtataat ggtaaataat 1140

ccattcatgg tccatgatcc ttggatttgg gtccatggca attcaaaaac tagctatctc 1200

tctctctctc tcttagtctc tctgccaaag atatttgaag cacattctga cggcaataaa 1260

aaaagacgta aaactagcgg gcgatgaact cattcaccat tacaaccatt aaatttaatg 1320

caaattaagt accggtttaa tatagaaaat tatgaataac atgttttgtg acatctgaca 1380

tgtgcatgtg tgtacatgtt tctaattatc atgattttaa tcatagaaaa caaaggacgg 1440

tttgcaacaa catacccaac gacactaaag ctgacgctag ttgccataga ggttgtctat 1500

gtagcacaac caagctagga tttagtgagg ggtctaccta gaaggcgcat ccgacaaaga 1560

agacgagaaa gacgatgtgg tggcaaggga gcccctcctc ggatggctgc atgggaaggc 1620

gctcacaaca aggatggtgg tggatggaga cgaggaaaaa ggtcgagcca gggaagaaga 1680

acggagatgg tgccagacct cgactgtgaa atctaggacc agtgcctctt gtgaaatcat 1740

ttgtgcagca gtgttacttt tccgagctaa gaaggttggt ccatgtggct caaattaaag 1800

ttgatggata ggccagtgat caagcaatgt agacccaaag gttgtgtccg aaattttcat 1860

ttacgtttca atgtggtttc taaaaaaata atttcaatgc tacaccaaaa cataagaatt 1920

atagagtttt gtcgtggctt tgaaacttct tccaatcgtg ctagtttaat ttgtatatca 1980

ggaccatgct attcctctgg ccttggttct tgcgcatcca ttctaaatga gcacgcgcca 2040

cgccacacat tccttcttaa tcaccagctg cttcgctagc ttgacatcca atgtcctggg 2100

caccactccg tcggatccgc caggatgccc agctgaaatg atgcctaatg atcatatgaa 2160

aacaaatatt agtatacgag ctggccattt gcggagccaa ccgaagtcgt cgtgcacaaa 2220

atatttgata ccgtatcacg gaaaacacta aatatacgat gtaggcaata atctagaacg 2280

gactcttcct caccggtcgg gttcacctgt atatatttga atatgatgac tcggttcatt 2340

tgaacactat cgtgcctagt agtgcaccga tttcttaatc ctaaggctgg actataagta 2400

tccctggtaa caccccgtga tcaaagcatc gcaaactagc tgctaatcac ttgtcaagag 2460

ctctctgacc atattagctc tagagtgatc cgcgagctgg tgtgatcgag caataatggt 2520

agatctgagg gtaaatttct agtttttctc cttcattttc ttggttagga cccttttctc 2580

tttttatttt tttgagcttt gatctttctt taaactgatc tattttttaa ttgattggtt 2640

atggtgtaaa tattacatag ctttaactga taatctgatt actttatttc gtgtgtctat 2700

gatgatgatg atagttacag aaccgacgaa ctagtctgta cccgatcaac accgagaccc 2760

gtggcgtctt cgacctcaat ggcgtctgga acttcaagct ggactacggg aaaggactgg 2820

aagagaagtg gtacgaaagc aagctgaccg acactattag tatggccgtc ccaagcagtt 2880

acaatgacat tggcgtgacc aaggaaatcc gcaaccatat cggatatgtc tggtacgaac 2940

gtgagttcac ggtgccggcc tatctgaagg atcagcgtat cgtgctccgc ttcggctctg 3000

caactcacaa agcaattgtc tatgtcaatg gtgagctggt cgtggagcac aagggcggat 3060

tcctgccatt cgaagcggaa atcaacaact cgctgcgtga tggcatgaat cgcgtcaccg 3120

tcgccgtgga caacatcctc gacgatagca ccctcccggt ggggctgtac agcgagcgcc 3180

acgaagaggg cctcggaaaa gtcattcgta acaagccgaa cttcgacttc ttcaactatg 3240

caggcctgca ccgtccggtg aaaatctaca cgaccccgtt tacgtacgtc gaggacatct 3300

cggttgtgac cgacttcaat ggcccaaccg ggactgtgac ctatacggtg gactttcaag 3360

gcaaagccga gaccgtgaaa gtgtcggtcg tggatgagga aggcaaagtg gtcgcaagca 3420

ccgagggcct gagcggtaac gtggagattc cgaatgtcat cctctgggaa ccactgaaca 3480

cgtatctcta ccagatcaaa gtggaactgg tgaacgacgg actgaccatc gatgtctatg 3540

aagagccgtt cggcgtgcgg accgtggaag tcaacgacgg caagttcctc atcaacaaca 3600

aaccgttcta cttcaagggc tttggcaaac atgaggacac tcctatcaac ggccgtggct 3660

ttaacgaagc gagcaatgtg atggatttca atatcctcaa atggatcggc gccaacagct 3720

tccggaccgc acactatccg tactctgaag agttgatgcg tcttgcggat cgcgagggtc 3780

tggtcgtgat cgacgagact ccggcagttg gcgtgcacct caacttcatg gccaccacgg 3840

gactcggcga aggcagcgag cgcgtcagta cctgggagaa gattcggacg tttgagcacc 3900

atcaagacgt tctccgtgaa ctggtgtctc gtgacaagaa ccatccaagc gtcgtgatgt 3960

ggagcatcgc caacgaggcg gcgactgagg aagagggcgc gtacgagtac ttcaagccgt 4020

tggtggagct gaccaaggaa ctcgacccac agaagcgtcc ggtcacgatc gtgctgtttg 4080

tgatggctac cccggagacg gacaaagtcg ccgaactgat tgacgtcatc gcgctcaatc 4140

gctataacgg atggtacttc gatggcggtg atctcgaagc ggccaaagtc catctccgcc 4200

aggaatttca cgcgtggaac aagcgttgcc caggaaagcc gatcatgatc actgagtacg 4260

gcgcagacac cgttgcgggc tttcacgaca ttgatccagt gatgttcacc gaggaatatc 4320

aagtcgagta ctaccaggcg aaccacgtcg tgttcgatga gtttgagaac ttcgtgggtg 4380

agcaagcgtg gaacttcgcg gacttcgcga cctctcaggg cgtgatgcgc gtccaaggaa 4440

acaagaaggg cgtgttcact cgtgaccgca agccgaagct cgccgcgcac gtctttcgcg 4500

agcgctggac caacattcca gatttcggct acaagaacgc tagccatcac catcaccatc 4560

acgtgtgatg agcgcctgga tctcagcgcc ttgagacatc ttgtctttta atttcagctc 4620

ggttttaatg atgcgttgtt atttgattgc ttttccacgt agtatgatgt acgactagtc 4680

agcatacatg catgcacgca tggccggccg tgctgtcaaa ttgtattttt ttcatttgtt 4740

gaaaaaaagc cggcgatcac ttgtatgccg gtgctaagtt ccaatcaagt ttggtttgcg 4800

atttatttca cagtttcgca tgcatgttct ggttatattc tagtcgtact tgagcatatg 4860

aaaacgtact gtctaccacg tacttattct cttgagtgtc actgagaagg aatgtgtgtt 4920

ggtaagcttt cttgaatctg acaaattatg taaaataaat attatcaata tttacatctt 4980

cacgtagttt ataataaaaa tatatttacc gatctatcta atgatactaa ttttacacca 5040

taaatactaa tatttctgta tatatattta gtcaaaattt aaaatgttta acttctcaga 5100

aggtgagaat gatactattt gtcagacggt ggtgcggggt gtcggacaaa aatcagacgg 5160

tggcgcagtg catgcggcca ctagcagcgg tgcgcgatcc acacttcctc cagcgcagcg 5220

tttggggcaa tcggcgatgg cacgcaggcc ctatgtcggt agtacgctgc tcccttcctc 5280

tagtgagcgt ggatccgacg agcggatcca gcgacaatgg cagcacgtga atgggctcgg 5340

cgggccttgt ggataggctt ggagggcctc atcgatgcgc atgccatttc ttattttgtt 5400

aacacagatg agcaagtgtc cgcctgcata aatcttgatt tatactggtg ttgaaggaga 5460

ggcagacgta ctggctgccc gactccaaaa accaattatg gtcacctagg aaaattgcta 5520

ttgtggtggt gttaaccgat aaaacatcta aagctatttt tttagaagct actgctttca 5580

cagtataatt ttcacacctt gaaccctact tcttgctttc agttattcca acttccaaat 5640

gggtggaaat atagcaacat ttcataatca tttcaagaga gattagattg gataggtatg 5700

aggggctcat cctccttatc ttttgcattt agcaatttct tttaaacttt aatagctaca 5760

aacttatagg agaggcttta catttccaat ggcagtaaga ggggctcgac gccgctcgac 5820

tacgtgctag atccacccct aataggtttt gtagttgctt taaccaaaca acttataatt 5880

tttctagagc gcatagctca catgagcttt ttcatagtta tctggtgaca gttgaactat 5940

acagacccgg agttaagtcg tctgcgaact aagagccact caactgcctc ctctcttcct 6000

catccatgca tgagccacta atgcatcact cttccgtccc catggatgat gcacaccgct 6060

tcgccgcctc tgtccctcag ccatgcttgt cttgctttgc cacctgtgtc ttttctccat 6120

gtgcgttata catgggcgga tccatatagg atctactggg tgcggccaca cccagacaaa 6180

aatacaaaat atgctatact ttgcatgttt ctatggtatt cgcaccccgg ccgccatggc 6240

cgc 6243

<210> SEQ ID NO: 12

<211> LENGTH: 2513

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: SfiI-2_23 promoter

<400> SEQENCE: 12

ggcccttaag gccacactag aatcactctc ccactcaatc agatgatcac tatcaagcat 60

aagtgagtta gagggctccc aagcgccacc acataagcca ccaaggccct agtgggctca 120

gcaactagcc aaagggcggc cacacttcta tttatagcca caagggctaa acaagccgtt 180

gccccttcac taggcaaaac gcgggggcgt cggacgcacc accccagtgt ccgtagctca 240

tgaagcagcc acgtgctact agtcgtttga acttaaccgt tgccgccaac ggctaactca 300

cacgtgccga gggataggac gttctggcac aacttgtcgg acgctagcac ctcacgtccg 360

acgctgctta gagagttccc aaacttggtt acacaccatc ggacgtgtct gacgggtgat 420

catcggacgc gtgccagcgt cctacacgta cacctcgcaa aacgttgcgt gcgttggaca 480

ctcattagta ctcggtcagc atccgacaca aaaccttcgg acatgccaat gcacagtgca 540

actctatcac acattgtcga acgcaggtct agcgtccaac gctgccaagt cttgctcaag 600

cttagctgtc acacgcggtc tctcgcttca aagcctccga cttgcccttc acacatgcaa 660

tcagtccgtc aagccaagcc ttatctagat cttctccatc ttggtcacat gactccatgt 720

catgtctcat atgcaatgag ctcctccatc attacatatt cacctataga ctaatctcct 780

gtgtatctca cataaaaact attagtccac ctaagttatt caattaccaa aaccaaacaa 840

gaacctttta gcgggtaact ttgacaaaaa gtttgaagac acaacagatg tcaatgatgt 900

gcatgatccg gatgactttg gccatgattt tcagtgagga agagaaaggc tatagaacat 960

agataaggca tgactgtgtt tgtgatcgag ggaggtagtt tagtaaagaa tttttggtgt 1020

atattataaa gaaagtagtg ataaaaagga tagtttttgg tgtctacact aataaattaa 1080

tcaagcatgc atggacccaa ctatatatcc taatcctaat ggtataatgg taaataatcc 1140

attcatggtc catgatcctt ggatttgggt ccatggcaat tcaaaaacta gctatctctc 1200

tctctctctc ttagtctctc tgccaaagat atttgaagca cattctgacg gcaataaaaa 1260

aagacgtaaa actagcgggc gatgaactca ttcaccatta caaccattaa atttaatgca 1320

aattaagtac cggtttaata tagaaaatta tgaataacat gttttgtgac atctgacatg 1380

tgcatgtgtg tacatgtttc taattatcat gattttaatc atagaaaaca aaggacggtt 1440

tgcaacaaca tacccaacga cactaaagct gacgctagtt gccatagagg ttgtctatgt 1500

agcacaacca agctaggatt tagtgagggg tctacctaga aggcgcatcc gacaaagaag 1560

acgagaaaga cgatgtggtg gcaagggagc ccctcctcgg atggctgcat gggaaggcgc 1620

tcacaacaag gatggtggtg gatggagacg aggaaaaagg tcgagccagg gaagaagaac 1680

ggagatggtg ccagacctcg actgtgaaat ctaggaccag tgcctcttgt gaaatcattt 1740

gtgcagcagt gttacttttc cgagctaaga aggttggtcc atgtggctca aattaaagtt 1800

gatggatagg ccagtgatca agcaatgtag acccaaaggt tgtgtccgaa attttcattt 1860

acgtttcaat gtggtttcta aaaaaataat ttcaatgcta caccaaaaca taagaattat 1920

agagttttgt cgtggctttg aaacttcttc caatcgtgct agtttaattt gtatatcagg 1980

accatgctat tcctctggcc ttggttcttg cgcatccatt ctaaatgagc acgcgccacg 2040

ccacacattc cttcttaatc accagctgct tcgctagctt gacatccaat gtcctgggca 2100

ccactccgtc ggatccgcca ggatgcccag ctgaaatgat gcctaatgat catatgaaaa 2160

caaatattag tatacgagct ggccatttgc ggagccaacc gaagtcgtcg tgcacaaaat 2220

atttgatacc gtatcacgga aaacactaaa tatacgatgt aggcaataat ctagaacgga 2280

ctcttcctca ccggtcgggt tcacctgtat atatttgaat atgatgactc ggttcatttg 2340

aacactatcg tgcctagtag tgcaccgatt tcttaatcct aaggctggac tataagtatc 2400

cctggtaaca ccccgtgatc aaagcatcgc aaactagctg ctaatcactt gtcaagagct 2460

ctctgaccat attagctcta gagtgatccg cgagctggtg tgatcgagca ata 2513

<210> SEQ ID NO: 13

<211> LENGTH: 1673

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_23 terminator- SfiI)

