Great research starts with great data.

Learn More
More >
Patent Analysis of

Methods and compositions for plant pest control

Updated Time 12 June 2019

Patent Registration Data

Publication Number

US10000767

Application Number

US14/165097

Application Date

27 January 2014

Publication Date

19 June 2018

Current Assignee

MONSANTO TECHNOLOGY LLC

Original Assignee (Applicant)

MONSANTO TECHNOLOGY LLC

International Classification

C12N15/82,A01N65/00,C07K14/415,A01H1/00,A01N63/02

Cooperative Classification

C12N15/8285,A01H1/00,A01N65/00,C07K14/415,C12N15/8206

Inventor

CRAWFORD, MICHAEL J.,LI, XIANGQIAN,KAPOOR, MAHAK,WILLIAMS, DERYCK JEREMY

Patent Images

This patent contains figures and images illustrating the invention and its embodiment.

US10000767 Methods compositions plant 1 US10000767 Methods compositions plant 2 US10000767 Methods compositions plant 3
See all images <>

Abstract

Provided are methods and compositions to improve fungal disease resistance in various crop plants. Also provided are combinations of compositions and methods to improve fungal disease resistance in various crop plants.

Read more

Claims

1. A method for producing a soybean plant exhibiting an improvement in Soy Cyst Nematode (SCN) resistance, the method comprising topically applying to a plant surface a composition that comprises:(a) at least four polynucleotides that comprise: (i) a polynucleotide of 25 to 150 nucleotides in length that comprises a segment of 25 contiguous nucleotides that are identical or complementary to SEQ ID NO: 126; (ii) a polynucleotide of 25 to 150 nucleotides in length that comprises a segment of 25 contiguous nucleotides that are identical or complementary to SEQ ID NO: 127; (iii) a polynucleotide of 25 to 150 nucleotides in length that comprises a segment of 25 contiguous nucleotides that are identical or complementary to SEQ ID NO: 128; and (iv) a polynucleotide of 25 to 150 nucleotides in length that comprises a segment of 25 contiguous nucleotides that are identical or complementary to SEQ ID NO: 129, wherein said polynucleotides are polynucleotide is not operably linked to a promoter or a viral vector and wherein said polynucleotides are not integrated into the plant chromosome; and(b) a transfer agent; and thereby producing a soybean plant that exhibits an improvement in SCN resistance resulting from suppression of a BAX inhibitor 1 (BI-1) gene.

2. The method of claim 1, wherein said polynucleotides comprise sense ssDNA, sense ssRNA, dsRNA, dsDNA, a double stranded DNA/RNA hybrid, anti-sense ssDNA, or anti-sense ssRNA.

3. The method of claim 1, wherein said composition further comprises a non-polynucleotide herbicidal molecule, a polynucleotide herbicidal molecule, a polynucleotide that suppresses an herbicide target gene, an insecticide, a fungicide, a nematocide, or a combination thereof.

4. The method of claim 1, wherein said composition further comprises a non-polynucleotide herbicidal molecule and said plant is resistant to said non-polynucleotide herbicidal molecule.

5. The method of claim 1, wherein said transfer agent comprises an organosilicone preparation.

Read more

Claim Tree

  • 1
    1. A method for producing a soybean plant exhibiting an improvement in Soy Cyst Nematode (SCN) resistance, the method comprising topically applying to a plant surface a composition that comprises:
    • (a) at least four polynucleotides that comprise: (i) a polynucleotide of 25 to 150 nucleotides in length that comprises a segment of 25 contiguous nucleotides that are identical or complementary to SEQ ID NO: 126; (ii) a polynucleotide of 25 to 150 nucleotides in length that comprises a segment of 25 contiguous nucleotides that are identical or complementary to SEQ ID NO: 127; (iii) a polynucleotide of 25 to 150 nucleotides in length that comprises a segment of 25 contiguous nucleotides that are identical or complementary to SEQ ID NO: 128; and (iv) a polynucleotide of 25 to 150 nucleotides in length that comprises a segment of 25 contiguous nucleotides that are identical or complementary to SEQ ID NO: 129, wherein said polynucleotides are polynucleotide is not operably linked to a promoter or a viral vector and wherein said polynucleotides are not integrated into the plant chromosome; and
    • (b) a transfer agent; and thereby producing a soybean plant that exhibits an improvement in SCN resistance resulting from suppression of a BAX inhibitor 1 (BI-1) gene.
    • 2. The method of claim 1, wherein
      • said polynucleotides comprise
    • 3. The method of claim 1, wherein
      • said composition further comprises
    • 4. The method of claim 1, wherein
      • said composition further comprises
    • 5. The method of claim 1, wherein
      • said transfer agent comprises
See all independent claims <>

Description

INCORPORATION OF SEQUENCE LISTING

A text file of the Sequence Listing contained in the file named “MON58632C_SEQ_LISTING.TXT” which is 94,742 bytes (measured in MS-Windows® in size and which was created on Jan. 27, 2014, is electronically filed herewith and is incorporated herein by reference in its entirety. This Sequence Listing consists of SEQ ID NO:1-147.

BACKGROUND

Powdery mildews are fungal diseases that affect a wide range of plants including cereals, grasses, vegetables, ornamentals, weeds, shrubs, fruit trees, broad-leaved shade and forest trees, that is caused by different species of fungi in the order Erysiphales. The disease is characterized by spots or patches of white to grayish, talcum-powder-like growth that produce tiny, pinhead-sized, spherical fruiting structures (the cleistothecia or overwintering bodies of the fungus), that are first white, later yellow-brown and finally black. The fungi that cause powdery mildews are host specific and cannot survive without the proper host plant. They produce mycelium (fungal threads) that grow only on the surface of the plant and feed by sending haustoria, or root-like structures, into the epidermal cells of the plant. The fungi overwinter on plant debris as cleistothecia or mycelia. In the spring, the cleistothecia produce spores that are moved to susceptible hosts by rain, wind or insects.

Powdery mildew disease is particularly prevalent in temperate and humid climates, where they frequently cause significant yield losses and quality reductions in various agricultural settings including greenhouse and field farming. This affects key cereals (e.g. barley and wheat), horticultural crops (e.g. grapevine, pea and tomato) and economically important ornamentals (e.g. roses). Limited access to natural sources of resistance to powdery mildews, rapid changes in pathogen virulence and the time consuming introgression of suitable resistance genes into elite varieties has led to the widespread use of fungicides to control the disease. This has not surprisingly led to the evolution and spread of fungicide resistance, which is especially dramatic amongst the most economically important powdery mildews.

Downy mildew diseases are caused by oomycete microbes from the family Peronosporaceae that are parasites of plants. Peronosporaceae are obligate biotrophic plant pathogens and parasitize their host plants as an intercellular mycelium using haustoria to penetrate the host cells. The downy mildews reproduce asexually by forming sporangia on distinctive white sporangiophores usually formed on the lower surface of infected leaves. These constitute the “downy mildew” and the initial symptoms appear on leaves as light green to yellow spots. The sporangia are wind-dispersed to the surface of other leaves. Depending on the genus, the sporangia may germinate by forming zoospores or by germ-tube. In the latter case, the sporangia behave like fungal conidia and are often referred to as such. Sexual reproduction is via oospores.

Most Peronosporaceae are pathogens of herbaceous dicots. Some downy mildew genera have relatively restricted host ranges, e.g. Basidiophora, Paraperonospora, Protobremia and Bremia on Asteraceae; Perofascia and Hyaloperonospora almost exclusively on Brassicaceae; Viennotia, Graminivora, Poakatesthia, Sclerospora and Peronosclerospora on Poaceae, Plasmoverna on Ranunculaceae. However, the largest genera, Peronospora and Plasmopara, have very wide host ranges.

Rusts (Pucciniales, formerly Uredinales) are obligate biotrophic parasites of vascular plants. Rusts affect a variety of plants; leaves, stems, fruits and seeds and is most commonly seen as coloured powder, composed of tiny aeciospores which land on vegetation producing pustules, or uredia, that form on the lower surfaces. During late spring or early summer, yellow orange or brown, hairlike or ligulate structures called telia grow on the leaves or emerge from bark of woody hosts. These telia produce teliospores which will germinate into aerial basidiospores, spreading and causing further infection.

SUMMARY

The present embodiments provide for compositions comprising polynucleotide molecules and methods for treating a plant to alter or regulate gene or gene transcript expression in the plant, for example, by providing RNA or DNA for inhibition of expression. Various aspects provide compositions comprising polynucleotide molecules and related methods for topically applying such compositions to plants to regulate endogenous BAX inhibitor 1 (BI-1) genes in a plant cell. The polynucleotides, compositions, and methods disclosed herein are useful in decreasing levels of BI-1 transcript and improving fungal disease resistance of a plant. Provided herein are compositions and methods that increase plant resistance to powdery mildew, downy mildew, rust infection or other fungal pathogens by suppression of plant BAX inhibitor 1 (BI-1) genes.