<400> SEQENCE: 13

tgagcgcctg gatctcagcg ccttgagaca tcttgtcttt taatttcagc tcggttttaa 60

tgatgcgttg ttatttgatt gcttttccac gtagtatgat gtacgactag tcagcataca 120

tgcatgcacg catggccggc cgtgctgtca aattgtattt ttttcatttg ttgaaaaaaa 180

gccggcgatc acttgtatgc cggtgctaag ttccaatcaa gtttggtttg cgatttattt 240

cacagtttcg catgcatgtt ctggttatat tctagtcgta cttgagcata tgaaaacgta 300

ctgtctacca cgtacttatt ctcttgagtg tcactgagaa ggaatgtgtg ttggtaagct 360

ttcttgaatc tgacaaatta tgtaaaataa atattatcaa tatttacatc ttcacgtagt 420

ttataataaa aatatattta ccgatctatc taatgatact aattttacac cataaatact 480

aatatttctg tatatatatt tagtcaaaat ttaaaatgtt taacttctca gaaggtgaga 540

atgatactat ttgtcagacg gtggtgcggg gtgtcggaca aaaatcagac ggtggcgcag 600

tgcatgcggc cactagcagc ggtgcgcgat ccacacttcc tccagcgcag cgtttggggc 660

aatcggcgat ggcacgcagg ccctatgtcg gtagtacgct gctcccttcc tctagtgagc 720

gtggatccga cgagcggatc cagcgacaat ggcagcacgt gaatgggctc ggcgggcctt 780

gtggataggc ttggagggcc tcatcgatgc gcatgccatt tcttattttg ttaacacaga 840

tgagcaagtg tccgcctgca taaatcttga tttatactgg tgttgaagga gaggcagacg 900

tactggctgc ccgactccaa aaaccaatta tggtcaccta ggaaaattgc tattgtggtg 960

gtgttaaccg ataaaacatc taaagctatt tttttagaag ctactgcttt cacagtataa 1020

ttttcacacc ttgaacccta cttcttgctt tcagttattc caacttccaa atgggtggaa 1080

atatagcaac atttcataat catttcaaga gagattagat tggataggta tgaggggctc 1140

atcctcctta tcttttgcat ttagcaattt cttttaaact ttaatagcta caaacttata 1200

ggagaggctt tacatttcca atggcagtaa gaggggctcg acgccgctcg actacgtgct 1260

agatccaccc ctaataggtt ttgtagttgc tttaaccaaa caacttataa tttttctaga 1320

gcgcatagct cacatgagct ttttcatagt tatctggtga cagttgaact atacagaccc 1380

ggagttaagt cgtctgcgaa ctaagagcca ctcaactgcc tcctctcttc ctcatccatg 1440

catgagccac taatgcatca ctcttccgtc cccatggatg atgcacaccg cttcgccgcc 1500

tctgtccctc agccatgctt gtcttgcttt gccacctgtg tcttttctcc atgtgcgtta 1560

tacatgggcg gatccatata ggatctactg ggtgcggcca cacccagaca aaaatacaaa 1620

atatgctata ctttgcatgt ttctatggta ttcgcacccc ggccgccatg gcc 1673

<210> SEQ ID NO: 14

<211> LENGTH: 5497

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_32 promoter::GUSPlus::2_32-3′ cassette

<400> SEQENCE: 14

ttagctagat cggatggtta agaacctagt aagaggaact taagttgtag gctagaacca 60

aaatttagta gacctagagc cagctctagt taaattgtaa gggtgcgcat aactccataa 120

tccataattc tagccaccca ttgtgtcgcc gacccagagt cccagactag gaatcgacgc 180

ggacaggcag gcagccctct ccgactccgt gggcaccgtc gtcgcagcta ctcgttgctc 240

cgtctacgaa agaatcaatt tttaaagttg ttctaagtca aactttttaa actttaacca 300

aatttctaga aaaaaatact aagatttatg gtatcaaatt agtatcatta gattcactat 360

agaatatatt ttcatatgat acgtatttta tatcatagat ttgttaccat tttctataaa 420

attagtcaaa cttaaaaaag tttgacggat acggattcta agaattgatt cttttatgga 480

cagagggagt acatacagca ggctgtgtct gtgcaaacgt ccggcttcta cgacgggcgg 540

ccaggttgag gtcttgttta gatccaaaaa gtttttggat tttaacactc actttcattt 600

ttatttgaca aacattgtcc aatcatagag taactagact taaaagattc gtctcgcaat 660

ttacagacaa attgtgcaat tagttttttt tatcatattt aatgctctat gaatatacca 720

taagattcga tgtgataaaa aatcttaaaa aaattgtttt tttagtaaac taaacaatgc 780

cgtgccgtgg gcgtgggcgt ggagaacatg caatgcattg catggggaac atcgatgaac 840

caaagttaat gggcacacta aactgcatgc cccagacaca gttttaaaat ttatttacta 900

atatagcaac aaaaaaaaac aaatatatgc acgcccgcac gcacgtcctg tgcatatata 960

tatgcacgga cgctattcaa atcaacaggg agaggacagt ttggtcggtg gagtatctat 1020

ctacactaaa aaataccgcc ctcctctact cagctcgtcc ccgatttttt taactcctcc 1080

tccaaatcac aatcagatat caaatcaaat caaatcattc taaatcgaaa aaaaaagaaa 1140

atattaaatc aaatcaagaa aaaatataag tcaaatacac agaatatccc atcatgctca 1200

tcttgtcctt ggatattttg actctctcct ccaaatcaga atcggatatc aaatcaaatc 1260

aaatcgttct aaaaccgaat aaaaaaaaga aaatatcaaa ccaaatgaaa tgaaatcgag 1320

aaaaaaaaaa tcaaatatgc agggtatcgt agtaccatcc tactctgttc agctcatccc 1380

caaatttttt ttgccttgct cctcgaaatc agaatcgaat atcaaatcat tctaaatcca 1440

aatcagaaaa agaaatatca aaccaaatta aatgaaatca taaaaaaata taagtcaaat 1500

atgcaaagta tcattttgac tcgctcctcc aaatgagatc gaatatcaaa atcgaatcaa 1560

attgtttgaa atctgaattt taaaaaataa aatatcaaac caaatcaaat gaaatcggaa 1620

aaaaatacaa gtaaaataca cagggtattg tcgtaccacc ctgctttact caacttgtcc 1680

ttggattttt ttgcatgtct cctccaaatc agaatcggat atcaaatcat atcgttccaa 1740

atccgaattg gaaagaagaa aatatcaaac caaatcaaat gaaatagaaa aaaaatacaa 1800

gttagtgtgt tgttgcaact gtattgaaac ttgacctctt gccgcctgcg cgagggctcg 1860

tgaactagca ggctgtcact gtaaaaataa tagtatcagg tacaataaca gtgtgattcg 1920

actgttatat cattcatata cacgtaaaag cggagagaga aagcaatgct tttgttgatg 1980

agcttgtgac gcatgtcaag acgctttttc taagcagagg ttaactcttc ccatcctatc 2040

cttgtatatt gaataagaaa acaatattta gactatagaa agggactaat tgttgtatgt 2100

gctagactct aaataaactt gtctaataat gacttggctt ggcttataga taaattttat 2160

taggcttgct ctaaaacctg ccctcacaca tgatccgaaa cttgtggggc aataaaaagc 2220

gaaactattc tgtatattaa gctcgtgctt tgtgctacct gaaaaaaaat acaaacaggt 2280

aagccattgc gtaacaaaaa aaaaatgaaa agaacaaaga aacaattaag aaatccgcct 2340

acctgatcgt gcattgtgct cggttactaa tgtacttttt aaaaattgga atggatggat 2400

ggttttcctc tgactggctg gctggctgcc tgctgcttat aggagtacta tataagtaga 2460

cgcatgcagt acccaaacga cgacgccgcc accaccgcaa aagcagcaaa accttagctt 2520

gttcaccacc acaaccgcca gccatggtag atctgagggt aaatttctag tttttctcct 2580

tcattttctt ggttaggacc cttttctctt tttatttttt tgagctttga tctttcttta 2640

aactgatcta ttttttaatt gattggttat ggtgtaaata ttacatagct ttaactgata 2700

atctgattac tttatttcgt gtgtctatga tgatgatgat agttacagaa ccgacgaact 2760

agtctgtacc cgatcaacac cgagacccgt ggcgtcttcg acctcaatgg cgtctggaac 2820

ttcaagctgg actacgggaa aggactggaa gagaagtggt acgaaagcaa gctgaccgac 2880

actattagta tggccgtccc aagcagttac aatgacattg gcgtgaccaa ggaaatccgc 2940

aaccatatcg gatatgtctg gtacgaacgt gagttcacgg tgccggccta tctgaaggat 3000

cagcgtatcg tgctccgctt cggctctgca actcacaaag caattgtcta tgtcaatggt 3060

gagctggtcg tggagcacaa gggcggattc ctgccattcg aagcggaaat caacaactcg 3120

ctgcgtgatg gcatgaatcg cgtcaccgtc gccgtggaca acatcctcga cgatagcacc 3180

ctcccggtgg ggctgtacag cgagcgccac gaagagggcc tcggaaaagt cattcgtaac 3240

aagccgaact tcgacttctt caactatgca ggcctgcacc gtccggtgaa aatctacacg 3300

accccgttta cgtacgtcga ggacatctcg gttgtgaccg acttcaatgg cccaaccggg 3360

actgtgacct atacggtgga ctttcaaggc aaagccgaga ccgtgaaagt gtcggtcgtg 3420

gatgaggaag gcaaagtggt cgcaagcacc gagggcctga gcggtaacgt ggagattccg 3480

aatgtcatcc tctgggaacc actgaacacg tatctctacc agatcaaagt ggaactggtg 3540

aacgacggac tgaccatcga tgtctatgaa gagccgttcg gcgtgcggac cgtggaagtc 3600

aacgacggca agttcctcat caacaacaaa ccgttctact tcaagggctt tggcaaacat 3660

gaggacactc ctatcaacgg ccgtggcttt aacgaagcga gcaatgtgat ggatttcaat 3720

atcctcaaat ggatcggcgc caacagcttc cggaccgcac actatccgta ctctgaagag 3780

ttgatgcgtc ttgcggatcg cgagggtctg gtcgtgatcg acgagactcc ggcagttggc 3840

gtgcacctca acttcatggc caccacggga ctcggcgaag gcagcgagcg cgtcagtacc 3900

tgggagaaga ttcggacgtt tgagcaccat caagacgttc tccgtgaact ggtgtctcgt 3960

gacaagaacc atccaagcgt cgtgatgtgg agcatcgcca acgaggcggc gactgaggaa 4020

gagggcgcgt acgagtactt caagccgttg gtggagctga ccaaggaact cgacccacag 4080

aagcgtccgg tcacgatcgt gctgtttgtg atggctaccc cggagacgga caaagtcgcc 4140

gaactgattg acgtcatcgc gctcaatcgc tataacggat ggtacttcga tggcggtgat 4200

ctcgaagcgg ccaaagtcca tctccgccag gaatttcacg cgtggaacaa gcgttgccca 4260

ggaaagccga tcatgatcac tgagtacggc gcagacaccg ttgcgggctt tcacgacatt 4320

gatccagtga tgttcaccga ggaatatcaa gtcgagtact accaggcgaa ccacgtcgtg 4380

ttcgatgagt ttgagaactt cgtgggtgag caagcgtgga acttcgcgga cttcgcgacc 4440

tctcagggcg tgatgcgcgt ccaaggaaac aagaagggcg tgttcactcg tgaccgcaag 4500

ccgaagctcg ccgcgcacgt ctttcgcgag cgctggacca acattccaga tttcggctac 4560

aagaacgcta gccatcacca tcaccatcac gtgtgacttg catcattgct gggagggatc 4620

cattccatgc ctgcgctttg ccagctggga ataatgatag atgcccgtac gtacgtctcg 4680

atatgcatac ggttgatgtt ggtgttgaat acctcgcgct ctcgtattcg tatacggagt 4740

agtaggtgaa gtcagttggt gcaatgtatt ccatctgttc gtggcctata tattatgcaa 4800

aaaaataatg tcagaataat taaatcacat gtgtgagatt gaataaataa ccaatttctc 4860

cgcatcgttt atatattaat tgtacagtat atatagtagg atcaggagta atgcatgctt 4920

agctactcta tatacctctc aaaaacgatt gtgtactata aattcataat aggcgaagga 4980

cctgctgtat aaacgctgct ggggttaccg gccgggcata tacatatcct cctttcttat 5040

cagcaaggcc tgctgtacta aattcataat aaggacccca gcagcgtttc gatcgtcgac 5100

atacatatct cctacctaca gcttcttcga cggacaaaac ttggtgtctt gctgtggatt 5160

tataatgggc ttggcccata tacatttagt aaatcaataa actcggtgta taattaatac 5220

aatacgggat atattgataa aacattaact agacttatat ggttggattt tatccttcta 5280

tattgagaag ttgagaaaag tacaaaggcg tgccacacgt gcgcgcactg ccgccgccca 5340

ggccgtgccg ccaatcaaaa ctcataataa cgtgagtttc ttcttttgta ttatcacgat 5400

taatctttgt ctgttacgaa ctctttgctt gtttgtctgt ctcttgagtt gactgcgatc 5460

ccttctcctg cctctacctg cgagaataaa atctcga 5497

<210> SEQ ID NO: 15

<211> LENGTH: 5512

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: HindIII-2_32 promoter::GUS-plus::2_32

terminator- EcoRI cassette

<400> SEQENCE: 15

cgcaagctta gctagatcgg atggttaaga acctagtaag aggaacttaa gttgtaggct 60

agaaccaaaa tttagtagac ctagagccag ctctagttaa attgtaaggg tgcgcataac 120

tccataatcc ataattctag ccacccattg tgtcgccgac ccagagtccc agactaggaa 180

tcgacgcgga caggcaggca gccctctccg actccgtggg caccgtcgtc gcagctactc 240

gttgctccgt ctacgaaaga atcaattttt aaagttgttc taagtcaaac tttttaaact 300

ttaaccaaat ttctagaaaa aaatactaag atttatggta tcaaattagt atcattagat 360

tcactataga atatattttc atatgatacg tattttatat catagatttg ttaccatttt 420

ctataaaatt agtcaaactt aaaaaagttt gacggatacg gattctaaga attgattctt 480

ttatggacag agggagtaca tacagcaggc tgtgtctgtg caaacgtccg gcttctacga 540

cgggcggcca ggttgaggtc ttgtttagat ccaaaaagtt tttggatttt aacactcact 600

ttcattttta tttgacaaac attgtccaat catagagtaa ctagacttaa aagattcgtc 660

tcgcaattta cagacaaatt gtgcaattag ttttttttat catatttaat gctctatgaa 720

tataccataa gattcgatgt gataaaaaat cttaaaaaaa ttgttttttt agtaaactaa 780

acaatgccgt gccgtgggcg tgggcgtgga gaacatgcaa tgcattgcat ggggaacatc 840

gatgaaccaa agttaatggg cacactaaac tgcatgcccc agacacagtt ttaaaattta 900

tttactaata tagcaacaaa aaaaaacaaa tatatgcacg cccgcacgca cgtcctgtgc 960

atatatatat gcacggacgc tattcaaatc aacagggaga ggacagtttg gtcggtggag 1020

tatctatcta cactaaaaaa taccgccctc ctctactcag ctcgtccccg atttttttaa 1080

ctcctcctcc aaatcacaat cagatatcaa atcaaatcaa atcattctaa atcgaaaaaa 1140

aaagaaaata ttaaatcaaa tcaagaaaaa atataagtca aatacacaga atatcccatc 1200

atgctcatct tgtccttgga tattttgact ctctcctcca aatcagaatc ggatatcaaa 1260

tcaaatcaaa tcgttctaaa accgaataaa aaaaagaaaa tatcaaacca aatgaaatga 1320

aatcgagaaa aaaaaaatca aatatgcagg gtatcgtagt accatcctac tctgttcagc 1380

tcatccccaa attttttttg ccttgctcct cgaaatcaga atcgaatatc aaatcattct 1440

aaatccaaat cagaaaaaga aatatcaaac caaattaaat gaaatcataa aaaaatataa 1500

gtcaaatatg caaagtatca ttttgactcg ctcctccaaa tgagatcgaa tatcaaaatc 1560

gaatcaaatt gtttgaaatc tgaattttaa aaaataaaat atcaaaccaa atcaaatgaa 1620

atcggaaaaa aatacaagta aaatacacag ggtattgtcg taccaccctg ctttactcaa 1680

cttgtccttg gatttttttg catgtctcct ccaaatcaga atcggatatc aaatcatatc 1740

gttccaaatc cgaattggaa agaagaaaat atcaaaccaa atcaaatgaa atagaaaaaa 1800

aatacaagtt agtgtgttgt tgcaactgta ttgaaacttg acctcttgcc gcctgcgcga 1860

gggctcgtga actagcaggc tgtcactgta aaaataatag tatcaggtac aataacagtg 1920

tgattcgact gttatatcat tcatatacac gtaaaagcgg agagagaaag caatgctttt 1980

gttgatgagc ttgtgacgca tgtcaagacg ctttttctaa gcagaggtta actcttccca 2040

tcctatcctt gtatattgaa taagaaaaca atatttagac tatagaaagg gactaattgt 2100

tgtatgtgct agactctaaa taaacttgtc taataatgac ttggcttggc ttatagataa 2160

attttattag gcttgctcta aaacctgccc tcacacatga tccgaaactt gtggggcaat 2220

aaaaagcgaa actattctgt atattaagct cgtgctttgt gctacctgaa aaaaaataca 2280

aacaggtaag ccattgcgta acaaaaaaaa aatgaaaaga acaaagaaac aattaagaaa 2340

tccgcctacc tgatcgtgca ttgtgctcgg ttactaatgt actttttaaa aattggaatg 2400

gatggatggt tttcctctga ctggctggct ggctgcctgc tgcttatagg agtactatat 2460

aagtagacgc atgcagtacc caaacgacga cgccgccacc accgcaaaag cagcaaaacc 2520

ttagcttgtt caccaccaca accgccagcc atggtagatc tgagggtaaa tttctagttt 2580

ttctccttca ttttcttggt taggaccctt ttctcttttt atttttttga gctttgatct 2640

ttctttaaac tgatctattt tttaattgat tggttatggt gtaaatatta catagcttta 2700

actgataatc tgattacttt atttcgtgtg tctatgatga tgatgatagt tacagaaccg 2760

acgaactagt ctgtacccga tcaacaccga gacccgtggc gtcttcgacc tcaatggcgt 2820

ctggaacttc aagctggact acgggaaagg actggaagag aagtggtacg aaagcaagct 2880

gaccgacact attagtatgg ccgtcccaag cagttacaat gacattggcg tgaccaagga 2940

aatccgcaac catatcggat atgtctggta cgaacgtgag ttcacggtgc cggcctatct 3000

gaaggatcag cgtatcgtgc tccgcttcgg ctctgcaact cacaaagcaa ttgtctatgt 3060

caatggtgag ctggtcgtgg agcacaaggg cggattcctg ccattcgaag cggaaatcaa 3120

caactcgctg cgtgatggca tgaatcgcgt caccgtcgcc gtggacaaca tcctcgacga 3180

tagcaccctc ccggtggggc tgtacagcga gcgccacgaa gagggcctcg gaaaagtcat 3240

tcgtaacaag ccgaacttcg acttcttcaa ctatgcaggc ctgcaccgtc cggtgaaaat 3300

ctacacgacc ccgtttacgt acgtcgagga catctcggtt gtgaccgact tcaatggccc 3360

aaccgggact gtgacctata cggtggactt tcaaggcaaa gccgagaccg tgaaagtgtc 3420

ggtcgtggat gaggaaggca aagtggtcgc aagcaccgag ggcctgagcg gtaacgtgga 3480

gattccgaat gtcatcctct gggaaccact gaacacgtat ctctaccaga tcaaagtgga 3540

actggtgaac gacggactga ccatcgatgt ctatgaagag ccgttcggcg tgcggaccgt 3600

ggaagtcaac gacggcaagt tcctcatcaa caacaaaccg ttctacttca agggctttgg 3660

caaacatgag gacactccta tcaacggccg tggctttaac gaagcgagca atgtgatgga 3720

tttcaatatc ctcaaatgga tcggcgccaa cagcttccgg accgcacact atccgtactc 3780

tgaagagttg atgcgtcttg cggatcgcga gggtctggtc gtgatcgacg agactccggc 3840

agttggcgtg cacctcaact tcatggccac cacgggactc ggcgaaggca gcgagcgcgt 3900

cagtacctgg gagaagattc ggacgtttga gcaccatcaa gacgttctcc gtgaactggt 3960

gtctcgtgac aagaaccatc caagcgtcgt gatgtggagc atcgccaacg aggcggcgac 4020

tgaggaagag ggcgcgtacg agtacttcaa gccgttggtg gagctgacca aggaactcga 4080

cccacagaag cgtccggtca cgatcgtgct gtttgtgatg gctaccccgg agacggacaa 4140

agtcgccgaa ctgattgacg tcatcgcgct caatcgctat aacggatggt acttcgatgg 4200

cggtgatctc gaagcggcca aagtccatct ccgccaggaa tttcacgcgt ggaacaagcg 4260

ttgcccagga aagccgatca tgatcactga gtacggcgca gacaccgttg cgggctttca 4320

cgacattgat ccagtgatgt tcaccgagga atatcaagtc gagtactacc aggcgaacca 4380

cgtcgtgttc gatgagtttg agaacttcgt gggtgagcaa gcgtggaact tcgcggactt 4440

cgcgacctct cagggcgtga tgcgcgtcca aggaaacaag aagggcgtgt tcactcgtga 4500

ccgcaagccg aagctcgccg cgcacgtctt tcgcgagcgc tggaccaaca ttccagattt 4560

cggctacaag aacgctagcc atcaccatca ccatcacgtg tgacttgcat cattgctggg 4620

agggatccat tccatgcctg cgctttgcca gctgggaata atgatagatg cccgtacgta 4680

cgtctcgata tgcatacggt tgatgttggt gttgaatacc tcgcgctctc gtattcgtat 4740

acggagtagt aggtgaagtc agttggtgca atgtattcca tctgttcgtg gcctatatat 4800

tatgcaaaaa aataatgtca gaataattaa atcacatgtg tgagattgaa taaataacca 4860

atttctccgc atcgtttata tattaattgt acagtatata tagtaggatc aggagtaatg 4920

catgcttagc tactctatat acctctcaaa aacgattgtg tactataaat tcataatagg 4980

cgaaggacct gctgtataaa cgctgctggg gttaccggcc gggcatatac atatcctcct 5040

ttcttatcag caaggcctgc tgtactaaat tcataataag gaccccagca gcgtttcgat 5100

cgtcgacata catatctcct acctacagct tcttcgacgg acaaaacttg gtgtcttgct 5160

gtggatttat aatgggcttg gcccatatac atttagtaaa tcaataaact cggtgtataa 5220

ttaatacaat acgggatata ttgataaaac attaactaga cttatatggt tggattttat 5280

ccttctatat tgagaagttg agaaaagtac aaaggcgtgc cacacgtgcg cgcactgccg 5340

ccgcccaggc cgtgccgcca atcaaaactc ataataacgt gagtttcttc ttttgtatta 5400

tcacgattaa tctttgtctg ttacgaactc tttgcttgtt tgtctgtctc ttgagttgac 5460

tgcgatccct tctcctgcct ctacctgcga gaataaaatc tcgagaattc gg 5512

<210> SEQ ID NO: 16

<211> LENGTH: 2547

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: HindIII - 2_32 promoter

<400> SEQENCE: 16

aagcttagct agatcggatg gttaagaacc tagtaagagg aacttaagtt gtaggctaga 60

accaaaattt agtagaccta gagccagctc tagttaaatt gtaagggtgc gcataactcc 120

ataatccata attctagcca cccattgtgt cgccgaccca gagtcccaga ctaggaatcg 180

acgcggacag gcaggcagcc ctctccgact ccgtgggcac cgtcgtcgca gctactcgtt 240

gctccgtcta cgaaagaatc aatttttaaa gttgttctaa gtcaaacttt ttaaacttta 300

accaaatttc tagaaaaaaa tactaagatt tatggtatca aattagtatc attagattca 360

ctatagaata tattttcata tgatacgtat tttatatcat agatttgtta ccattttcta 420

taaaattagt caaacttaaa aaagtttgac ggatacggat tctaagaatt gattctttta 480

tggacagagg gagtacatac agcaggctgt gtctgtgcaa acgtccggct tctacgacgg 540

gcggccaggt tgaggtcttg tttagatcca aaaagttttt ggattttaac actcactttc 600

atttttattt gacaaacatt gtccaatcat agagtaacta gacttaaaag attcgtctcg 660

caatttacag acaaattgtg caattagttt tttttatcat atttaatgct ctatgaatat 720

accataagat tcgatgtgat aaaaaatctt aaaaaaattg tttttttagt aaactaaaca 780

atgccgtgcc gtgggcgtgg gcgtggagaa catgcaatgc attgcatggg gaacatcgat 840

gaaccaaagt taatgggcac actaaactgc atgccccaga cacagtttta aaatttattt 900

actaatatag caacaaaaaa aaacaaatat atgcacgccc gcacgcacgt cctgtgcata 960

tatatatgca cggacgctat tcaaatcaac agggagagga cagtttggtc ggtggagtat 1020

ctatctacac taaaaaatac cgccctcctc tactcagctc gtccccgatt tttttaactc 1080

ctcctccaaa tcacaatcag atatcaaatc aaatcaaatc attctaaatc gaaaaaaaaa 1140

gaaaatatta aatcaaatca agaaaaaata taagtcaaat acacagaata tcccatcatg 1200

ctcatcttgt ccttggatat tttgactctc tcctccaaat cagaatcgga tatcaaatca 1260

aatcaaatcg ttctaaaacc gaataaaaaa aagaaaatat caaaccaaat gaaatgaaat 1320

cgagaaaaaa aaaatcaaat atgcagggta tcgtagtacc atcctactct gttcagctca 1380

tccccaaatt ttttttgcct tgctcctcga aatcagaatc gaatatcaaa tcattctaaa 1440

tccaaatcag aaaaagaaat atcaaaccaa attaaatgaa atcataaaaa aatataagtc 1500

aaatatgcaa agtatcattt tgactcgctc ctccaaatga gatcgaatat caaaatcgaa 1560

tcaaattgtt tgaaatctga attttaaaaa ataaaatatc aaaccaaatc aaatgaaatc 1620

ggaaaaaaat acaagtaaaa tacacagggt attgtcgtac caccctgctt tactcaactt 1680

gtccttggat ttttttgcat gtctcctcca aatcagaatc ggatatcaaa tcatatcgtt 1740

ccaaatccga attggaaaga agaaaatatc aaaccaaatc aaatgaaata gaaaaaaaat 1800

acaagttagt gtgttgttgc aactgtattg aaacttgacc tcttgccgcc tgcgcgaggg 1860

ctcgtgaact agcaggctgt cactgtaaaa ataatagtat caggtacaat aacagtgtga 1920

ttcgactgtt atatcattca tatacacgta aaagcggaga gagaaagcaa tgcttttgtt 1980

gatgagcttg tgacgcatgt caagacgctt tttctaagca gaggttaact cttcccatcc 2040

tatccttgta tattgaataa gaaaacaata tttagactat agaaagggac taattgttgt 2100

atgtgctaga ctctaaataa acttgtctaa taatgacttg gcttggctta tagataaatt 2160

ttattaggct tgctctaaaa cctgccctca cacatgatcc gaaacttgtg gggcaataaa 2220

aagcgaaact attctgtata ttaagctcgt gctttgtgct acctgaaaaa aaatacaaac 2280

aggtaagcca ttgcgtaaca aaaaaaaaat gaaaagaaca aagaaacaat taagaaatcc 2340

gcctacctga tcgtgcattg tgctcggtta ctaatgtact ttttaaaaat tggaatggat 2400

ggatggtttt cctctgactg gctggctggc tgcctgctgc ttataggagt actatataag 2460

tagacgcatg cagtacccaa acgacgacgc cgccaccacc gcaaaagcag caaaacctta 2520

gcttgttcac caccacaacc gccagcc 2547

<210> SEQ ID NO: 17

<211> LENGTH: 907

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_32 terminator - EcoRI

<400> SEQENCE: 17

cttgcatcat tgctgggagg gatccattcc atgcctgcgc tttgccagct gggaataatg 60

atagatgccc gtacgtacgt ctcgatatgc atacggttga tgttggtgtt gaatacctcg 120

cgctctcgta ttcgtatacg gagtagtagg tgaagtcagt tggtgcaatg tattccatct 180

gttcgtggcc tatatattat gcaaaaaaat aatgtcagaa taattaaatc acatgtgtga 240

gattgaataa ataaccaatt tctccgcatc gtttatatat taattgtaca gtatatatag 300

taggatcagg agtaatgcat gcttagctac tctatatacc tctcaaaaac gattgtgtac 360

tataaattca taataggcga aggacctgct gtataaacgc tgctggggtt accggccggg 420

catatacata tcctcctttc ttatcagcaa ggcctgctgt actaaattca taataaggac 480

cccagcagcg tttcgatcgt cgacatacat atctcctacc tacagcttct tcgacggaca 540

aaacttggtg tcttgctgtg gatttataat gggcttggcc catatacatt tagtaaatca 600

ataaactcgg tgtataatta atacaatacg ggatatattg ataaaacatt aactagactt 660

atatggttgg attttatcct tctatattga gaagttgaga aaagtacaaa ggcgtgccac 720

acgtgcgcgc actgccgccg cccaggccgt gccgccaatc aaaactcata ataacgtgag 780

tttcttcttt tgtattatca cgattaatct ttgtctgtta cgaactcttt gcttgtttgt 840

ctgtctcttg agttgactgc gatcccttct cctgcctcta cctgcgagaa taaaatctcg 900

agaattc 907

<210> SEQ ID NO: 18

<211> LENGTH: 6015

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_35 promoter::GUSPlus::2_35-3′ cassette