In one aspect, polynucleotide molecules are provided in compositions that can permeate or be absorbed into living plant tissue to initiate localized, partially systemic, or systemic gene inhibition or regulation. In certain embodiments, the polynucleotide molecules ultimately provide to a plant, or allow the in planta production of, RNA that is capable of hybridizing under physiological conditions in a plant cell to RNA transcribed from a target endogenous gene or target transgene in the plant cell, thereby effecting regulation of the endogenous BI-1 target gene. In certain embodiments, regulation of the BI-1 target genes, such as by silencing or suppression of the target gene, leads to the upregulation of another gene that is itself affected or regulated by decreasing the BI-1 target gene's expression.

In certain aspects or embodiments, the topical application of a composition comprising an exogenous polynucleotide and a transfer agent to a plant or plant part according to the methods described herein does not necessarily result in nor require the exogenous polynucleotide's integration into a chromosome of the plant. In certain aspects or embodiments, the topical application of a composition comprising an exogenous polynucleotide and a transfer agent to a plant or plant part according to the methods described herein does not necessarily result in nor require transcription of the exogenous polynucleotide from DNA integrated into a chromosome of the plant. In certain embodiments, topical application of a composition comprising an exogenous polynucleotide and a transfer agent to a plant according to the methods described herein also does not necessarily require that the exogenous polynucleotide be physically bound to a particle, such as in biolistic mediated introduction of polynucleotides associated with a gold or tungsten particles into internal portions of a plant, plant part, or plant cell. An exogenous polynucleotide used in certain methods and compositions provided herein can optionally be associated with an operably linked promoter sequence in certain embodiments of the methods provided herein. However, in other embodiments, an exogenous polynucleotide used in certain methods and compositions provided herein is not associated with an operably linked promoter sequence. Also, in certain embodiments, an exogenous polynucleotide used in certain methods and compositions provided herein is not operably linked to a viral vector.

In certain embodiments, methods for improving fungal disease resistance in a plant comprising topically applying compositions comprising a polynucleotide and a transfer agent that suppress the target BI-1 gene are provided. In certain embodiments, methods for selectively suppressing the target BI-1 gene by topically applying the polynucleotide composition to a plant surface at one or more selected seed, vegetative, or reproductive stage(s) of plant growth are provided. Such methods can provide for gene suppression in a plant or plant part on an as needed or as desired basis. In certain embodiments, methods for selectively suppressing the target BI-1 gene by topically applying the polynucleotide composition to a plant surface at one or more pre-determined seed, vegetative, or reproductive stage(s) of plant growth are provided. Such methods can provide for BI-1 gene suppression in a plant or plant part that obviates any undesired or unnecessary effects of suppressing the genes expression at certain seed, vegetative, or reproductive stage(s) of plant development.

In certain embodiments, methods for selectively improving fungal disease resistance in a plant by topically applying the polynucleotide composition to the plant surface at one or more selected seed, vegetative, or reproductive stage(s) are provided. Such methods can provide for improved fungal disease resistance in a plant or plant part on an as needed or as desired basis. In certain embodiments, methods for selectively improving fungal disease resistance in a plant by topically applying the polynucleotide composition to the plant surface at one or more predetermined seed, vegetative, or reproductive stage(s) are provided. Such methods can provide for improving fungal disease resistance in a plant or plant part that obviates any undesired or unnecessary effects of suppressing BI-1 gene expression at certain seed, vegetative, or reproductive stage(s) of plant development.

Methods and compositions that provide for the topical application of certain polynucleotides in the presence of transfer agents can be used to suppress BAX inhibitor 1 (BI-1) gene expression in an optimal manner. Topically induced BI-1 gene suppression methods and compositions provided herein can control the timing and degree of BI-1 knockdown to achieve fungal control while minimizing deleterious pleotropic effects in the host plant. In certain embodiments, the compositions provided herein can be applied on an “as needed” basis upon scouting for the occurrence of fungal disease. In certain embodiments, the compositions can be applied in a manner that obviates any deleterious effects on yield or other characteristics that can be associated with suppression of BI-1 gene expression in a crop plant. The applied polynucleotides are complementary to the BI-1 target host gene in plants and their topical application leads to suppression of the BI-1 gene.

Provided herein are compositions and methods for controlling plant fungal diseases. Plant fungal diseases that can be controlled with the methods and compositions provided herein include, but are not limited to, obligate biotrophic powdery mildew, downy mildew, and rust fungal infestations in plants. Plant fungal diseases that can be controlled with the methods and compositions provided herein also include, but are not limited to, fungal pathogens such as those causing anthracnose stalk rot, Diplodia Stalk or Ear Rot, Gibberella Stalk or Ear Rot, and Fusarium Stalk Rot in corn, or causing Take-all in wheat, Fusarium head blight in barley and wheat, or causing rice blast. In certain embodiments, methods and compositions for reducing expression of one or more host plant BI-1 polynucleotide and/or protein molecules in one or more cells or tissues of the plant such that the plant is rendered less susceptible to fungal infections from the order Erysiphales, the family Peronosporaceae or the order Pucciniales, are provided. In certain embodiments, nucleotide and amino acid sequences of plant BAX inhibitor 1 (BI-1) genes which can be downregulated by methods and compositions provided herein to increase plant resistance to powdery mildew, downy mildew, rust infection, or fungal pathogens such as those causing anthracnose stalk rot, Diplodia Stalk or Ear Rot, Gibberella Stalk or Ear Rot, and Fusarium Stalk Rot in corn, or causing Take-all in wheat, Fusarium head blight in barley and wheat, or causing rice blast are disclosed. Examples of powdery mildew fungi of the order Erysiphales which are controlled by the compositions and methods provided herein include, but are not limited to, Blumeria graminis f. sp. hordei, Blumeria graminis forma specialis (f. sp.) tritici, Golovinomyces orontii, Golovinomyces cichoracearum, Oidium neolycopersici, Oidium lycopersici, Erysiphe pisi, Erisyphe necator and Sphaerotheca fuliginea among others. Examples of downy mildew of the family Peronosporaceae include Pseudoperonospora humuli, Pseudoperonospora cubensis, Plasmopara viticola, Peronospora tabacina, Bremia lactucae, and Plasmopara halstedii. Examples of rusts of the order Pucciniales which are controlled by the compositions and methods provided herein include, but are not limited to, Phakopsora meibomiae, Phakopsora pachyrhizi, Puccinia graminis, Puccinia recondita, Uromyces phaseoli and Uromyces appendeculatus. Other examples of fungal pathogens which are controlled by the compositions and methods provided herein include, but are not limited to, Colletotrichum graminicola, Stenocarpella (or Diplodia) maydis, Gibberella zeae, Fusarium moniliforme, Gaeumannomyces graminis, Fusarium graminearum, Magnaporthe grisea (also known as Pyricularia grisea or Pyricularia oryzae), Septoria nodorum, and Septoria tritici.

Examples of plants protected by the compositions and methods provided herein include, but are not limited to, barley, rye, wheat, rice, oats, corn, sorghum, switchgrass, and sugar cane.

Also provided are methods and compositions where topically induced reductions in BI-1 transcript or protein levels are used to achieve fungal disease control while minimizing deleterious pleotropic effects in the host plant. Such methods and compositions provide for optimized levels of BI-1 gene inhibition and/or optimized timing of BI-1 gene inhibition.

Polynucleotides that can be used to suppress a BI-1 include, but are not limited to, any of: i) polynucleotides comprising at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BI-1 gene or to a transcript of the gene of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32 or Example 5; or ii) polynucleotides comprising at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a polynucleotide of SEQ ID NO:33-106, 109-140, or 142-146 as provided herein.

Certain embodiments are directed to a method for producing a plant exhibiting an improvement in fungal disease resistance comprising topically applying to a plant surface a composition that comprises:

a. at least one polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or to a transcript of the gene; and

b. a transfer agent, wherein the plant exhibits an improvement in fungal disease resistance that results from suppression of the BAX inhibitor 1 (BI-1) gene. In certain embodiments of the methods, the polynucleotide molecule comprises sense ssDNA, sense ssRNA, dsRNA, dsDNA, a double stranded DNA/RNA hybrid, anti-sense ssDNA, or anti-sense ssRNA. In certain embodiments of the methods, the polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments of the methods: (a) the plant is a barley plant, the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the plant is a rice plant, the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the plant is a wheat plant, the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the plant is a soybean plant, the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the plant is a corn plant, the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the plant is a sorghum plant, the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the plant is a pepper plant, the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the plant is a grape plant, the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the plant is a tomato plant, the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the plant is a lettuce plant, the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the plant is a cucumber plant, the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the plant is a cotton plant, the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32. In certain embodiments of the methods, the composition comprises any combination of two or more polynucleotide molecules. In certain embodiments of the methods, the polynucleotide is at least 18 to about 24, about 25 to about 50, about 51 to about 100, about 101 to about 300, about 301 to about 500, or at least about 500 or more residues in length. In certain embodiments of the methods, the composition further comprises a non-polynucleotide herbicidal molecule, a polynucleotide herbicidal molecule, a polynucleotide that suppresses an herbicide target gene, an insecticide, a fungicide, a nematocide, or a combination thereof. In certain embodiments of the methods, the composition further comprises a non-polynucleotide herbicidal molecule and the plant is resistant to the herbicidal molecule. In certain embodiments of the methods, the transfer agent comprises an organosilicone preparation. In certain embodiments of the methods, the polynucleotide is not operably linked to a viral vector. In certain embodiments of the methods, the polynucleotide is not integrated into the plant chromosome.