<400> SEQENCE: 18

tctgggtact gctattgagg ccttgtctcc caaaatgggg cttgaatatg catgagtata 60

agaagacaga ataacttgaa cacatgtcaa caagggacca acaatcaaag tattatattg 120

tattcaagta tactttgcta ttatatctta tagaatatat tatatattct ccaacgccat 180

aatttcataa tagatgggta gccacggttc atcctgggct aagtttcaac ccaactggaa 240

caatttgtaa ctttattgtg tcgtaattgt atcagcttat ggggttagcc attctaccct 300

atgtaataat atatgtttat atgttgcaat gcttatggtc ctaaggtttc actaagtgct 360

tatcattgtt ggctgcatca ccgccagtct gttagaaaaa aggacatcac gccaggttta 420

taaaccaact gtagtgaata tagcgacata atttgagata tcattgggat ttacatatcg 480

tttctttttt ttttcttttc acaaagcact tagccactta ggacacttcc tttcttcctt 540

ccttccttta agctggacta ggaaacacaa agagtctggg ccttgacgat agcatggatt 600

gggacgactt tgtcttttgg gcttcttggt catcatcgtc tccatgcgtg tgccaccagc 660

gttcccgttg ccctcctcat cctttctgac agatgccccc ttggtaccgt gacatttctc 720

tcttcttgag aaccggcttg acccaagcca gtgccaccgg aaaaatgagc ttcagcacgt 780

gctcattctc ctaggttgac gtacacaagt gcacgggcca ttctgaccaa tgaacaagaa 840

cttgattgaa acagaaactt catcattgcg tctacacact tagcataatg attagtccta 900

agatttcatt aattattaaa atcaaactag ggctttcata tgggtacgta ccctatgtct 960

acttgaagca ggccttgaca caagagtcca agaaggcata ttccatagtt ctacgattgt 1020

cgtcggtgtc ctcttggtaa cagcgattcc ctccttggtc aatctgctgg tgatcgcgat 1080

gaccctgtca atgagatcgg aggagacatc gggcaacaac ctcctcttta agactcggtc 1140

acctgacctt tgttgagatc atcccaacac aaactgctaa aaatctcggt tcacgatttg 1200

atccatcatc tgaagcaagt gcaaacataa ttgctgattt tgtgtcaaat gagaaatata 1260

atgcaatagt gatgtgaagt atataccctt cttttttttt aggaaacgct aatggtttga 1320

tgacaatttt gttgtgcttt ttactttctt ttcacattta ttttgtactt ctgatttttt 1380

aaagtgtaaa acacaattac tttgaagaat tgggaaacaa tcagctcatg actccagcag 1440

taaaaaaggt taaactcgaa aaaaagggga aaatgatggt ttcatccgtg actttgaaga 1500

ttcatgaatc ggagtaaaaa aagaagaatt gtgaatcaca aaccctttgg ctcttgtatt 1560

cgaaaaagtg ggtcctgtta ctcctgtagg tgtcatatgt gacaaaaatt atcatagctc 1620

aaagaaaaaa aactgtaaac aaaaatggct acccacctgt ttcgtgacgt ggtggctctt 1680

gtacatatat atagggggtg tttgagattg ctctgctcca aattttttta gctccgcttt 1740

atgtttttta gtcaaacagt ttcaggtcca cgcactcagt tttaaaaaaa tggtggagtt 1800

gtgagagcac ctagagaggt actctacaaa ctccggtttt ttgtgaagct gtttcatggt 1860

ggagtttgtg gagcagagtt cgtgaagcaa tgccaaacac ctagtaacat ggtgttgtac 1920

gtggccgaaa ccaccgtagt tgaaaaaaca aaaaccgtgg aagcaaaagc cgctataggg 1980

taacttaata agctcattaa catacggtaa cacaaacaaa gaagaagttt tcacacgtgt 2040

gtgttatatt tttctgttca gattacccaa gatcggagat acgtttttga attaggattc 2100

ctttcggcgg agagacgttt ttgaattagt aaaaataaaa atataaaaga tacgctgccg 2160

atgcgttttc gatacatatt ggagaagtat cagaaaacaa aataaaaata acacaaaatc 2220

tgatagtcgt gaggggatat gtatatcagc ctggtcaact cacgccggcc ggtactactc 2280

tgtgagggct gccactactg cttatcggag aagtattcat cagaaaataa aaacaaaaaa 2340

cctgatactc gaggatatgc tacgtatcac aactcacgca gatacgacgg ctagctgaac 2400

agcccacacc cacaccctct ttataaatgc atggctcatg cggcgctgct ccatattgct 2460

cccattcatc ctcgtcctcc acgagcctgg ctcacaggct gtacgtcgtg cgtcgtcgtc 2520

gatggtagat ctgagggtaa atttctagtt tttctccttc attttcttgg ttaggaccct 2580

tttctctttt tatttttttg agctttgatc tttctttaaa ctgatctatt ttttaattga 2640

ttggttatgg tgtaaatatt acatagcttt aactgataat ctgattactt tatttcgtgt 2700

gtctatgatg atgatgatag ttacagaacc gacgaactag tctgtacccg atcaacaccg 2760

agacccgtgg cgtcttcgac ctcaatggcg tctggaactt caagctggac tacgggaaag 2820

gactggaaga gaagtggtac gaaagcaagc tgaccgacac tattagtatg gccgtcccaa 2880

gcagttacaa tgacattggc gtgaccaagg aaatccgcaa ccatatcgga tatgtctggt 2940

acgaacgtga gttcacggtg ccggcctatc tgaaggatca gcgtatcgtg ctccgcttcg 3000

gctctgcaac tcacaaagca attgtctatg tcaatggtga gctggtcgtg gagcacaagg 3060

gcggattcct gccattcgaa gcggaaatca acaactcgct gcgtgatggc atgaatcgcg 3120

tcaccgtcgc cgtggacaac atcctcgacg atagcaccct cccggtgggg ctgtacagcg 3180

agcgccacga agagggcctc ggaaaagtca ttcgtaacaa gccgaacttc gacttcttca 3240

actatgcagg cctgcaccgt ccggtgaaaa tctacacgac cccgtttacg tacgtcgagg 3300

acatctcggt tgtgaccgac ttcaatggcc caaccgggac tgtgacctat acggtggact 3360

ttcaaggcaa agccgagacc gtgaaagtgt cggtcgtgga tgaggaaggc aaagtggtcg 3420

caagcaccga gggcctgagc ggtaacgtgg agattccgaa tgtcatcctc tgggaaccac 3480

tgaacacgta tctctaccag atcaaagtgg aactggtgaa cgacggactg accatcgatg 3540

tctatgaaga gccgttcggc gtgcggaccg tggaagtcaa cgacggcaag ttcctcatca 3600

acaacaaacc gttctacttc aagggctttg gcaaacatga ggacactcct atcaacggcc 3660

gtggctttaa cgaagcgagc aatgtgatgg atttcaatat cctcaaatgg atcggcgcca 3720

acagcttccg gaccgcacac tatccgtact ctgaagagtt gatgcgtctt gcggatcgcg 3780

agggtctggt cgtgatcgac gagactccgg cagttggcgt gcacctcaac ttcatggcca 3840

ccacgggact cggcgaaggc agcgagcgcg tcagtacctg ggagaagatt cggacgtttg 3900

agcaccatca agacgttctc cgtgaactgg tgtctcgtga caagaaccat ccaagcgtcg 3960

tgatgtggag catcgccaac gaggcggcga ctgaggaaga gggcgcgtac gagtacttca 4020

agccgttggt ggagctgacc aaggaactcg acccacagaa gcgtccggtc acgatcgtgc 4080

tgtttgtgat ggctaccccg gagacggaca aagtcgccga actgattgac gtcatcgcgc 4140

tcaatcgcta taacggatgg tacttcgatg gcggtgatct cgaagcggcc aaagtccatc 4200

tccgccagga atttcacgcg tggaacaagc gttgcccagg aaagccgatc atgatcactg 4260

agtacggcgc agacaccgtt gcgggctttc acgacattga tccagtgatg ttcaccgagg 4320

aatatcaagt cgagtactac caggcgaacc acgtcgtgtt cgatgagttt gagaacttcg 4380

tgggtgagca agcgtggaac ttcgcggact tcgcgacctc tcagggcgtg atgcgcgtcc 4440

aaggaaacaa gaagggcgtg ttcactcgtg accgcaagcc gaagctcgcc gcgcacgtct 4500

ttcgcgagcg ctggaccaac attccagatt tcggctacaa gaacgctagc catcaccatc 4560

accatcacgt gtgatagcag aggaacttac tgtcacaacg cctctgccaa gtccaataat 4620

gtggatccgt ggccccatgg ccgtctactt atctatactg tacttgaatc aataatctcc 4680

ttggacatat ttgccatgac atgtcaaata atttctacac gacttttgat ttatggatca 4740

aaaaactgtt gcaaccttgc tcttcttgtt ttactctttt tttatctttt tttatttcct 4800

aagttgttgt actgtgtttt cctcttttta atttcaataa atctcctata ggggctaagg 4860

cccctccagt tcttttttta aaaaataatt tttaccactt gtggagatat tctaaattca 4920

ctgttcatag gcttccattt gtattgatcg agacattgag tggagtgccc tatccttcca 4980

ccccaccctc tgctggtcct ctttattaag ggatccgtct atatttgact tgagtgatgt 5040

ccgtgttttg taaactaaat agtgaattta tacgtatcgt gtagctttag gaagacgaca 5100

cttatagaca cgagggttat actggtcagg cggccgcagc cctacgtcta gtctcaaaga 5160

tggtttaagt ctgtgtttct cgattgaatg ctttgaagtt cttacgatag gttaagtaag 5220

ctaaggaaga gaggtaggag ggaggagtga ggtgaacgaa tgatgagtac atgcccgatc 5280

ttctgagagg taactggtaa gtttgatttg tggagatctc gacgttggcg atccggcttc 5340

aaaccagaca cgattcgaac cctgcaaccg ttacaccact gatccgttgg ttatcaacca 5400

agcacaactt gattgacctc gccaagaagg cttttcctgc aagcgaatcg aagaacacaa 5460

gcaagaaggt ttaaacatgc aatctgaaat tgcaaatatg aatgacacga atatcaatag 5520

agggttcaag aactcggttt caaaggacta atcgacgcag tggaggagat taagaacggg 5580

agcactggat cattgtaaaa ggatttgtca ccacagttac aatgaacgat tcagtttctc 5640

gatggaaaac taaactctaa acaaaaccca agtctcgaca gcttgcggct gcgtggaata 5700

taaaagagag gcgtcctagg attggaaggc gaccagggat ggtgcccaca acttgggctt 5760

aaggtctgac tcattacata gccaagttgg cttaaaatag atgacgcatc aacttatcgt 5820

agtcacacag attaatccac gtgtcatctg gagctgggac aagatccaaa acgatgacat 5880

cgtcgtcccc tttccaatga gtccaagatc tccctatttc gatgtcgtat gaagaagtta 5940

tgatcgaaac attaacgacg tgtctgctga attcgagggt gacgtgacag ctgagttgga 6000

gatgagttgc aactt 6015

<210> SEQ ID NO: 19

<211> LENGTH: 6045

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: SfiI-2_35 promoter::GUS-plus::2_35 terminator-

SfiI cassette

<400> SEQENCE: 19

gcggccctta aggcctctgg gtactgctat tgaggccttg tctcccaaaa tggggcttga 60

atatgcatga gtataagaag acagaataac ttgaacacat gtcaacaagg gaccaacaat 120

caaagtatta tattgtattc aagtatactt tgctattata tcttatagaa tatattatat 180

attctccaac gccataattt cataatagat gggtagccac ggttcatcct gggctaagtt 240

tcaacccaac tggaacaatt tgtaacttta ttgtgtcgta attgtatcag cttatggggt 300

tagccattct accctatgta ataatatatg tttatatgtt gcaatgctta tggtcctaag 360

gtttcactaa gtgcttatca ttgttggctg catcaccgcc agtctgttag aaaaaaggac 420

atcacgccag gtttataaac caactgtagt gaatatagcg acataatttg agatatcatt 480

gggatttaca tatcgtttct tttttttttc ttttcacaaa gcacttagcc acttaggaca 540

cttcctttct tccttccttc ctttaagctg gactaggaaa cacaaagagt ctgggccttg 600

acgatagcat ggattgggac gactttgtct tttgggcttc ttggtcatca tcgtctccat 660

gcgtgtgcca ccagcgttcc cgttgccctc ctcatccttt ctgacagatg cccccttggt 720

accgtgacat ttctctcttc ttgagaaccg gcttgaccca agccagtgcc accggaaaaa 780

tgagcttcag cacgtgctca ttctcctagg ttgacgtaca caagtgcacg ggccattctg 840

accaatgaac aagaacttga ttgaaacaga aacttcatca ttgcgtctac acacttagca 900

taatgattag tcctaagatt tcattaatta ttaaaatcaa actagggctt tcatatgggt 960

acgtacccta tgtctacttg aagcaggcct tgacacaaga gtccaagaag gcatattcca 1020

tagttctacg attgtcgtcg gtgtcctctt ggtaacagcg attccctcct tggtcaatct 1080

gctggtgatc gcgatgaccc tgtcaatgag atcggaggag acatcgggca acaacctcct 1140

ctttaagact cggtcacctg acctttgttg agatcatccc aacacaaact gctaaaaatc 1200

tcggttcacg atttgatcca tcatctgaag caagtgcaaa cataattgct gattttgtgt 1260

caaatgagaa atataatgca atagtgatgt gaagtatata cccttctttt tttttaggaa 1320

acgctaatgg tttgatgaca attttgttgt gctttttact ttcttttcac atttattttg 1380

tacttctgat tttttaaagt gtaaaacaca attactttga agaattggga aacaatcagc 1440

tcatgactcc agcagtaaaa aaggttaaac tcgaaaaaaa ggggaaaatg atggtttcat 1500

ccgtgacttt gaagattcat gaatcggagt aaaaaaagaa gaattgtgaa tcacaaaccc 1560

tttggctctt gtattcgaaa aagtgggtcc tgttactcct gtaggtgtca tatgtgacaa 1620

aaattatcat agctcaaaga aaaaaaactg taaacaaaaa tggctaccca cctgtttcgt 1680

gacgtggtgg ctcttgtaca tatatatagg gggtgtttga gattgctctg ctccaaattt 1740

ttttagctcc gctttatgtt ttttagtcaa acagtttcag gtccacgcac tcagttttaa 1800

aaaaatggtg gagttgtgag agcacctaga gaggtactct acaaactccg gttttttgtg 1860

aagctgtttc atggtggagt ttgtggagca gagttcgtga agcaatgcca aacacctagt 1920

aacatggtgt tgtacgtggc cgaaaccacc gtagttgaaa aaacaaaaac cgtggaagca 1980

aaagccgcta tagggtaact taataagctc attaacatac ggtaacacaa acaaagaaga 2040

agttttcaca cgtgtgtgtt atatttttct gttcagatta cccaagatcg gagatacgtt 2100

tttgaattag gattcctttc ggcggagaga cgtttttgaa ttagtaaaaa taaaaatata 2160

aaagatacgc tgccgatgcg ttttcgatac atattggaga agtatcagaa aacaaaataa 2220

aaataacaca aaatctgata gtcgtgaggg gatatgtata tcagcctggt caactcacgc 2280

cggccggtac tactctgtga gggctgccac tactgcttat cggagaagta ttcatcagaa 2340

aataaaaaca aaaaacctga tactcgagga tatgctacgt atcacaactc acgcagatac 2400

gacggctagc tgaacagccc acacccacac cctctttata aatgcatggc tcatgcggcg 2460

ctgctccata ttgctcccat tcatcctcgt cctccacgag cctggctcac aggctgtacg 2520

tcgtgcgtcg tcgtcgatgg tagatctgag ggtaaatttc tagtttttct ccttcatttt 2580

cttggttagg acccttttct ctttttattt ttttgagctt tgatctttct ttaaactgat 2640

ctatttttta attgattggt tatggtgtaa atattacata gctttaactg ataatctgat 2700

tactttattt cgtgtgtcta tgatgatgat gatagttaca gaaccgacga actagtctgt 2760

acccgatcaa caccgagacc cgtggcgtct tcgacctcaa tggcgtctgg aacttcaagc 2820

tggactacgg gaaaggactg gaagagaagt ggtacgaaag caagctgacc gacactatta 2880

gtatggccgt cccaagcagt tacaatgaca ttggcgtgac caaggaaatc cgcaaccata 2940

tcggatatgt ctggtacgaa cgtgagttca cggtgccggc ctatctgaag gatcagcgta 3000

tcgtgctccg cttcggctct gcaactcaca aagcaattgt ctatgtcaat ggtgagctgg 3060

tcgtggagca caagggcgga ttcctgccat tcgaagcgga aatcaacaac tcgctgcgtg 3120

atggcatgaa tcgcgtcacc gtcgccgtgg acaacatcct cgacgatagc accctcccgg 3180

tggggctgta cagcgagcgc cacgaagagg gcctcggaaa agtcattcgt aacaagccga 3240

acttcgactt cttcaactat gcaggcctgc accgtccggt gaaaatctac acgaccccgt 3300

ttacgtacgt cgaggacatc tcggttgtga ccgacttcaa tggcccaacc gggactgtga 3360

cctatacggt ggactttcaa ggcaaagccg agaccgtgaa agtgtcggtc gtggatgagg 3420

aaggcaaagt ggtcgcaagc accgagggcc tgagcggtaa cgtggagatt ccgaatgtca 3480

tcctctggga accactgaac acgtatctct accagatcaa agtggaactg gtgaacgacg 3540

gactgaccat cgatgtctat gaagagccgt tcggcgtgcg gaccgtggaa gtcaacgacg 3600

gcaagttcct catcaacaac aaaccgttct acttcaaggg ctttggcaaa catgaggaca 3660

ctcctatcaa cggccgtggc tttaacgaag cgagcaatgt gatggatttc aatatcctca 3720

aatggatcgg cgccaacagc ttccggaccg cacactatcc gtactctgaa gagttgatgc 3780

gtcttgcgga tcgcgagggt ctggtcgtga tcgacgagac tccggcagtt ggcgtgcacc 3840

tcaacttcat ggccaccacg ggactcggcg aaggcagcga gcgcgtcagt acctgggaga 3900

agattcggac gtttgagcac catcaagacg ttctccgtga actggtgtct cgtgacaaga 3960

accatccaag cgtcgtgatg tggagcatcg ccaacgaggc ggcgactgag gaagagggcg 4020

cgtacgagta cttcaagccg ttggtggagc tgaccaagga actcgaccca cagaagcgtc 4080

cggtcacgat cgtgctgttt gtgatggcta ccccggagac ggacaaagtc gccgaactga 4140

ttgacgtcat cgcgctcaat cgctataacg gatggtactt cgatggcggt gatctcgaag 4200

cggccaaagt ccatctccgc caggaatttc acgcgtggaa caagcgttgc ccaggaaagc 4260

cgatcatgat cactgagtac ggcgcagaca ccgttgcggg ctttcacgac attgatccag 4320

tgatgttcac cgaggaatat caagtcgagt actaccaggc gaaccacgtc gtgttcgatg 4380

agtttgagaa cttcgtgggt gagcaagcgt ggaacttcgc ggacttcgcg acctctcagg 4440

gcgtgatgcg cgtccaagga aacaagaagg gcgtgttcac tcgtgaccgc aagccgaagc 4500

tcgccgcgca cgtctttcgc gagcgctgga ccaacattcc agatttcggc tacaagaacg 4560

ctagccatca ccatcaccat cacgtgtgat agcagaggaa cttactgtca caacgcctct 4620

gccaagtcca ataatgtgga tccgtggccc catggccgtc tacttatcta tactgtactt 4680

gaatcaataa tctccttgga catatttgcc atgacatgtc aaataatttc tacacgactt 4740

ttgatttatg gatcaaaaaa ctgttgcaac cttgctcttc ttgttttact ctttttttat 4800

ctttttttat ttcctaagtt gttgtactgt gttttcctct ttttaatttc aataaatctc 4860

ctataggggc taaggcccct ccagttcttt ttttaaaaaa taatttttac cacttgtgga 4920

gatattctaa attcactgtt cataggcttc catttgtatt gatcgagaca ttgagtggag 4980

tgccctatcc ttccacccca ccctctgctg gtcctcttta ttaagggatc cgtctatatt 5040

tgacttgagt gatgtccgtg ttttgtaaac taaatagtga atttatacgt atcgtgtagc 5100

tttaggaaga cgacacttat agacacgagg gttatactgg tcaggcggcc gcagccctac 5160

gtctagtctc aaagatggtt taagtctgtg tttctcgatt gaatgctttg aagttcttac 5220

gataggttaa gtaagctaag gaagagaggt aggagggagg agtgaggtga acgaatgatg 5280

agtacatgcc cgatcttctg agaggtaact ggtaagtttg atttgtggag atctcgacgt 5340

tggcgatccg gcttcaaacc agacacgatt cgaaccctgc aaccgttaca ccactgatcc 5400

gttggttatc aaccaagcac aacttgattg acctcgccaa gaaggctttt cctgcaagcg 5460

aatcgaagaa cacaagcaag aaggtttaaa catgcaatct gaaattgcaa atatgaatga 5520

cacgaatatc aatagagggt tcaagaactc ggtttcaaag gactaatcga cgcagtggag 5580

gagattaaga acgggagcac tggatcattg taaaaggatt tgtcaccaca gttacaatga 5640

acgattcagt ttctcgatgg aaaactaaac tctaaacaaa acccaagtct cgacagcttg 5700

cggctgcgtg gaatataaaa gagaggcgtc ctaggattgg aaggcgacca gggatggtgc 5760

ccacaacttg ggcttaaggt ctgactcatt acatagccaa gttggcttaa aatagatgac 5820

gcatcaactt atcgtagtca cacagattaa tccacgtgtc atctggagct gggacaagat 5880

ccaaaacgat gacatcgtcg tcccctttcc aatgagtcca agatctccct atttcgatgt 5940

cgtatgaaga agttatgatc gaaacattaa cgacgtgtct gctgaattcg agggtgacgt 6000

gacagctgag ttggagatga gttgcaactt ggccgccatg gccgc 6045

<210> SEQ ID NO: 20

<211> LENGTH: 2534

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: SfiI-2_35 promoter

<400> SEQENCE: 20

ggcccttaag gcctctgggt actgctattg aggccttgtc tcccaaaatg gggcttgaat 60

atgcatgagt ataagaagac agaataactt gaacacatgt caacaaggga ccaacaatca 120

aagtattata ttgtattcaa gtatactttg ctattatatc ttatagaata tattatatat 180

tctccaacgc cataatttca taatagatgg gtagccacgg ttcatcctgg gctaagtttc 240

aacccaactg gaacaatttg taactttatt gtgtcgtaat tgtatcagct tatggggtta 300

gccattctac cctatgtaat aatatatgtt tatatgttgc aatgcttatg gtcctaaggt 360

ttcactaagt gcttatcatt gttggctgca tcaccgccag tctgttagaa aaaaggacat 420

cacgccaggt ttataaacca actgtagtga atatagcgac ataatttgag atatcattgg 480

gatttacata tcgtttcttt tttttttctt ttcacaaagc acttagccac ttaggacact 540

tcctttcttc cttccttcct ttaagctgga ctaggaaaca caaagagtct gggccttgac 600

gatagcatgg attgggacga ctttgtcttt tgggcttctt ggtcatcatc gtctccatgc 660

gtgtgccacc agcgttcccg ttgccctcct catcctttct gacagatgcc cccttggtac 720

cgtgacattt ctctcttctt gagaaccggc ttgacccaag ccagtgccac cggaaaaatg 780

agcttcagca cgtgctcatt ctcctaggtt gacgtacaca agtgcacggg ccattctgac 840

caatgaacaa gaacttgatt gaaacagaaa cttcatcatt gcgtctacac acttagcata 900

atgattagtc ctaagatttc attaattatt aaaatcaaac tagggctttc atatgggtac 960

gtaccctatg tctacttgaa gcaggccttg acacaagagt ccaagaaggc atattccata 1020

gttctacgat tgtcgtcggt gtcctcttgg taacagcgat tccctccttg gtcaatctgc 1080

tggtgatcgc gatgaccctg tcaatgagat cggaggagac atcgggcaac aacctcctct 1140

ttaagactcg gtcacctgac ctttgttgag atcatcccaa cacaaactgc taaaaatctc 1200

ggttcacgat ttgatccatc atctgaagca agtgcaaaca taattgctga ttttgtgtca 1260

aatgagaaat ataatgcaat agtgatgtga agtatatacc cttctttttt tttaggaaac 1320

gctaatggtt tgatgacaat tttgttgtgc tttttacttt cttttcacat ttattttgta 1380

cttctgattt tttaaagtgt aaaacacaat tactttgaag aattgggaaa caatcagctc 1440

atgactccag cagtaaaaaa ggttaaactc gaaaaaaagg ggaaaatgat ggtttcatcc 1500

gtgactttga agattcatga atcggagtaa aaaaagaaga attgtgaatc acaaaccctt 1560

tggctcttgt attcgaaaaa gtgggtcctg ttactcctgt aggtgtcata tgtgacaaaa 1620

attatcatag ctcaaagaaa aaaaactgta aacaaaaatg gctacccacc tgtttcgtga 1680

cgtggtggct cttgtacata tatatagggg gtgtttgaga ttgctctgct ccaaattttt 1740

ttagctccgc tttatgtttt ttagtcaaac agtttcaggt ccacgcactc agttttaaaa 1800

aaatggtgga gttgtgagag cacctagaga ggtactctac aaactccggt tttttgtgaa 1860

gctgtttcat ggtggagttt gtggagcaga gttcgtgaag caatgccaaa cacctagtaa 1920

catggtgttg tacgtggccg aaaccaccgt agttgaaaaa acaaaaaccg tggaagcaaa 1980

agccgctata gggtaactta ataagctcat taacatacgg taacacaaac aaagaagaag 2040

ttttcacacg tgtgtgttat atttttctgt tcagattacc caagatcgga gatacgtttt 2100

tgaattagga ttcctttcgg cggagagacg tttttgaatt agtaaaaata aaaatataaa 2160