Further embodiments are directed to: a plant made according to the above-described methods; progeny of the plant that exhibit fungal disease resistance; seed of the plant, wherein seed from the plant exhibits fungal disease resistance; and a processed product of the plant, the progeny plant, or the seed, wherein the processed product exhibits fungal disease resistance. In certain embodiments, the processed product exhibits an improved attribute relative to a processed product of an untreated control plant and the improved attribute results from the improved fungal disease resistance. An improved attribute of a processed product can include, but is not limited to, decreased mycotoxin content, improved nutritional content, improved storage characteristics, improved flavor, improved consistency, and the like when compared to a processed product obtained from an untreated plant or plant part.

Additional embodiments are directed to compositions comprising a polynucleotide molecule that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or transcript of the gene, wherein the polynucleotide is not operably linked to a promoter; and, b) a transfer agent. In certain embodiments of the composition, the polynucleotide is selected from the group consisting of wherein the polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments of the composition: (a) the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32. In certain embodiments of the composition, the polynucleotide is at least 18 to about 24, about 25 to about 50, about 51 to about 100, about 101 to about 300, about 301 to about 500, or at least about 500 or more residues in length. In certain embodiments of the composition, the composition further comprises a non-polynucleotide herbicidal molecule, a polynucleotide herbicidal molecule, a polynucleotide that suppresses an herbicide target gene, an insecticide, a fungicide, a nematocide, or a combination thereof. In certain embodiments of the composition, the transfer agent is an organosilicone preparation. In certain embodiments of the composition, the polynucleotide is not physically bound to a biolistic particle.

Other embodiments are directed to a method of making a composition comprising the step of combining at least: a) a polynucleotide molecule comprising at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or transcript of a plant, wherein the polynucleotide is not operably linked to a promoter or a viral vector; and, b) a transfer agent. In certain embodiments of the methods, the polynucleotide is obtained by in vivo biosynthesis, in vitro enzymatic synthesis, or chemical synthesis. In certain embodiments, the methods further comprises combining with the polynucleotide and the transfer agent at least one of a non-polynucleotide herbicidal molecule, a polynucleotide herbicidal molecule, an insecticide, a fungicide, and/or a nematocide. In certain embodiments of the methods, the transfer agent is an organosilicone preparation.

Yet another embodiment is directed to a method of identifying a polynucleotide for improving fungal disease resistance in a plant comprising; a) selecting a population of polynucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or transcript of a plant; b) topically applying to a surface of at least one of the plants a composition comprising at least one polynucleotide from the population and an transfer agent to obtain a treated plant; and, c) identifying a treated plant that exhibits suppression of the BAX inhibitor 1 (BI-1) gene or exhibits an improvement in fungal disease resistance, thereby identifying a polynucleotide that improves fungal disease resistance in the plant. In certain embodiments of the methods, the polynucleotide is selected from the group consisting of wherein the polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments of the methods: a) the plant is a barley plant, the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the plant is a rice plant, the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the plant is a wheat plant, the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the plant is a soybean plant, the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the plant is a corn plant, the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the plant is a sorghum plant, the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the plant is a pepper plant, the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the plant is a grape plant, the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the plant is a tomato plant, the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the plant is a lettuce plant, the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the plant is a cucumber plant, the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the plant is a cotton plant, the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32.

A further embodiment is directed to a plant comprising an exogenous polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or transcript of the gene, wherein the exogenous polynucleotide is not operably linked to a promoter or to a viral vector, is not integrated into the chromosomal DNA of the plant, and is not found in a non-transgenic plant; and, wherein the plant exhibits an improvement in fungal disease resistance that results from suppression of the BAX inhibitor 1 (BI-1) gene. In certain embodiments, the plant further comprises an organosilicone compound or a component thereof. In certain embodiments, the polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments: a) the plant is a barley plant, the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the plant is a rice plant, the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the plant is a wheat plant, the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the plant is a soybean plant, the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the plant is a corn plant, the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the plant is a sorghum plant, the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the plant is a pepper plant, the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the plant is a grape plant, the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the plant is a tomato plant, the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the plant is a lettuce plant, the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the plant is a cucumber plant, the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the plant is a cotton plant, the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32.

An additional embodiment is directed to a plant part comprising an exogenous polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or transcript of the gene, wherein the exogenous polynucleotide is not operably linked to a promoter or to a viral vector and is not found in a non-transgenic plant; and, wherein the plant part exhibits an improvement in fungal disease resistance that results from suppression of the BAX inhibitor 1 (BI-1) gene. In certain embodiments, the plant part further comprises an organosilicone compound or a component thereof. In certain embodiments, the polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments: a) the plant part is a barley plant part, the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the plant part is a rice plant part, the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the plant part is a wheat plant part, the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the plant part is a soybean plant part, the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the plant part is a corn plant part, the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the plant part is a sorghum plant part, the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the plant part is a pepper plant part, the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the plant part is a grape plant part, the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the plant part is a tomato plant part, the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the plant part is a lettuce plant part, the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the plant part is a cucumber plant part, the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the plant part is a cotton plant part, the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32. In certain embodiments, the plant part is a flower, meristem, ovule, stem, tuber, fruit, anther, pollen, leaf, root, or seed. In certain embodiments, the plant part is a seed. Also provided are processed plant products obtained from the plant parts that exhibit an improved attribute relative to a processed plant product of an untreated control plant and wherein the improved attribute results from the improved disease tolerance. In certain embodiments, the processed product is a meal, a pulp, a feed, or a food product.

Another embodiment is directed to a plant that exhibits an improvement in fungal disease resistance, wherein the plant was topically treated with a composition that comprises: a. at least one polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or to a transcript of the gene; and, b. a transfer agent; and, wherein the plant exhibits an improvement in fungal disease resistance that results from suppression of the BAX inhibitor 1 (BI-1) gene. In certain embodiments, the transfer agent is an organosilicone preparation.

Certain embodiments are directed to a method for providing a seed that produces a plant exhibiting an improvement in fungal disease resistance comprising: a) soaking the seed in a liquid composition that comprises at least one polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BAX inhibitor 1 (BI-1) gene or to a transcript of the gene, wherein the seed produces a plant exhibiting an improvement in fungal disease resistance that results from suppression of the BAX inhibitor 1 (BI-1) gene. In some embodiments, the liquid composition further comprises a transfer agent. In certain embodiments, the polynucleotide comprises sense ssDNA, sense ssRNA, dsRNA, dsDNA, a double stranded DNA/RNA hybrid, anti-sense ssDNA, or anti-sense ssRNA. In certain embodiments, the polynucleotide is selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146, or wherein the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments of the methods: (a) the seed is a barley seed, the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the seed is a rice seed, the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the seed is a wheat seed, the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the seed is a soybean seed, the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the seed is a corn seed, the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the seed is a sorghum seed, the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the seed is a pepper seed, the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the seed is a grape seed, the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the seed is a tomato seed, the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the seed is a lettuce seed, the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the seed is a cucumber seed, the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the seed is a cotton seed, the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32. In certain embodiments, the liquid composition comprises any combination of two or more polynucleotide molecules. In certain embodiments, the polynucleotide is at least 18 to about 24, about 25 to about 50, about 51 to about 100, about 101 to about 300, about 301 to about 500, or at least about 500 or more residues in length. In certain embodiments of the methods, the composition further comprises an insecticide, a fungicide, a nematocide, or a combination thereof. In certain embodiments, the transfer agent comprises an organosilicone preparation. In certain embodiments, the polynucleotide is not operably linked to a viral vector. In certain embodiments, the polynucleotide is not integrated into the plant chromosome.