agatacgctg ccgatgcgtt ttcgatacat attggagaag tatcagaaaa caaaataaaa 2220

ataacacaaa atctgatagt cgtgagggga tatgtatatc agcctggtca actcacgccg 2280

gccggtacta ctctgtgagg gctgccacta ctgcttatcg gagaagtatt catcagaaaa 2340

taaaaacaaa aaacctgata ctcgaggata tgctacgtat cacaactcac gcagatacga 2400

cggctagctg aacagcccac acccacaccc tctttataaa tgcatggctc atgcggcgct 2460

gctccatatt gctcccattc atcctcgtcc tccacgagcc tggctcacag gctgtacgtc 2520

gtgcgtcgtc gtcg 2534

<210> SEQ ID NO: 21

<211> LENGTH: 1454

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_35 terminator- SfiI

<400> SEQENCE: 21

tagcagagga acttactgtc acaacgcctc tgccaagtcc aataatgtgg atccgtggcc 60

ccatggccgt ctacttatct atactgtact tgaatcaata atctccttgg acatatttgc 120

catgacatgt caaataattt ctacacgact tttgatttat ggatcaaaaa actgttgcaa 180

ccttgctctt cttgttttac tcttttttta tcttttttta tttcctaagt tgttgtactg 240

tgttttcctc tttttaattt caataaatct cctatagggg ctaaggcccc tccagttctt 300

tttttaaaaa ataattttta ccacttgtgg agatattcta aattcactgt tcataggctt 360

ccatttgtat tgatcgagac attgagtgga gtgccctatc cttccacccc accctctgct 420

ggtcctcttt attaagggat ccgtctatat ttgacttgag tgatgtccgt gttttgtaaa 480

ctaaatagtg aatttatacg tatcgtgtag ctttaggaag acgacactta tagacacgag 540

ggttatactg gtcaggcggc cgcagcccta cgtctagtct caaagatggt ttaagtctgt 600

gtttctcgat tgaatgcttt gaagttctta cgataggtta agtaagctaa ggaagagagg 660

taggagggag gagtgaggtg aacgaatgat gagtacatgc ccgatcttct gagaggtaac 720

tggtaagttt gatttgtgga gatctcgacg ttggcgatcc ggcttcaaac cagacacgat 780

tcgaaccctg caaccgttac accactgatc cgttggttat caaccaagca caacttgatt 840

gacctcgcca agaaggcttt tcctgcaagc gaatcgaaga acacaagcaa gaaggtttaa 900

acatgcaatc tgaaattgca aatatgaatg acacgaatat caatagaggg ttcaagaact 960

cggtttcaaa ggactaatcg acgcagtgga ggagattaag aacgggagca ctggatcatt 1020

gtaaaaggat ttgtcaccac agttacaatg aacgattcag tttctcgatg gaaaactaaa 1080

ctctaaacaa aacccaagtc tcgacagctt gcggctgcgt ggaatataaa agagaggcgt 1140

cctaggattg gaaggcgacc agggatggtg cccacaactt gggcttaagg tctgactcat 1200

tacatagcca agttggctta aaatagatga cgcatcaact tatcgtagtc acacagatta 1260

atccacgtgt catctggagc tgggacaaga tccaaaacga tgacatcgtc gtcccctttc 1320

caatgagtcc aagatctccc tatttcgatg tcgtatgaag aagttatgat cgaaacatta 1380

acgacgtgtc tgctgaattc gagggtgacg tgacagctga gttggagatg agttgcaact 1440

tggccgccat ggcc 1454

<210> SEQ ID NO: 22

<211> LENGTH: 6156

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_36 promoter::GUSPlus::2_36-3′ cassette

<400> SEQENCE: 22

caatatgcat cggcatcttg ccgatgaggc ggctgcggat ctggcacctg atggcgaacc 60

tccacgtgtc tgttcgggac gtgatctgta cggaacattg tattgatcac ctgtcctcca 120

atctgcggac caccaaactg ctgtccaccg attggctgtc ctccgaattg ctgtccaaaa 180

ttcattggct ggttgggaat cccctgacct tggaacccgg gatagacctg cccttgctgg 240

aaccctgtag tctggtaact ctgctggggc gattgtggaa aggcttgctg tccaaaccat 300

ccactattag cgttcatcgg catagatgct gccgatgatt ggtaattggg taccgtcgtt 360

gaattgacat accccgactg ggccgcagac ctctgttgta tcagcattga ctttgccgat 420

gcgttgggca tctggaacat tgaatcttga ggatttccag tgtgaggcct tgcagtagtg 480

gttgtggtat accgaggact ctggttcatc ggcgcattgg gaggtgccga tgtcatagga 540

gttttgcccc tcatgtcagt tatctgtgat gttcccggtg tcacctctgg aggcataccg 600

taaccccacc agttgggagg aagagtcaac cctgacattg ccaatgccaa catatctgtt 660

gtcagtttat gctgcccaac tgaaatctgt gggttggttg ccatcggcat agatagtgca 720

ccagtagtcc ccgatgtact tggagggacg gcagattgtg cacttgcatt cgtcaaggca 780

gccgacggag ccgtgacctc tggtgccgtt ggctgatgat gggaggggcc cacatactct 840

ggtgggattt gtccttcctt gaaagtcctt gccacggcat tgaaaaccgt attagacagt 900

acaccagctt ggttaatcaa cgctcgattg atggcattgt caaccatatc ttgaagcttg 960

ccaggattgg cgtcaaaggt aacctgccgt ggtgccggca gcgcatcttt ctgaaccact 1020

tcgccgctcc tgtttatgct gaaagacctc aggcattgct gcttgaactc ttccatggct 1080

tgggcaatag cttgcttctg ctcatccttg aggttggcct ccgtcacggg gatgacgttc 1140

tcttgatcga ggtcagagat cgacatgttg atcttgatct tgaatctgtc ccaccgggcg 1200

tgccaaaaga tgtgttgatg caaaagctga tctgcaaaca caaagggcta atacccgatt 1260

tcaacgttaa ggcgtgccag ccgatttgac cttactatcg gcaaaggtga taactcgaat 1320

actttggtcc cgacaacagc gatgcgccca gatgccacgg ccaagaggta ttcacgcgga 1380

acttgagaac acgccgagct taagtcgacg aattcctaag aactcgtaat aaaaaggaaa 1440

aagtatgaca aagtcgtcga aatagtagat gctggaatat gagtaaaaac ttgtgtttga 1500

ttgattgata gatcattaca aggccctagg gtctatattt ataccctgct caaagagtta 1560

caaccagaca caattagaat tcgaattcca aattacacgg aatccgtata caaaacgatg 1620

taaataatta aggaaataac aaaactatcc cccgtgacaa actgaaactc ctccacacaa 1680

cgaccggcag cttccggact ccctcttttg catcatcggc agaccctttg ccatagtcat 1740

cggcagactt tcttatctag ccatcggcac aatcacatca ctgtctgtag acttagtcac 1800

gttcagcttc tccttcatcg gcaactatcc tcatcggcaa cccaccctgt agacagcata 1860

ctgccacctt atcctgccat cctagacaca tgcccaaaaa cggtgtcaac agtacttggt 1920

gtcttggtga ttgaatacta tcagcgaatc aggtcaacga tctactagca attaacaata 1980

tatcatttct taatcttttg ctagttccgt ttcaattaga aaactatctc taccactcat 2040

ctgcatgcta ttgttcttaa ttaattactt gatatatatg gagcatatct ctaccactct 2100

catctgcaca tgctaatata atatatagtg atttgcacga ttcacaatca ataatttgca 2160

tgataatata ctggaacacg tgaaccagag gcacttacgg ccgcgtgttt attacttaat 2220

ttgccatata agatactata tgattccttt cacagattgg cagagatatg acatgtgtta 2280

tcttattctg tgattaacta tgtatatatg cccgggattt aatttttgcc tgatccgaaa 2340

caaatgggga accactactg cgtcgcattc ctcgcataag atatattcta cagtaataaa 2400

caacgacgtc tgcccacaga acgaaatcgc tcgaagcctc aaaacgacgg acggagtaac 2460

caatgcatgc ccaagctctc tatatatatt cgcttgaacg tctctccaat cacatcacac 2520

ggcgagctag ctaggaaaca aacacacatc aacatacagc aaacattaga caagaatcaa 2580

acacgttcgc aggaaaagaa tagaagctag ggaggaggaa atggtagatc tgagggtaaa 2640

tttctagttt ttctccttca ttttcttggt taggaccctt ttctcttttt atttttttga 2700

gctttgatct ttctttaaac tgatctattt tttaattgat tggttatggt gtaaatatta 2760

catagcttta actgataatc tgattacttt atttcgtgtg tctatgatga tgatgatagt 2820

tacagaaccg acgaactagt ctgtacccga tcaacaccga gacccgtggc gtcttcgacc 2880

tcaatggcgt ctggaacttc aagctggact acgggaaagg actggaagag aagtggtacg 2940

aaagcaagct gaccgacact attagtatgg ccgtcccaag cagttacaat gacattggcg 3000

tgaccaagga aatccgcaac catatcggat atgtctggta cgaacgtgag ttcacggtgc 3060

cggcctatct gaaggatcag cgtatcgtgc tccgcttcgg ctctgcaact cacaaagcaa 3120

ttgtctatgt caatggtgag ctggtcgtgg agcacaaggg cggattcctg ccattcgaag 3180

cggaaatcaa caactcgctg cgtgatggca tgaatcgcgt caccgtcgcc gtggacaaca 3240

tcctcgacga tagcaccctc ccggtggggc tgtacagcga gcgccacgaa gagggcctcg 3300

gaaaagtcat tcgtaacaag ccgaacttcg acttcttcaa ctatgcaggc ctgcaccgtc 3360

cggtgaaaat ctacacgacc ccgtttacgt acgtcgagga catctcggtt gtgaccgact 3420

tcaatggccc aaccgggact gtgacctata cggtggactt tcaaggcaaa gccgagaccg 3480

tgaaagtgtc ggtcgtggat gaggaaggca aagtggtcgc aagcaccgag ggcctgagcg 3540

gtaacgtgga gattccgaat gtcatcctct gggaaccact gaacacgtat ctctaccaga 3600

tcaaagtgga actggtgaac gacggactga ccatcgatgt ctatgaagag ccgttcggcg 3660

tgcggaccgt ggaagtcaac gacggcaagt tcctcatcaa caacaaaccg ttctacttca 3720

agggctttgg caaacatgag gacactccta tcaacggccg tggctttaac gaagcgagca 3780

atgtgatgga tttcaatatc ctcaaatgga tcggcgccaa cagcttccgg accgcacact 3840

atccgtactc tgaagagttg atgcgtcttg cggatcgcga gggtctggtc gtgatcgacg 3900

agactccggc agttggcgtg cacctcaact tcatggccac cacgggactc ggcgaaggca 3960

gcgagcgcgt cagtacctgg gagaagattc ggacgtttga gcaccatcaa gacgttctcc 4020

gtgaactggt gtctcgtgac aagaaccatc caagcgtcgt gatgtggagc atcgccaacg 4080

aggcggcgac tgaggaagag ggcgcgtacg agtacttcaa gccgttggtg gagctgacca 4140

aggaactcga cccacagaag cgtccggtca cgatcgtgct gtttgtgatg gctaccccgg 4200

agacggacaa agtcgccgaa ctgattgacg tcatcgcgct caatcgctat aacggatggt 4260

acttcgatgg cggtgatctc gaagcggcca aagtccatct ccgccaggaa tttcacgcgt 4320

ggaacaagcg ttgcccagga aagccgatca tgatcactga gtacggcgca gacaccgttg 4380

cgggctttca cgacattgat ccagtgatgt tcaccgagga atatcaagtc gagtactacc 4440

aggcgaacca cgtcgtgttc gatgagtttg agaacttcgt gggtgagcaa gcgtggaact 4500

tcgcggactt cgcgacctct cagggcgtga tgcgcgtcca aggaaacaag aagggcgtgt 4560

tcactcgtga ccgcaagccg aagctcgccg cgcacgtctt tcgcgagcgc tggaccaaca 4620

ttccagattt cggctacaag aacgctagcc atcaccatca ccatcacgtg tgaaccaaca 4680

tactcgatcg gttcctatat atgctcgatg aaggtttacg tggtgccata tattgccgat 4740

tcagtgctcc tgttcgttcg tccttggtgc gatgttgttg cacgtgcggt atatgatctg 4800

tttagtttat tttatctact atgaggtgtg aaaaggctat tatgacctat gtgttttaga 4860

aaaatatgtt atgagctatg tggtgtggaa aataaagctc ttgtgagttt tgtgttgtgt 4920

tgtgaaaaaa gctataaact gtttctttgt aataaatatg aaacctgtcc ccttttttat 4980

ctcctttgaa acagctataa tacaaaatgc atctctattg caatgaataa tcctcttcaa 5040

agagagaggt gccctcagga atacaggtgg tgcatggctt tcgtcagctc atgccgtaag 5100

gtattgggtt aagtctcgca acgagcgtaa cccttgtgtt gatgtctagt ccagtgtagc 5160

tgacattgct aaaatgcatc aacttggtgc taaaaatagg agaacatata gcattataaa 5220

gactgcttac caaggggttt aatataatgt gtccaagaat aaaatttaca aacctcataa 5280

atgaccccgg ttatggtatt tgtcatggca attgcctgtt cgaggtatgc agattttctt 5340

atgcggccag ccttgagcgg tgaacagtac tgcgggttcg tcttcaaggg aagtttcata 5400

tttggagaca ataggttgga cagagacagc ctgtgctttg gaaccaggct cagcaagttg 5460

acttgtcgcc ttcacttgct caacttgggt gatgaggaca aggccgctat acatatagcc 5520

atgcttagag aatcacatgc agaccaagta gatcaacaag gggacctgaa tggagaagaa 5580

ggtctaaagc ttatacggtt tcagtcaccg gtggaagcct aaatcaagtt cgagtccacc 5640

tcggaatcta ggagcagtct gtagtaaaac ggatgcccag gaaacattct gattctgttt 5700

ttgatgatcc acatatggat gaaaagataa tttgataagc taactaatgg ctttagtttc 5760

acgtcaaaat tcatccgaag tcaacaggaa tcgtcaaaac aagttagcat ccagaatctg 5820

caagggtgct gcgtcactgt ttttggtccg ttgggttgtg tatcatcatt gagtccatta 5880

ggagaggcgt ccagagggag tgacgaccct aacaccttat aatcagtaac cgccaccctc 5940

attaggattt gggttattct atttacaata gtttcactat cattggtttt taagacccca 6000

actttgtgag attaatcatt catttgcaaa tttagttgca tttttttgtt cttgcttgtg 6060

ttctttgatt tgcaggcaag gattagcctt cttggcgagg tcgaacgtgc agcgccggtc 6120

aataacctga gatgacgtgg tgctaaggtt gcatgg 6156

<210> SEQ ID NO: 23

<211> LENGTH: 6184

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: SfiI-2_36 promoter::GUS-plus::2_36 terminator-

SfiI cassette

<400> SEQENCE: 23

gcggccctta aggcccaata tgcatcggca tcttgccgat gaggcggctg cggatctggc 60

acctgatggc gaacctccac gtgtctgttc gggacgtgat ctgtacggaa cattgtattg 120

atcacctgtc ctccaatctg cggaccacca aactgctgtc caccgattgg ctgtcctccg 180

aattgctgtc caaaattcat tggctggttg ggaatcccct gaccttggaa cccgggatag 240

acctgccctt gctggaaccc tgtagtctgg taactctgct ggggcgattg tggaaaggct 300

tgctgtccaa accatccact attagcgttc atcggcatag atgctgccga tgattggtaa 360

ttgggtaccg tcgttgaatt gacatacccc gactgggccg cagacctctg ttgtatcagc 420

attgactttg ccgatgcgtt gggcatctgg aacattgaat cttgaggatt tccagtgtga 480

ggccttgcag tagtggttgt ggtataccga ggactctggt tcatcggcgc attgggaggt 540

gccgatgtca taggagtttt gcccctcatg tcagttatct gtgatgttcc cggtgtcacc 600

tctggaggca taccgtaacc ccaccagttg ggaggaagag tcaaccctga cattgccaat 660

gccaacatat ctgttgtcag tttatgctgc ccaactgaaa tctgtgggtt ggttgccatc 720

ggcatagata gtgcaccagt agtccccgat gtacttggag ggacggcaga ttgtgcactt 780

gcattcgtca aggcagccga cggagccgtg acctctggtg ccgttggctg atgatgggag 840

gggcccacat actctggtgg gatttgtcct tccttgaaag tccttgccac ggcattgaaa 900

accgtattag acagtacacc agcttggtta atcaacgctc gattgatggc attgtcaacc 960

atatcttgaa gcttgccagg attggcgtca aaggtaacct gccgtggtgc cggcagcgca 1020

tctttctgaa ccacttcgcc gctcctgttt atgctgaaag acctcaggca ttgctgcttg 1080

aactcttcca tggcttgggc aatagcttgc ttctgctcat ccttgaggtt ggcctccgtc 1140

acggggatga cgttctcttg atcgaggtca gagatcgaca tgttgatctt gatcttgaat 1200

ctgtcccacc gggcgtgcca aaagatgtgt tgatgcaaaa gctgatctgc aaacacaaag 1260

ggctaatacc cgatttcaac gttaaggcgt gccagccgat ttgaccttac tatcggcaaa 1320

ggtgataact cgaatacttt ggtcccgaca acagcgatgc gcccagatgc cacggccaag 1380

aggtattcac gcggaacttg agaacacgcc gagcttaagt cgacgaattc ctaagaactc 1440

gtaataaaaa ggaaaaagta tgacaaagtc gtcgaaatag tagatgctgg aatatgagta 1500

aaaacttgtg tttgattgat tgatagatca ttacaaggcc ctagggtcta tatttatacc 1560

ctgctcaaag agttacaacc agacacaatt agaattcgaa ttccaaatta cacggaatcc 1620

gtatacaaaa cgatgtaaat aattaaggaa ataacaaaac tatcccccgt gacaaactga 1680

aactcctcca cacaacgacc ggcagcttcc ggactccctc ttttgcatca tcggcagacc 1740

ctttgccata gtcatcggca gactttctta tctagccatc ggcacaatca catcactgtc 1800

tgtagactta gtcacgttca gcttctcctt catcggcaac tatcctcatc ggcaacccac 1860

cctgtagaca gcatactgcc accttatcct gccatcctag acacatgccc aaaaacggtg 1920

tcaacagtac ttggtgtctt ggtgattgaa tactatcagc gaatcaggtc aacgatctac 1980

tagcaattaa caatatatca tttcttaatc ttttgctagt tccgtttcaa ttagaaaact 2040

atctctacca ctcatctgca tgctattgtt cttaattaat tacttgatat atatggagca 2100

tatctctacc actctcatct gcacatgcta atataatata tagtgatttg cacgattcac 2160

aatcaataat ttgcatgata atatactgga acacgtgaac cagaggcact tacggccgcg 2220

tgtttattac ttaatttgcc atataagata ctatatgatt cctttcacag attggcagag 2280

atatgacatg tgttatctta ttctgtgatt aactatgtat atatgcccgg gatttaattt 2340

ttgcctgatc cgaaacaaat ggggaaccac tactgcgtcg cattcctcgc ataagatata 2400

ttctacagta ataaacaacg acgtctgccc acagaacgaa atcgctcgaa gcctcaaaac 2460

gacggacgga gtaaccaatg catgcccaag ctctctatat atattcgctt gaacgtctct 2520

ccaatcacat cacacggcga gctagctagg aaacaaacac acatcaacat acagcaaaca 2580

ttagacaaga atcaaacacg ttcgcaggaa aagaatagaa gctagggagg aggaaatggt 2640

agatctgagg gtaaatttct agtttttctc cttcattttc ttggttagga cccttttctc 2700

tttttatttt tttgagcttt gatctttctt taaactgatc tattttttaa ttgattggtt 2760

atggtgtaaa tattacatag ctttaactga taatctgatt actttatttc gtgtgtctat 2820

gatgatgatg atagttacag aaccgacgaa ctagtctgta cccgatcaac accgagaccc 2880

gtggcgtctt cgacctcaat ggcgtctgga acttcaagct ggactacggg aaaggactgg 2940

aagagaagtg gtacgaaagc aagctgaccg acactattag tatggccgtc ccaagcagtt 3000

acaatgacat tggcgtgacc aaggaaatcc gcaaccatat cggatatgtc tggtacgaac 3060

gtgagttcac ggtgccggcc tatctgaagg atcagcgtat cgtgctccgc ttcggctctg 3120

caactcacaa agcaattgtc tatgtcaatg gtgagctggt cgtggagcac aagggcggat 3180

tcctgccatt cgaagcggaa atcaacaact cgctgcgtga tggcatgaat cgcgtcaccg 3240

tcgccgtgga caacatcctc gacgatagca ccctcccggt ggggctgtac agcgagcgcc 3300

acgaagaggg cctcggaaaa gtcattcgta acaagccgaa cttcgacttc ttcaactatg 3360

caggcctgca ccgtccggtg aaaatctaca cgaccccgtt tacgtacgtc gaggacatct 3420

cggttgtgac cgacttcaat ggcccaaccg ggactgtgac ctatacggtg gactttcaag 3480

gcaaagccga gaccgtgaaa gtgtcggtcg tggatgagga aggcaaagtg gtcgcaagca 3540

ccgagggcct gagcggtaac gtggagattc cgaatgtcat cctctgggaa ccactgaaca 3600

cgtatctcta ccagatcaaa gtggaactgg tgaacgacgg actgaccatc gatgtctatg 3660

aagagccgtt cggcgtgcgg accgtggaag tcaacgacgg caagttcctc atcaacaaca 3720

aaccgttcta cttcaagggc tttggcaaac atgaggacac tcctatcaac ggccgtggct 3780

ttaacgaagc gagcaatgtg atggatttca atatcctcaa atggatcggc gccaacagct 3840

tccggaccgc acactatccg tactctgaag agttgatgcg tcttgcggat cgcgagggtc 3900

tggtcgtgat cgacgagact ccggcagttg gcgtgcacct caacttcatg gccaccacgg 3960

gactcggcga aggcagcgag cgcgtcagta cctgggagaa gattcggacg tttgagcacc 4020

atcaagacgt tctccgtgaa ctggtgtctc gtgacaagaa ccatccaagc gtcgtgatgt 4080

ggagcatcgc caacgaggcg gcgactgagg aagagggcgc gtacgagtac ttcaagccgt 4140

tggtggagct gaccaaggaa ctcgacccac agaagcgtcc ggtcacgatc gtgctgtttg 4200

tgatggctac cccggagacg gacaaagtcg ccgaactgat tgacgtcatc gcgctcaatc 4260

gctataacgg atggtacttc gatggcggtg atctcgaagc ggccaaagtc catctccgcc 4320

aggaatttca cgcgtggaac aagcgttgcc caggaaagcc gatcatgatc actgagtacg 4380

gcgcagacac cgttgcgggc tttcacgaca ttgatccagt gatgttcacc gaggaatatc 4440

aagtcgagta ctaccaggcg aaccacgtcg tgttcgatga gtttgagaac ttcgtgggtg 4500

agcaagcgtg gaacttcgcg gacttcgcga cctctcaggg cgtgatgcgc gtccaaggaa 4560

acaagaaggg cgtgttcact cgtgaccgca agccgaagct cgccgcgcac gtctttcgcg 4620

agcgctggac caacattcca gatttcggct acaagaacgc tagccatcac catcaccatc 4680

acgtgtgaac caacatactc gatcggttcc tatatatgct cgatgaaggt ttacgtggtg 4740

ccatatattg ccgattcagt gctcctgttc gttcgtcctt ggtgcgatgt tgttgcacgt 4800

gcggtatatg atctgtttag tttattttat ctactatgag gtgtgaaaag gctattatga 4860

cctatgtgtt ttagaaaaat atgttatgag ctatgtggtg tggaaaataa agctcttgtg 4920

agttttgtgt tgtgttgtga aaaaagctat aaactgtttc tttgtaataa atatgaaacc 4980

tgtccccttt tttatctcct ttgaaacagc tataatacaa aatgcatctc tattgcaatg 5040

aataatcctc ttcaaagaga gaggtgccct caggaataca ggtggtgcat ggctttcgtc 5100

agctcatgcc gtaaggtatt gggttaagtc tcgcaacgag cgtaaccctt gtgttgatgt 5160

ctagtccagt gtagctgaca ttgctaaaat gcatcaactt ggtgctaaaa ataggagaac 5220

atatagcatt ataaagactg cttaccaagg ggtttaatat aatgtgtcca agaataaaat 5280

ttacaaacct cataaatgac cccggttatg gtatttgtca tggcaattgc ctgttcgagg 5340

tatgcagatt ttcttatgcg gccagccttg agcggtgaac agtactgcgg gttcgtcttc 5400

aagggaagtt tcatatttgg agacaatagg ttggacagag acagcctgtg ctttggaacc 5460

aggctcagca agttgacttg tcgccttcac ttgctcaact tgggtgatga ggacaaggcc 5520

gctatacata tagccatgct tagagaatca catgcagacc aagtagatca acaaggggac 5580

ctgaatggag aagaaggtct aaagcttata cggtttcagt caccggtgga agcctaaatc 5640

aagttcgagt ccacctcgga atctaggagc agtctgtagt aaaacggatg cccaggaaac 5700

attctgattc tgtttttgat gatccacata tggatgaaaa gataatttga taagctaact 5760

aatggcttta gtttcacgtc aaaattcatc cgaagtcaac aggaatcgtc aaaacaagtt 5820

agcatccaga atctgcaagg gtgctgcgtc actgtttttg gtccgttggg ttgtgtatca 5880

tcattgagtc cattaggaga ggcgtccaga gggagtgacg accctaacac cttataatca 5940

gtaaccgcca ccctcattag gatttgggtt attctattta caatagtttc actatcattg 6000

gtttttaaga ccccaacttt gtgagattaa tcattcattt gcaaatttag ttgcattttt 6060

ttgttcttgc ttgtgttctt tgatttgcag gcaaggatta gccttcttgg cgaggtcgaa 6120

cgtgcagcgc cggtcaataa cctgagatga cgtggtgcta aggttgcatg gccgccatgg 6180

ccgc 6184

<210> SEQ ID NO: 24

<211> LENGTH: 2633

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: SfiI-2_36 promoter

<400> SEQENCE: 24

ggcccttaag gcccaatatg catcggcatc ttgccgatga ggcggctgcg gatctggcac 60

ctgatggcga acctccacgt gtctgttcgg gacgtgatct gtacggaaca ttgtattgat 120

cacctgtcct ccaatctgcg gaccaccaaa ctgctgtcca ccgattggct gtcctccgaa 180

ttgctgtcca aaattcattg gctggttggg aatcccctga ccttggaacc cgggatagac 240

ctgcccttgc tggaaccctg tagtctggta actctgctgg ggcgattgtg gaaaggcttg 300

ctgtccaaac catccactat tagcgttcat cggcatagat gctgccgatg attggtaatt 360

gggtaccgtc gttgaattga cataccccga ctgggccgca gacctctgtt gtatcagcat 420

tgactttgcc gatgcgttgg gcatctggaa cattgaatct tgaggatttc cagtgtgagg 480

ccttgcagta gtggttgtgg tataccgagg actctggttc atcggcgcat tgggaggtgc 540

cgatgtcata ggagttttgc ccctcatgtc agttatctgt gatgttcccg gtgtcacctc 600

tggaggcata ccgtaacccc accagttggg aggaagagtc aaccctgaca ttgccaatgc 660

caacatatct gttgtcagtt tatgctgccc aactgaaatc tgtgggttgg ttgccatcgg 720

catagatagt gcaccagtag tccccgatgt acttggaggg acggcagatt gtgcacttgc 780

attcgtcaag gcagccgacg gagccgtgac ctctggtgcc gttggctgat gatgggaggg 840

gcccacatac tctggtggga tttgtccttc cttgaaagtc cttgccacgg cattgaaaac 900

cgtattagac agtacaccag cttggttaat caacgctcga ttgatggcat tgtcaaccat 960

atcttgaagc ttgccaggat tggcgtcaaa ggtaacctgc cgtggtgccg gcagcgcatc 1020

tttctgaacc acttcgccgc tcctgtttat gctgaaagac ctcaggcatt gctgcttgaa 1080

ctcttccatg gcttgggcaa tagcttgctt ctgctcatcc ttgaggttgg cctccgtcac 1140

ggggatgacg ttctcttgat cgaggtcaga gatcgacatg ttgatcttga tcttgaatct 1200

gtcccaccgg gcgtgccaaa agatgtgttg atgcaaaagc tgatctgcaa acacaaaggg 1260

ctaatacccg atttcaacgt taaggcgtgc cagccgattt gaccttacta tcggcaaagg 1320

tgataactcg aatactttgg tcccgacaac agcgatgcgc ccagatgcca cggccaagag 1380

gtattcacgc ggaacttgag aacacgccga gcttaagtcg acgaattcct aagaactcgt 1440

aataaaaagg aaaaagtatg acaaagtcgt cgaaatagta gatgctggaa tatgagtaaa 1500

aacttgtgtt tgattgattg atagatcatt acaaggccct agggtctata tttataccct 1560

gctcaaagag ttacaaccag acacaattag aattcgaatt ccaaattaca cggaatccgt 1620

atacaaaacg atgtaaataa ttaaggaaat aacaaaacta tcccccgtga caaactgaaa 1680

ctcctccaca caacgaccgg cagcttccgg actccctctt ttgcatcatc ggcagaccct 1740

ttgccatagt catcggcaga ctttcttatc tagccatcgg cacaatcaca tcactgtctg 1800

tagacttagt cacgttcagc ttctccttca tcggcaacta tcctcatcgg caacccaccc 1860

tgtagacagc atactgccac cttatcctgc catcctagac acatgcccaa aaacggtgtc 1920

aacagtactt ggtgtcttgg tgattgaata ctatcagcga atcaggtcaa cgatctacta 1980

gcaattaaca atatatcatt tcttaatctt ttgctagttc cgtttcaatt agaaaactat 2040

ctctaccact catctgcatg ctattgttct taattaatta cttgatatat atggagcata 2100

tctctaccac tctcatctgc acatgctaat ataatatata gtgatttgca cgattcacaa 2160

tcaataattt gcatgataat atactggaac acgtgaacca gaggcactta cggccgcgtg 2220

tttattactt aatttgccat ataagatact atatgattcc tttcacagat tggcagagat 2280

atgacatgtg ttatcttatt ctgtgattaa ctatgtatat atgcccggga tttaattttt 2340

gcctgatccg aaacaaatgg ggaaccacta ctgcgtcgca ttcctcgcat aagatatatt 2400

ctacagtaat aaacaacgac gtctgcccac agaacgaaat cgctcgaagc ctcaaaacga 2460

cggacggagt aaccaatgca tgcccaagct ctctatatat attcgcttga acgtctctcc 2520

aatcacatca cacggcgagc tagctaggaa acaaacacac atcaacatac agcaaacatt 2580

agacaagaat caaacacgtt cgcaggaaaa gaatagaagc tagggaggag gaa 2633

<210> SEQ ID NO: 25

<211> LENGTH: 1494

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_36 terminator- SfiI

<400> SEQENCE: 25

accaacatac tcgatcggtt cctatatatg ctcgatgaag gtttacgtgg tgccatatat 60

tgccgattca gtgctcctgt tcgttcgtcc ttggtgcgat gttgttgcac gtgcggtata 120

tgatctgttt agtttatttt atctactatg aggtgtgaaa aggctattat gacctatgtg 180

ttttagaaaa atatgttatg agctatgtgg tgtggaaaat aaagctcttg tgagttttgt 240

gttgtgttgt gaaaaaagct ataaactgtt tctttgtaat aaatatgaaa cctgtcccct 300

tttttatctc ctttgaaaca gctataatac aaaatgcatc tctattgcaa tgaataatcc 360