Further embodiments are directed to: a plant grown from a seed treated according to the above-described methods; progeny of the plant that exhibit fungal disease resistance; seed of the plant, wherein seed from the plant exhibits fungal disease resistance; and a processed product of the plant, the progeny plant, or the seed, wherein the processed product exhibits fungal disease resistance. In certain embodiments, the processed product exhibits an improved attribute relative to a processed product of an untreated control plant and the improved attribute results from the improved fungal disease resistance. An improved attribute of a processed product can include, but is not limited to, decreased mycotoxin content, improved nutritional content, improved storage characteristics, improved flavor, improved consistency, and the like when compared to a processed product obtained from an untreated plant or plant part.

Also provided herein are transgenic plants, plant parts, plant cells, and processed plant products containing a transgene comprising a heterologous promoter that is operably linked to a polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BI-1 gene or transcript of the BI-1 gene. Such transgenes can be integrated into the genome of the transgenic plant or provided in recombinant viral genomes that can be propagated in the plant. In certain embodiments, the transgene confers an improvement in fungal disease resistance and/or nematode resistance to the transgenic plants or plant parts that contain the transgene. In certain embodiments, the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a polynucleotide selected from the group consisting of SEQ ID NO: 33-106, 109-140, and 142-146 or comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a BI-1 gene or to a transcript of the gene of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32. In certain embodiments: (a) the plant is a barley plant, the gene or the transcript is a barley BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 73-76, 93-106, 109-120, and 121, and 121, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO:24; (b) the plant is a rice plant, the gene or the transcript is a rice BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 77-79, and 80, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 26; (c) the plant is a wheat plant, the gene or the transcript is a wheat BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:61-67, and 68, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to a wheat gene or transcript that encodes SEQ ID NO:18 or 20; (d) the plant is a soybean plant, the gene or the transcript is a soybean BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 49-52, 69-72, and 122-140, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 12 or 22; (e) the plant is a corn plant, the gene or the transcript is a corn BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:57-59, and 60, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 16; (f) the plant is a sorghum plant, the gene or the transcript is a sorghum BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 53-55, and 56, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 14; (g) the plant is a pepper plant, the gene or the transcript is a pepper BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO: 45-47, and 48, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 10; (h) the plant is a grape plant, the gene or the transcript is a grape BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:41-43, and 44, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 8; (i) the plant is a tomato plant, the gene or the transcript is a tomato BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:37-39, and 40, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 6; (j) the plant is a lettuce plant, the gene or the transcript is a lettuce BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:33-35, and 36, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 4; (k) the plant is a cucumber plant, the gene or the transcript is a cucumber BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:81-88, and 142-146, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 28 or 30; or (l) the plant is a cotton plant, the gene or the transcript is a cotton BAX inhibitor 1 (BI-1) gene or transcript, and the polynucleotide molecule is selected from the group consisting of SEQ ID NO:89-91, and 92, or the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 32. In certain embodiments, the transgenic plant part is a flower, meristem, ovule, stem, tuber, fruit, anther, pollen, leaf, root, or seed. Processed plant products containing the transgene include, but are not limited to, a meal a pulp, a feed, or a food product obtainable from the transgenic plant parts. In certain embodiments, the processed plant products exhibit an improved attribute relative to a processed plant product of an untreated control plant and wherein the improved attribute results from the improved fungal disease resistance and/or nematode resistance conferred by the transgene. In certain embodiments, the processed product is a meal, a pulp, a feed, or a food product. Also provided herein are methods for obtaining transgenic plants exhibiting an improvement in fungal disease resistance and/or nematode resistance comprising the steps of introducing any of the aforementioned transgenes into the genome of a plant and selecting for a transgenic plant wherein expression of an endogenous BAX inhibitor 1 (BI-1) gene is suppressed, thereby obtaining a plant exhibiting an improvement in fungal disease resistance and/or nematode resistance. Also provided herein are methods for improving fungal disease resistance and/or nematode resistance in plants that comprise growing transgenic plants comprising any of the aforementioned transgenes wherein expression of an endogenous BI-1 gene is suppressed in the presence of fungi and/or nematodes, wherein fungal disease resistance and/or nematode resistance of the transgenic plants is improved in comparison to a control plant that lack a transgene that suppresses an endogenous BI-1 gene in the control plant.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Panel A. shows a graph of cyst counts for Soy Cyst Nematode (SCN) disease measurement at twenty eight days after treatment and inoculation with SCN. Panel B. shows a graph of gall weights.

FIG. 2. presents the gall rating results for Root Knot Nematode (RKN) disease measured as % root mass galled for dsRNA treatments (or controls) followed by inoculation with vermiform eggs.

DETAILED DESCRIPTION

I. Definitions

The following definitions and methods are provided to better define the present embodiments and to guide those of ordinary skill in the art in the practice of the present embodiments. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.

Where a term is provided in the singular, the inventors also contemplate aspects described by the plural of that term.

As used herein, the terms “DNA,”“DNA molecule,” and “DNA polynucleotide molecule” refer to a single-stranded DNA or double-stranded DNA molecule of genomic or synthetic origin, such as, a polymer of deoxyribonucleotide bases or a DNA polynucleotide molecule.

As used herein, the terms “DNA sequence,”“DNA nucleotide sequence,” and “DNA polynucleotide sequence” refer to the nucleotide sequence of a DNA molecule.

As used herein, the term “gene” refers to any portion of a nucleic acid that provides for expression of a transcript or encodes a transcript. A “gene” thus includes, but is not limited to, a promoter region, 5′ untranslated regions, transcript encoding regions that can include intronic regions, and 3′ untranslated regions.

As used herein, the terms “RNA,”“RNA molecule,” and “RNA polynucleotide molecule” refer to a single-stranded RNA or double-stranded RNA molecule of genomic or synthetic origin, such as, a polymer of ribonucleotide bases that comprise single or double stranded regions.

Unless otherwise stated, nucleotide sequences in the text of this specification are given, when read from left to right, in the 5′ to 3′ direction. The nomenclature used herein is that required by Title 37 of the United States Code of Federal Regulations § 1.822 and set forth in the tables in WIPO Standard ST.25 (1998), Appendix 2, Tables 1 and 3.

As used herein, a “plant surface” refers to any exterior portion of a plant. Plant surfaces thus include, but are not limited to, the surfaces of flowers, stems, tubers, fruit, anthers, pollen, leaves, roots, or seeds. A plant surface can be on a portion of a plant that is attached to other portions of a plant or on a portion of a plant that is detached from the plant.

As used herein, the phrase “polynucleotide is not operably linked to a promoter” refers to a polynucleotide that is not covalently linked to a polynucleotide promoter sequence that is specifically recognized by either a DNA dependent RNA polymerase II protein or by a viral RNA dependent RNA polymerase in such a manner that the polynucleotide will be transcribed by the DNA dependent RNA polymerase II protein or viral RNA dependent RNA polymerase. A polynucleotide that is not operably linked to a promoter can be transcribed by a plant RNA dependent RNA polymerase.

As used herein, SEQ ID NO:, though displayed in the Sequence Listing in the form of ssDNA or ssRNA, encompass dsDNA equivalents, dsRNA equivalents, ssRNA as shown or equivalents, ssRNA complements, ssDNA as shown or equivalents, and ssDNA complements.

As used herein, a first nucleic-acid sequence is “operably” connected or “linked” with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to an RNA and/or protein-coding sequence if the promoter provides for transcription or expression of the RNA or coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, are in the same reading frame.

As used herein, the phrase “organosilicone preparation” refers to a liquid comprising one or more organosilicone compounds, wherein the liquid or components contained therein, when combined with a polynucleotide in a composition that is topically applied to a target plant surface, enable the polynucleotide to enter a plant cell. Examples of organosilicone preparations include, but are not limited to, preparations marketed under the trade names “Silwet®” or “BREAK-THRU®” and preparations provided in Table 1. In certain embodiments, an organosilicone preparation can enable a polynucleotide to enter a plant cell in a manner permitting a polynucleotide suppression of target gene expression in the plant cell.

As used herein, the phrase “provides for an improvement in fungal disease resistance” refers to any measurable increase in a plants resistance to fungal damage. In certain embodiments, an improvement in fungal disease resistance in a plant or plant part can be determined in a comparison to a control plant or plant part that has not been treated with a composition comprising a polynucleotide and a transfer agent. When used in this context, a control plant is a plant that has not undergone treatment with polynucleotide and a transfer agent. Such control plants would include, but are not limited to, untreated plants or mock treated plants.

As used herein, the phrase “provides for a reduction”, when used in the context of a transcript or a protein in a plant or plant part, refers to any measurable decrease in the level of transcript or protein in a plant or plant part. In certain embodiments, a reduction of the level of a transcript in a plant or plant part can be determined in a comparison to a control plant or plant part that has not been treated with a composition comprising a polynucleotide and a transfer agent. When used in this context, a control plant or plant part is a plant or plant part that has not undergone treatment with polynucleotide and a transfer agent. Such control plants or plant parts would include, but are not limited to, untreated or mock treated plants and plant parts.

As used herein, the phrase “wherein said plant does not comprise a transgene” refers to a plant that lacks either a DNA molecule comprising a promoter that is operably linked to a polynucleotide or a recombinant viral vector.

As used herein, the phrase “suppressing expression” or “suppression”, when used in the context of a gene, refers any measurable decrease in the amount and/or activity of a product encoded by the gene. Thus, expression of a gene can be suppressed when there is a reduction in levels of a transcript from the gene, a reduction in levels of a protein encoded by the gene, a reduction in the activity of the transcript from the gene, a reduction in the activity of a protein encoded by the gene, any one of the preceding conditions, or any combination of the preceding conditions. In this context, the activity of a transcript includes, but is not limited to, its ability to be translated into a protein and/or to exert any RNA-mediated biologic or biochemical effect. In this context, the activity of a protein includes, but is not limited to, its ability to exert any protein-mediated biologic or biochemical effect. In certain embodiments, a suppression of gene expression in a plant or plant part can be determined in a comparison of gene product levels or activities in a treated plant to a control plant or plant part that has not been treated with a composition comprising a polynucleotide and a transfer agent. When used in this context, a control plant or plant part is a plant or plant part that has not undergone treatment with polynucleotide and a transfer agent. Such control plants or plant parts would include, but are not limited to, untreated or mock treated plants and plant parts.

As used herein, the term “transcript” corresponds to any RNA that is produced from a gene by the process of transcription. A transcript of a gene can thus comprise a primary transcription product which can contain introns or can comprise a mature RNA that lacks introns.

As used herein, the term “liquid” refers to both homogeneous mixtures such as solutions and non-homogeneous mixtures such as suspensions, colloids, micelles, and emulsions.

II. Overview

The hypersensitive reaction (HR) in plants is a form of programmed cell death involved in many developmental processes and stress responses including disease resistance to pathogens.

The protein BAX inhibitor 1 (BI-1), localized at the endoplasmic reticulum and the nuclear envelope in both plants and animals, is a negative regulator of programmed cell death. The silencing of BAX inhibitor 1 increases the resistance of barley to powdery mildew infection.

Provided herein are certain methods and polynucleotide compositions that can be applied to living plant cells/tissues to suppress expression of target genes and that provide improved fungal disease resistance to a crop plant. Also provided herein are plants and plant parts exhibiting fungal disease resistance as well as processed products of such plants or plant parts. The compositions may be topically applied to the surface of a plant, such as to the surface of a leaf, and include a transfer agent. Aspects of the method can be applied to various crops, for example, including but not limited to: i) row crop plants including, but are not limited to, corn, barley, sorghum, soybean, cotton, canola, sugar beet, alfalfa, sugarcane, rice, and wheat; ii) vegetable plants including, but not limited to, tomato, potato, sweet pepper, hot pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, carrots, sweet corn, Chinese cabbage, leek, fennel, pumpkin, squash or gourd, radish, Brussels sprouts, tomatillo, garden beans, dry beans, or okra; iii) culinary plants including, but not limited to, basil, parsley, coffee, or tea; iv) fruit plants including but not limited to apple, pear, cherry, peach, plum, apricot, banana, plantain, table grape, wine grape, citrus, avocado, mango, or berry; v) a tree grown for ornamental or commercial use, including, but not limited to, a fruit or nut tree; or, vi) an ornamental plant (e. g., an ornamental flowering plant or shrub or turf grass). The methods and compositions provided herein can also be applied to plants produced by a cutting, cloning, or grafting process (i. e., a plant not grown from a seed) that include fruit trees and plants. Fruit trees produced by such processes include, but are not limited to, citrus and apple trees. Plants produced by such processes include, but are not limited to, avocados, tomatoes, eggplant, cucumber, melons, watermelons, and grapes as well as various ornamental plants.

Without being bound by theory, the compositions and methods of the present embodiments are believed to operate through one or more of the several natural cellular pathways involved in RNA-mediated gene suppression as generally described in Brodersen and Voinnet (2006), Trends Genetics, 22:268-280; Tomari and Zamore (2005) Genes &Dev., 19:517-529; Vaucheret (2006) Genes Dev., 20:759-771; Meins et al. (2005) Annu. Rev. Cell Dev. Biol., 21:297-318; and Jones-Rhoades et al. (2006) Annu. Rev. Plant Biol., 57:19-53. RNA-mediated gene suppression generally involves a double-stranded RNA (dsRNA) intermediate that is formed intra-molecularly within a single RNA molecule or inter-molecularly between two RNA molecules. This longer dsRNA intermediate is processed by a ribonuclease of the RNAase III family (Dicer or Dicer-like ribonuclease) to one or more shorter double-stranded RNAs, one strand of which is incorporated into the RNA-induced silencing complex (“RISC”). For example, the siRNA pathway involves the cleavage of a longer double-stranded RNA intermediate to small interfering RNAs (“siRNAs”). The size of siRNAs is believed to range from about 19 to about 25 base pairs, but the most common classes of siRNAs in plants include those containing 21 to 24 base pairs (See, Hamilton et al. (2002) EMBO J., 21:4671-4679).

Polynucleotides

As used herein, “polynucleotide” refers to a DNA or RNA molecule containing multiple nucleotides and generally refers both to “oligonucleotides” (a polynucleotide molecule of 18-25 nucleotides in length) and longer polynucleotides of 26 or more nucleotides. Embodiments include compositions including oligonucleotides having a length of 18-25 nucleotides (18-mers, 19-mers, 20-mers, 21-mers, 22-mers, 23-mers, 24-mers, or 25-mers), or medium-length polynucleotides having a length of 26 or more nucleotides (polynucleotides of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, or about 300 nucleotides), or long polynucleotides having a length greater than about 300 nucleotides (e. g., polynucleotides of between about 300 to about 400 nucleotides, between about 400 to about 500 nucleotides, between about 500 to about 600 nucleotides, between about 600 to about 700 nucleotides, between about 700 to about 800 nucleotides, between about 800 to about 900 nucleotides, between about 900 to about 1000 nucleotides, between about 300 to about 500 nucleotides, between about 300 to about 600 nucleotides, between about 300 to about 700 nucleotides, between about 300 to about 800 nucleotides, between about 300 to about 900 nucleotides, or about 1000 nucleotides in length, or even greater than about 1000 nucleotides in length, for example up to the entire length of a target gene including coding or non-coding or both coding and non-coding portions of the target gene). Where a polynucleotide is double-stranded, its length can be similarly described in terms of base pairs.

Polynucleotide compositions used in the various embodiments include compositions including oligonucleotides, polynucleotides, or a mixture of both, including: RNA or DNA or RNA/DNA hybrids or chemically modified oligonucleotides or polynucleotides or a mixture thereof. In certain embodiments, the polynucleotide may be a combination of ribonucleotides and deoxyribonucleotides, for example, synthetic polynucleotides consisting mainly of ribonucleotides but with one or more terminal deoxyribonucleotides or synthetic polynucleotides consisting mainly of deoxyribonucleotides but with one or more terminal dideoxyribonucleotides. In certain embodiments, the polynucleotide includes non-canonical nucleotides such as inosine, thiouridine, or pseudouridine. In certain embodiments, the polynucleotide includes chemically modified nucleotides. Examples of chemically modified oligonucleotides or polynucleotides are well known in the art; see, for example, U.S. Patent Publication 2011/0171287, U.S. Patent Publication 2011/0171176, U.S. Patent Publication 2011/0152353, U.S. Patent Publication 2011/0152346, and U.S. Patent Publication 2011/0160082, which are herein incorporated by reference. Illustrative examples include, but are not limited to, the naturally occurring phosphodiester backbone of an oligonucleotide or polynucleotide which can be partially or completely modified with phosphorothioate, phosphorodithioate, or methylphosphonate internucleotide linkage modifications, modified nucleoside bases or modified sugars can be used in oligonucleotide or polynucleotide synthesis, and oligonucleotides or polynucleotides can be labeled with a fluorescent moiety (e. g., fluorescein or rhodamine) or other label (e. g., biotin).