tcttcaaaga gagaggtgcc ctcaggaata caggtggtgc atggctttcg tcagctcatg 420

ccgtaaggta ttgggttaag tctcgcaacg agcgtaaccc ttgtgttgat gtctagtcca 480

gtgtagctga cattgctaaa atgcatcaac ttggtgctaa aaataggaga acatatagca 540

ttataaagac tgcttaccaa ggggtttaat ataatgtgtc caagaataaa atttacaaac 600

ctcataaatg accccggtta tggtatttgt catggcaatt gcctgttcga ggtatgcaga 660

ttttcttatg cggccagcct tgagcggtga acagtactgc gggttcgtct tcaagggaag 720

tttcatattt ggagacaata ggttggacag agacagcctg tgctttggaa ccaggctcag 780

caagttgact tgtcgccttc acttgctcaa cttgggtgat gaggacaagg ccgctataca 840

tatagccatg cttagagaat cacatgcaga ccaagtagat caacaagggg acctgaatgg 900

agaagaaggt ctaaagctta tacggtttca gtcaccggtg gaagcctaaa tcaagttcga 960

gtccacctcg gaatctagga gcagtctgta gtaaaacgga tgcccaggaa acattctgat 1020

tctgtttttg atgatccaca tatggatgaa aagataattt gataagctaa ctaatggctt 1080

tagtttcacg tcaaaattca tccgaagtca acaggaatcg tcaaaacaag ttagcatcca 1140

gaatctgcaa gggtgctgcg tcactgtttt tggtccgttg ggttgtgtat catcattgag 1200

tccattagga gaggcgtcca gagggagtga cgaccctaac accttataat cagtaaccgc 1260

caccctcatt aggatttggg ttattctatt tacaatagtt tcactatcat tggtttttaa 1320

gaccccaact ttgtgagatt aatcattcat ttgcaaattt agttgcattt ttttgttctt 1380

gcttgtgttc tttgatttgc aggcaaggat tagccttctt ggcgaggtcg aacgtgcagc 1440

gccggtcaat aacctgagat gacgtggtgc taaggttgca tggccgccat ggcc 1494

<210> SEQ ID NO: 26

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 26

ttgccgattc agtgctcctg ttcgt 25

<210> SEQ ID NO: 27

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 27

cgtgcaacaa catcgcacca agga 24

<210> SEQ ID NO: 28

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 28

atccagggct acaagaaggg 20

<210> SEQ ID NO: 29

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 29

cgacaggtga tgatggcgaa 20

<210> SEQ ID NO: 30

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 30

atactaccgg gagccacaca ag 22

<210> SEQ ID NO: 31

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 31

ccaaggaggt gaagtggcag 20

<210> SEQ ID NO: 32

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 32

aatgatgcgt tgttatttga ttgctt 26

<210> SEQ ID NO: 33

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 33

tggtgactgc tgtactatgt gg 22

<210> SEQ ID NO: 34

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 34

ggctcgaaga cgatcagata cc 22

<210> SEQ ID NO: 35

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 35

tcggcatcgt ttatggtt 18

<210> SEQ ID NO: 36

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 36

gccggagcca cccgtcatgg agc 23

<210> SEQ ID NO: 37

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 37

ggctggcggt tgtggtggtg aacaagc 27

<210> SEQ ID NO: 38

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 38

tgacttgcat cattgctggg agg 23

<210> SEQ ID NO: 39

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 39

aagaggacga cgtcggcggc gt 22

<210> SEQ ID NO: 40

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 40

cctctacctt tcatcaagct tcc 23

<210> SEQ ID NO: 41

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 41

gcccgatgaa gtatatgtag acg 23

<210> SEQ ID NO: 42

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 42

tagcagagga acttactgtc acaacg 26

<210> SEQ ID NO: 43

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 43

aagttgcaac tcatctccaa ct 22

<210> SEQ ID NO: 44

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 44

acagtctgat ctgaccttcc tga 23

<210> SEQ ID NO: 45

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 45

catttcctcc tccctagctt cta 23

<210> SEQ ID NO: 46

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 46

tgaaccaaca tactcgatcg gttcct 26

<210> SEQ ID NO: 47

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 47

ccatgcaacc ttagcaccac gtca 24

<210> SEQ ID NO: 48

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 48

gtatggcgaa tgcaaaccac 20

<210> SEQ ID NO: 49

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 49

tattgctcga tcacaccagc tc 22

<210> SEQ ID NO: 50

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 50

gatctcagcc tcatcctcaa ctac 24

<210> SEQ ID NO: 51

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 51

ctggctgata ttgggctatg tg 22

<210> SEQ ID NO: 52

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_32_pFH primer

<400> SEQENCE: 52

cgcaagctta gctagatcgg atggttaaga 30

<210> SEQ ID NO: 53

<211> LENGTH: 39

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_32_pgR primer

<400> SEQENCE: 53

ttaccctcag atctaccatg gctggcggtt gtggtggtg 39

<210> SEQ ID NO: 54

<211> LENGTH: 39

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_32_pgF primer

<400> SEQENCE: 54

caccaccaca accgccagcc atggtagatc tgagggtaa 39

<210> SEQ ID NO: 55

<211> LENGTH: 39

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_32_gtR primer

<400> SEQENCE: 55

cctcccagca atgatgcaag tcacacgtga tggtgatgg 39

<210> SEQ ID NO: 56

<211> LENGTH: 39

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_32_gtF primer

<400> SEQENCE: 56

ccatcaccat cacgtgtgac ttgcatcatt gctgggagg 39

<210> SEQ ID NO: 57

<211> LENGTH: 38

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_32_tRE primer

<400> SEQENCE: 57

ccgaattctc gagattttat tctcgcaggt agaggcag 38

<210> SEQ ID NO: 58

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_35_pFA primer

<400> SEQENCE: 58

gcggccctta aggcctctgg gtactgctat tgag 34

<210> SEQ ID NO: 59

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_35_pgR primer

<400> SEQENCE: 59

gaaatttacc ctcagatcta ccatcgacga cgacgcacga cgtac 45

<210> SEQ ID NO: 60

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_35_pgF primer

<400> SEQENCE: 60

gtacgtcgtg cgtcgtcgtc gatggtagat ctgagggtaa atttc 45

<210> SEQ ID NO: 61

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_35_gtR primer

<400> SEQENCE: 61

cgttgtgaca gtaagttcct ctgctatcac acgtgatggt gatgg 45

<210> SEQ ID NO: 62

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_35_gtF primer

<400> SEQENCE: 62

ccatcaccat cacgtgtgat agcagaggaa cttactgtca caacg 45

<210> SEQ ID NO: 63

<211> LENGTH: 38

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_35_tRB primer

<400> SEQENCE: 63

gcggccatgg cggccaagtt gcaactcatc tccaactc 38

<210> SEQ ID NO: 64

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_36_pFA primer

<400> SEQENCE: 64

gcggccctta aggcccaata tgcatcggca tcttg 35

<210> SEQ ID NO: 65

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_36_pgR primer

<400> SEQENCE: 65

tttaccctca gatctaccat ttcctcctcc ctagcttcta ttctt 45

<210> SEQ ID NO: 66

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_36_pgF primer

<400> SEQENCE: 66

aagaatagaa gctagggagg aggaaatggt agatctgagg gtaaa 45

<210> SEQ ID NO: 67

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_36_gtR primer

<400> SEQENCE: 67

aggaaccgat cgagtatgtt ggttcacacg tgatggtgat ggtga 45

<210> SEQ ID NO: 68

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_36_gtF primer

<400> SEQENCE: 68

tcaccatcac catcacgtgt gaaccaacat actcgatcgg ttcct 45

<210> SEQ ID NO: 69

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_36_tRB primer

<400> SEQENCE: 69

gcggccatgg cggccatgca accttagcac cacgtca 37

<210> SEQ ID NO: 70

<211> LENGTH: 38

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_23_pFA primer

<400> SEQENCE: 70

gcggccctta aggccacact agaatcactc tcccactc 38

<210> SEQ ID NO: 71

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_23_pgR primer

<400> SEQENCE: 71

aaatttaccc tcagatctac cattattgct cgatcacacc agctc 45

<210> SEQ ID NO: 72

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_23_pgF primer

<400> SEQENCE: 72

gagctggtgt gatcgagcaa taatggtaga tctgagggta aattt 45

<210> SEQ ID NO: 73

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_23_gtR primer

<400> SEQENCE: 73

gcgctgagat ccaggcgctc atcacacgtg atggtgatgg tgatg 45

<210> SEQ ID NO: 74

<211> LENGTH: 45

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_23_gtF primer

<400> SEQENCE: 74

catcaccatc accatcacgt gtgatgagcg cctggatctc agcgc 45

<210> SEQ ID NO: 75

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: 2_23_tRB primer

<400> SEQENCE: 75

gcggccatgg cggccggggt gcgaatacca tagaaac 37

Read more
PatSnap Solutions

Great research starts with great data.

Use the most comprehensive innovation intelligence platform to maximise ROI on research.

Learn More

Patent Valuation

$

Reveal the value <>

25.0/100 Score

Market Attractiveness

It shows from an IP point of view how many competitors are active and innovations are made in the different technical fields of the company. On a company level, the market attractiveness is often also an indicator of how diversified a company is. Here we look into the commercial relevance of the market.

27.0/100 Score

Market Coverage

It shows the sizes of the market that is covered with the IP and in how many countries the IP guarantees protection. It reflects a market size that is potentially addressable with the invented technology/formulation with a legal protection which also includes a freedom to operate. Here we look into the size of the impacted market.

75.0/100 Score

Technology Quality

It shows the degree of innovation that can be derived from a company’s IP. Here we look into ease of detection, ability to design around and significance of the patented feature to the product/service.

30.0/100 Score

Assignee Score

It takes the R&D behavior of the company itself into account that results in IP. During the invention phase, larger companies are considered to assign a higher R&D budget on a certain technology field, these companies have a better influence on their market, on what is marketable and what might lead to a standard.

14.0/100 Score

Legal Score

It shows the legal strength of IP in terms of its degree of protecting effect. Here we look into claim scope, claim breadth, claim quality, stability and priority.

Citation

Patents Cited in This Cited by
Title Current Assignee Application Date Publication Date
Promoter from the rice triosephosphate isomerase gene OsTPI MONSANTO TECHNOLOGY LLC 04 August 2004 07 November 2006
Cambium/Xylem-Preferred Promoters and Uses Thereof FIBRIA CELULOSE S.A. 28 March 2005 14 August 2008
Methods and means of increasing the water use efficiency of plants PERFORMANCE PLANTS, INC. 12 June 2009 14 January 2010
See full citation <>

More Patents & Intellectual Property

PatSnap Solutions

PatSnap solutions are used by R&D teams, legal and IP professionals, those in business intelligence and strategic planning roles and by research staff at academic institutions globally.

PatSnap Solutions
Search & Analyze
The widest range of IP search tools makes getting the right answers and asking the right questions easier than ever. One click analysis extracts meaningful information on competitors and technology trends from IP data.
Business Intelligence
Gain powerful insights into future technology changes, market shifts and competitor strategies.
Workflow
Manage IP-related processes across multiple teams and departments with integrated collaboration and workflow tools.
Contact Sales
Clsoe
US10000762 Sorghum-derived transcription regulatory elements predominantly 1 US10000762 Sorghum-derived transcription regulatory elements predominantly 2 US10000762 Sorghum-derived transcription regulatory elements predominantly 3