Polynucleotides can be single- or double-stranded RNA, single- or double-stranded DNA, double-stranded DNA/RNA hybrids, and modified analogues thereof. In certain embodiments, the polynucleotides that provide single-stranded RNA in the plant cell may be: (a) a single-stranded RNA molecule (ssRNA), (b) a single-stranded RNA molecule that self-hybridizes to form a double-stranded RNA molecule, (c) a double-stranded RNA molecule (dsRNA), (d) a single-stranded DNA molecule (ssDNA), (e) a single-stranded DNA molecule that self-hybridizes to form a double-stranded DNA molecule, (f) a single-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, (g) a double-stranded DNA molecule (dsDNA), (h) a double-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, and (i) a double-stranded, hybridized RNA/DNA molecule, or combinations thereof. In certain embodiments, these polynucleotides can comprise both ribonucleic acid residues and deoxyribonucleic acid residues. In certain embodiments, these polynucleotides include chemically modified nucleotides or non-canonical nucleotides. In certain embodiments of the methods, the polynucleotides include double-stranded DNA formed by intramolecular hybridization, double-stranded DNA formed by intermolecular hybridization, double-stranded RNA formed by intramolecular hybridization, or double-stranded RNA formed by intermolecular hybridization. In certain embodiments where the polynucleotide is a dsRNA, the anti-sense strand will comprise at least 18 nucleotides that are essentially complementary to the target gene. In certain embodiments the polynucleotides include single-stranded DNA or single-stranded RNA that self-hybridizes to form a hairpin structure having an at least partially double-stranded structure including at least one segment that will hybridize to RNA transcribed from the gene targeted for suppression. Not intending to be bound by any mechanism, it is believed that such polynucleotides are or will produce single-stranded RNA with at least one segment that will hybridize to RNA transcribed from the gene targeted for suppression. In certain embodiments, the polynucleotides can be operably linked to a promoter—generally a promoter functional in a plant, for example, a pol II promoter, a pol III promoter, a pol IV promoter, or a pol V promoter.

The polynucleotide molecules of the present embodiments are designed to modulate expression by inducing regulation or suppression of an endogenous gene in a plant and are designed to have a nucleotide sequence essentially identical or essentially complementary to the nucleotide sequence of an endogenous gene of a plant or to the sequence of RNA transcribed from an endogenous gene of a plant, which can be coding sequence or non-coding sequence. These effective polynucleotide molecules that modulate expression are referred to herein as “a trigger, or triggers”. By “essentially identical” or “essentially complementary” it is meant that the trigger polynucleotides (or at least one strand of a double-stranded polynucleotide) have sufficient identity or complementarity to the endogenous gene or to the RNA transcribed from the endogenous gene (e.g. the transcript) to suppress expression of the endogenous gene (e.g. to effect a reduction in levels or activity of the gene transcript and/or encoded protein). Polynucleotides of the methods and compositions provided herein need not have 100 percent identity to a complementarity to the endogenous gene or to the RNA transcribed from the endogenous gene (i.e. the transcript) to suppress expression of the endogenous gene (i.e. to effect a reduction in levels or activity of the gene transcript or encoded protein). Thus, in certain embodiments, the polynucleotide or a portion thereof is designed to be essentially identical to, or essentially complementary to, a sequence of at least 18 or 19 contiguous nucleotides in either the target gene or messenger RNA transcribed from the target gene (e.g. the transcript). In certain embodiments, an “essentially identical” polynucleotide has 100 percent sequence identity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity when compared to the sequence of 18 or more contiguous nucleotides in either the endogenous target gene or to an RNA transcribed from the target gene (e.g. the transcript). In certain embodiments, an “essentially complementary” polynucleotide has 100 percent sequence complementarity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence complementarity when compared to the sequence of 18 or more contiguous nucleotides in either the target gene or RNA transcribed from the target gene.

In certain embodiments, polynucleotides used in the methods and compositions provided herein can be essentially identical or essentially complementary to any of: i) conserved regions of BAX inhibitor 1 (BI-1) genes of both monocot and dicot plants; ii) conserved regions of BAX inhibitor 1 (BI-1) genes of monocot plants; or iii) conserved regions of BAX inhibitor 1 (BI-1) genes of dicot plants. Such polynucleotides that are essentially identical or essentially complementary to such conserved regions can be used to improve fungal disease resistance by suppressing expression of BAX inhibitor 1 (BI-1) genes in any of: i) both dicot and monocot plants, including, but not limited to, corn, barley, wheat, sorghum, rice, cucumber, pea, Medicago sp., soybean, pepper, tomato, and grape; ii) monocot plants, including, but not limited to, corn, barley, wheat, sorghum, switchgrass, and rice, and; or iii) dicot plants, including, but not limited to, cucumber, pea, Medicago sp., soybean, pepper, tomato, and grape. Conserved regions of dicot and monocot plant BAX inhibitor 1 (BI-1) genes of SEQ ID NO: 2, 4, 6, 7, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32 can be targeted by essentially identical or essentially complementary polynucleotides.

Polynucleotides containing mismatches to the target gene or transcript can thus be used in certain embodiments of the compositions and methods provided herein. In certain embodiments, a polynucleotide can comprise at least 19 contiguous nucleotides that are essentially identical or essentially complementary to said gene or said transcript or comprises at least 19 contiguous nucleotides that are essentially identical or essentially complementary to the target gene or target gene transcript. In certain embodiments, a polynucleotide of 19 continuous nucleotides that is essentially identical or essentially complementary to the endogenous target gene or to an RNA transcribed from the target gene (e.g. the transcript) can have 1 or 2 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 20 or more nucleotides that contains a contiguous 19 nucleotide span of identity or complementarity to the endogenous target gene or to an RNA transcribed from the target gene can have 1 or 2 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 21 continuous nucleotides that is essentially identical or essentially complementary to the endogenous target gene or to an RNA transcribed from the target gene (e.g. the transcript) can have 1, 2, or 3 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 22 or more nucleotides that contains a contiguous 21 nucleotide span of identity or complementarity to the endogenous target gene or to an RNA transcribed from the target gene can have 1, 2, or 3 mismatches to the target gene or transcript. In designing polynucleotides with mismatches to an endogenous target gene or to an RNA transcribed from the target gene, mismatches of certain types and at certain positions that are more likely to be tolerated can be used. In certain embodiments, mismatches formed between adenine and cytosine or guanosine and uracil residues are used as described by Du et al. Nucleic Acids Research, 2005, Vol. 33, No. 5 1671-1677. In certain embodiments, mismatches in 19 base pair overlap regions can be at the low tolerance positions 5, 7, 8 or 11 (from the 5′ end of a 19 nucleotide target) with well tolerated nucleotide mismatch residues, at medium tolerance positions 3, 4, and 12-17, and/or at the high tolerance nucleotide positions at either end of the region of complementarity (i.e. positions 1, 2, 18, and 19) as described by Du et al. Nucleic Acids Research, 2005, Vol. 33, No. 5 1671-1677. It is further anticipated that tolerated mismatches can be empirically determined in assays where the polynucleotide is applied to the plants via the methods provided herein and the treated plants assayed for suppression of BAX inhibitor 1 (BI-1) expression or appearance of fungal disease resistance.

In certain embodiments, polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to one allele or one family member of a given target gene coding or non-coding sequence of a BI-1 target gene. In other embodiments, the polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to multiple alleles or family members of a given BAX inhibitor 1 (BI-1) target gene. In certain embodiments, the polynucleotide can thus comprise at least 18 contiguous nucleotides that are identical or complementary to SEQ ID NO: 33-106, 108-140, or 142-146. In certain embodiments, the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32.

In certain embodiments, polynucleotide compositions and methods provided herein typically effect regulation or modulation (e. g., suppression) of gene expression during a period during the life of the treated plant of at least 1 week or longer and typically in systemic fashion. For instance, within days of treating a plant leaf with a polynucleotide composition as described herein, primary and transitive siRNAs can be detected in other leaves lateral to and above the treated leaf and in apical tissue. In certain embodiments, methods of systemically suppressing expression of a gene in a plant, the methods comprising treating said plant with a composition comprising at least one polynucleotide and a transfer agent, wherein said polynucleotide comprises at least 18 or at least 19 contiguous nucleotides that are essentially identical or essentially complementary to a gene or a transcript encoding a BAX inhibitor 1 (BI-1) gene of the plant are provided, whereby expression of the gene in said plant or progeny thereof is systemically suppressed in comparison to a control plant that has not been treated with the composition.

Compositions used to suppress a target gene can comprise one or more polynucleotides that are essentially identical or essentially complementary to multiple genes, or to multiple segments of one or more genes. In certain embodiments, compositions used to suppress a target gene can comprise one or more polynucleotides that are essentially identical or essentially complementary to multiple consecutive segments of a target gene, multiple non-consecutive segments of a target gene, multiple alleles of a target gene, or multiple target genes from one or more species.

In certain embodiments, the polynucleotide includes two or more copies of a nucleotide sequence (of 18 or more nucleotides) where the copies are arranged in tandem fashion. In another embodiment, the polynucleotide includes two or more copies of a nucleotide sequence (of 18 or more nucleotides) where the copies are arranged in inverted repeat fashion (forming an at least partially self-complementary strand). The polynucleotide can include both tandem and inverted-repeat copies. Whether arranged in tandem or inverted repeat fashion, each copy can be directly contiguous to the next, or pairs of copies can be separated by an optional spacer of one or more nucleotides. The optional spacer can be unrelated sequence (i. e., not essentially identical to or essentially complementary to the copies, nor essentially identical to, or essentially complementary to, a sequence of 18 or more contiguous nucleotides of the endogenous target gene or RNA transcribed from the endogenous target gene). Alternatively the optional spacer can include sequence that is complementary to a segment of the endogenous target gene adjacent to the segment that is targeted by the copies. In certain embodiments, the polynucleotide includes two copies of a nucleotide sequence of between about 20 to about 30 nucleotides, where the two copies are separated by a spacer no longer than the length of the nucleotide sequence.

Tiling

Polynucleotide trigger molecules can be identified by “tiling” gene targets in random length fragments, e.g. 200-300 polynucleotides in length, with partially overlapping regions, e.g. 25 or so nucleotide overlapping regions along the length of the target gene. Multiple gene target sequences can be aligned and polynucleotide sequence regions with homology in common are identified as potential trigger molecules for multiple targets. Multiple target sequences can be aligned and sequence regions with poor homology are identified as potential trigger molecules for selectively distinguishing targets. To selectively suppress a single gene, trigger sequences may be chosen from regions that are unique to the target gene either from the transcribed region or the non-coding regions, e.g., promoter regions, 3′ untranslated regions, introns and the like.

Polynucleotides fragments are designed along the length of the full length coding and untranslated regions of a BI-1 gene or family member as contiguous overlapping fragments of 200-300 polynucleotides in length or fragment lengths representing a percentage of the target gene. These fragments are applied topically (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine the relative effectiveness in providing the fungal disease resistance phenotype. Fragments providing the desired activity may be further subdivided into 50-60 polynucleotide fragments which are evaluated for providing the fungal disease resistance phenotype. The 50-60 base fragments with the desired activity may then be further subdivided into 19-30 base fragments which are evaluated for providing the fungal disease resistance phenotype. Once relative effectiveness is determined, the fragments are utilized singly, or in combination in one or more pools to determine effective trigger composition or mixture of trigger polynucleotides for providing the fungal disease resistance phenotype.

Coding and/or non-coding sequences of gene families in the crop of interest are aligned and 200-300 polynucleotide fragments from the least homologous regions amongst the aligned sequences are evaluated using topically applied polynucleotides (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine their relative effectiveness in providing the fungal disease resistance phenotype. The effective segments are further subdivided into 50-60 polynucleotide fragments, prioritized by least homology, and reevaluated using topically applied polynucleotides. The effective 50-60 polynucleotide fragments are subdivided into 19-30 polynucleotide fragments, prioritized by least homology, and again evaluated for induction of the fungal disease resistance phenotype. Once relative effectiveness is determined, the fragments are utilized singly, or again evaluated in combination with one or more other fragments to determine the trigger composition or mixture of trigger polynucleotides for providing the fungal disease resistance phenotype.

Coding and/or non-coding sequences of gene families in the crop of interest are aligned and 200-300 polynucleotide fragments from the most homologous regions amongst the aligned sequences are evaluated using topically applied polynucleotides (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine their relative effectiveness in inducing the fungal disease resistance phenotype. The effective segments are subdivided into 50-60 polynucleotide fragments, prioritized by most homology, and reevaluated using topically applied polynucleotides. The effective 50-60 polynucleotide fragments are subdivided into 19-30 polynucleotide fragments, prioritized by most homology, and again evaluated for induction of the yield/quality phenotype. Once relative effectiveness is determined, the fragments may be utilized singly, or in combination with one or more other fragments to determine the trigger composition or mixture of trigger polynucleotides for providing the fungal disease resistance phenotype.

Also, provided herein are methods for identifying a preferred polynucleotide for improving fungal disease in a plant. Populations of candidate polynucleotides that are essentially identical or essentially complementary to a BI-1 gene or transcript of the gene can be generated by a variety of approaches, including but not limited to, any of the tiling, least homology, or most homology approaches provided herein. Such populations of polynucleotides can also be generated or obtained from any of the polynucleotides or genes provided herewith in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33-106, 108-140, or 142-146. Such populations of polynucleotides can also be generated or obtained from any genes that are orthologous to the genes or proteins provided herewith as SEQ ID NO: 1-32. Such polynucleotides can be topically applied to a surface of plants in a composition comprising at least one polynucleotide from said population and a transfer agent to obtain treated plants. Treated plants that exhibit suppression of the BI-1 gene and/or exhibit an improvement in fungal disease resistance are identified, thus identifying a preferred polynucleotide that improves fungal disease in a plant. Suppression of the gene can be determined by any assay for the levels and/or activity of a gene product (i.e. transcript or protein). Suitable assays for transcripts include, but are not limited to, semi-quantitative or quantitative reverse transcriptase PCR® (qRT-PCR) assays. Suitable assays for proteins include, but are not limited to, semi-quantitative or quantitative immunoassays, biochemical activity assays, or biological activity assays. In certain embodiments, the polynucleotides can be applied alone. In other embodiments, the polynucleotides can be applied in pools of multiple polynucleotides. When a pool of polynucleotides provides for suppression of the BI-1 gene and/or an improvement in fungal disease resistance are identified, the pool can be de-replicated and retested as necessary or desired to identify one or more preferred polynucleotide(s) that improves fungal disease resistance in a plant.

Methods of making polynucleotides are well known in the art. Such methods of making polynucleotides can include in vivo biosynthesis, in vitro enzymatic synthesis, or chemical synthesis. In certain embodiments, RNA molecules can be made by either in vivo or in vitro synthesis from DNA templates where a suitable promoter is operably linked to the polynucleotide and a suitable DNA-dependent RNA polymerase is provided. DNA-dependent RNA polymerases include, but are not limited to, E. coli or other bacterial RNA polymerases as well as the bacteriophage RNA polymerases such as the T7, T3, and SP6 RNA polymerases. Commercial preparation of oligonucleotides often provides two deoxyribonucleotides on the 3′ end of the sense strand. Long polynucleotide molecules can be synthesized from commercially available kits, for example, kits from Applied Biosystems/Ambion (Austin, Tex.) have DNA ligated on the 5′ end that encodes a bacteriophage T7 polymerase promoter that makes RNA strands that can be assembled into a dsRNA. Alternatively, dsRNA molecules can be produced from expression cassettes in bacterial cells that have regulated or deficient RNase III enzyme activity. Long polynucleotide molecules can also be assembled from multiple RNA or DNA fragments. In some embodiments design parameters such as Reynolds score (Reynolds et al. Nature Biotechnology 22, 326-330 (2004) and Tuschl rules (Pei and Tuschl, Nature Methods 3(9): 670-676, 2006) are known in the art and are used in selecting polynucleotide sequences effective in gene silencing. In some embodiments random design or empirical selection of polynucleotide sequences is used in selecting polynucleotide sequences effective in gene silencing. In some embodiments the sequence of a polynucleotide is screened against the genomic DNA of the intended plant to minimize unintentional silencing of other genes.

While there is no upper limit on the concentrations and dosages of polynucleotide molecules that can be useful in the methods and compositions provided herein, lower effective concentrations and dosages will generally be sought for efficiency. The concentrations can be adjusted in consideration of the volume of spray or treatment applied to plant leaves or other plant part surfaces, such as flower petals, stems, tubers, fruit, anthers, pollen, leaves, roots, or seeds. In one embodiment, a useful treatment for herbaceous plants using 25-mer polynucleotide molecules is about 1 nanomole (nmol) of polynucleotide molecules per plant, for example, from about 0.05 to 1 nmol polynucleotides per plant. Other embodiments for herbaceous plants include useful ranges of about 0.05 to about 100 nmol, or about 0.1 to about 20 nmol, or about 1 nmol to about 10 nmol of polynucleotides per plant. In certain embodiments, about 40 to about 50 nmol of a ssDNA polynucleotide are applied. In certain embodiments, about 0.5 nmol to about 2 nmol of a dsRNA is applied. In certain embodiments, a composition containing about 0.5 to about 2.0 mg/mL, or about 0.14 mg/mL of dsRNA or ssDNA (21-mer) is applied. In certain embodiments, a composition of about 0.5 to about 1.5 mg/mL of a long dsRNA polynucleotide (i.e. about 50 to about 200 or more nucleotides) is applied. In certain embodiments, about 1 nmol to about 5 nmol of a dsRNA is applied to a plant. In certain embodiments, the polynucleotide composition as topically applied to the plant contains the at least one polynucleotide at a concentration of about 0.01 to about 10 milligrams per milliliter, or about 0.05 to about 2 milligrams per milliliter, or about 0.1 to about 2 milligrams per milliliter. Very large plants, trees, or vines may require correspondingly larger amounts of polynucleotides. When using long dsRNA molecules that can be processed into multiple oligonucleotides, lower concentrations can be used. To illustrate certain embodiments, the factor 1×, when applied to oligonucleotide molecules is arbitrarily used to denote a treatment of 0.8 nmol of polynucleotide molecule per plant; 10×, 8 nmol of polynucleotide molecule per plant; and 100×, 80 nmol of polynucleotide molecule per plant.

The polynucleotide compositions of certain embodiments are useful in compositions, such as liquids that comprise polynucleotide molecules, alone or in combination with other components either in the same liquid or in separately applied liquids that provide a transfer agent. As used herein, a transfer agent is an agent that, when combined with a polynucleotide in a composition that is topically applied to a target plant surface, enables the polynucleotide to enter a plant cell. In certain embodiments, a transfer agent is an agent that conditions the surface of plant tissue, e. g., seeds, leaves, stems, roots, flowers, or fruits, to permeation by the polynucleotide molecules into plant cells. The transfer of polynucleotides into plant cells can be facilitated by the prior or contemporaneous application of a polynucleotide-transferring agent to the plant tissue. In some embodiments the transferring agent is applied subsequent to the application of the polynucleotide composition. The polynucleotide transfer agent enables a pathway for polynucleotides through cuticle wax barriers, stomata and/or cell wall or membrane barriers into plant cells. Suitable transfer agents to facilitate transfer of the polynucleotide into a plant cell include agents that increase permeability of the exterior of the plant or that increase permeability of plant cells to oligonucleotides or polynucleotides. Such agents to facilitate transfer of the composition into a plant cell include a chemical agent, or a physical agent, or combinations thereof. Chemical agents for conditioning or transfer include (a) surfactants, (b) an organic solvent or an aqueous solution or aqueous mixtures of organic solvents, (c) oxidizing agents, (d) acids, (e) bases, (f) oils, (g) enzymes, or combinations thereof. Embodiments of the method can optionally include an incubation step, a neutralization step (e.g., to neutralize an acid, base, or oxidizing agent, or to inactivate an enzyme), a rinsing step, or combinations thereof. Embodiments of agents or treatments for conditioning of a plant to permeation by polynucleotides include emulsions, reverse emulsions, liposomes, and other micellar-like compositions. Embodiments of agents or treatments for conditioning of a plant to permeation by polynucleotides include counter-ions or other molecules that are known to associate with nucleic acid molecules, e. g., inorganic ammonium ions, alkyl ammonium ions, lithium ions, polyamines such as spermine, spermidine, or putrescine, and other cations. Organic solvents useful in conditioning a plant to permeation by polynucleotides include DMSO, DMF, pyridine, N-pyrrolidine, hexamethylphosphoramide, acetonitrile, dioxane, polypropylene glycol, other solvents miscible with water or that will dissolve phosphonucleotides in non-aqueous systems (such as is used in synthetic reactions). Naturally derived or synthetic oils with or without surfactants or emulsifiers can be used, e. g., plant-sourced oils, crop oils (such as those listed in the 9th Compendium of Herbicide Adjuvants, publicly available on the worldwide web (internet) at herbicide.adjuvants.com can be used, e. g., paraffinic oils, polyol fatty acid esters, or oils with short-chain molecules modified with amides or polyamines such as polyethyleneimine or N-pyrrolidine. Transfer agents include, but are not limited to, organosilicone preparations.

In certain embodiments, an organosilicone preparation that is commercially available as Silwet® L-77 surfactant having CAS Number 27306-78-1 and EPA Number: CAL.REG.NO. 5905-50073-AA, and currently available from Momentive Performance Materials, Albany, N.Y. can be used to prepare a polynucleotide composition. In certain embodiments where a Silwet L-77 organosilicone preparation is used as a pre-spray treatment of plant leaves or other plant surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation comprising Silwet L-77 in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation comprising Silwet L-77 in the range of about 0.3 to about 1 percent by weight (wt percent) or about 0.5 to about 1% by weight (wt percent) is used or provided.

In certain embodiments, any of the commercially available organosilicone preparations provided in the following Table 1 can be used as transfer agents in a polynucleotide composition. In certain embodiments where an organosilicone preparation of Table 1 is used as a pre-spray treatment of plant leaves or other surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation of the following Table 1 in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.


TABLE 1
Name
CAS number
Manufacturer 1, 2
BREAK-THRU ® S 321
na
Evonik Industries AG
BREAK-THRU ® S 200
67674-67-3
Evonik Industries AG
BREAK-THRU ® OE 441
68937-55-3
Evonik Industries AG
BREAK-THRU ® S 278
27306-78-1
Evonik Goldschmidt
BREAK-THRU ® S 243
na
Evonik Industries AG
Silwet ® L-77
27306-78-1
Momentive Performance
Materials
Silwet ® HS 429
na
Momentive Performance
Materials
Silwet ® HS 312
na
Momentive Performance
Materials
BREAK-THRU ® S 233
134180-76-0 
Evonik Industries AG
Silwet ® HS 508
Momentive Performance
Materials
Silwet ® HS 604
Momentive Performance
Materials
1 Evonik Industries AG, Essen, Germany
2 Momentive Performance Materials, Albany, New York

Organosilicone preparations used in the methods and compositions provided herein can comprise one or more effective organosilicone compounds. As used herein, the phrase “effective organosilicone compound” is used to describe any organosilicone compound that is found in an organosilicone preparation that enables a polynucleotide to enter a plant cell. In certain embodiments, an effective organosilicone compound can enable a polynucleotide to enter a plant cell in a manner permitting a polynucleotide mediated suppression of a target gene expression in the plant cell. In general, effective organosilicone compounds include, but are not limited to, compounds that can comprise: i) a trisiloxane head group that is covalently linked to, ii) an alkyl linker including, but not limited to, an n-propyl linker, that is covalently linked to, iii) a poly glycol chain, that is covalently linked to, iv) a terminal group. Trisiloxane head groups of such effective organosilicone compounds include, but are not limited to, heptamethyltrisiloxane. Alkyl linkers can include, but are not limited to, an n-propyl linker. Poly glycol chains include, but are not limited to, polyethylene glycol or polypropylene glycol. Poly glycol chains can comprise a mixture that provides an average chain length “n” of about “7.5”. In certain embodiments, the average chain length “n” can vary from about 5 to about 14. Terminal groups can include, but are not limited to, alkyl groups such as a methyl group. Effective organosilicone compounds are believed to include, but are not limited to, trisiloxane ethoxylate surfactants or polyalkylene oxide modified heptamethyl trisiloxane.

(Compound I: polyalkyleneoxide heptamethyltrisiloxane, average n=7.5).

One organosilicone compound believed to be ineffective comprises the formula:

In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a trisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a heptamethyltrisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and one or more effective organosilicone compound in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.

In certain embodiments, the polynucleotide compositions that comprise an organosilicone preparation can comprise a salt such as ammonium chloride, tetrabutylphosphonium bromide, and/or ammonium sulfate. Ammonium chloride, tetrabutylphosphonium bromide, and/or ammonium sulfate can be provided in the polynucleotide composition at a concentration of about 0.5% to about 5% (w/v). An ammonium chloride, tetrabutylphosphonium bromide, and/or ammonium sulfate concentration of about 1% to about 3%, or about 2% (w/v) can also be used in the polynucleotide compositions that comprise an organosilicone preparation. In certain embodiments, the polynucleotide compositions can comprise an ammonium salt at a concentration greater or equal to 300 millimolar. In certain embodiments, the polynucleotide compositions that comprise an organosilicone preparation can comprise ammonium sulfate at concentrations from about 80 to about 1200 mM or about 150 mM to about 600 mM.

In certain embodiments, the polynucleotide compositions can also comprise a phosphate salt. Phosphate salts used in the compositions include, but are not limited to, calcium, magnesium, potassium, or sodium phosphate salts. In certain embodiments, the polynucleotide compositions can comprise a phosphate salt at a concentration of at least about 5 millimolar, at least about 10 millimolar, or at least about 20 millimolar. In certain embodiments, the polynucleotide compositions will comprise a phosphate salt in a range of about 1 mM to about 25 mM or in a range of about 5 mM to about 25 mM. In certain embodiments, the polynucleotide compositions can comprise sodium phosphate at a concentration of at least about 5 millimolar, at least about 10 millimolar, or at least about 20 millimolar. In certain embodiments, the polynucleotide compositions can comprise sodium phosphate at a concentration of about 5 millimolar, about 10 millimolar, or about 20 millimolar. In certain embodiments, the polynucleotide compositions will comprise a sodium phosphate salt in a range of about 1 mM to about 25 mM or in a range of about 5 mM to about 25 mM. In certain embodiments, the polynucleotide compositions can comprise a sodium phosphate buffer at a pH of about 6.8.

In certain embodiments, other useful transfer agents or adjuvants to transfer agents that can be used in polynucleotide compositions provided herein include surfactants and/or effective molecules contained therein. Surfactants and/or effective molecules contained therein include, but are not limited to, sodium or lithium salts of fatty acids (such as tallow or tallowamines or phospholipids) and organosilicone surfactants. In certain embodiments, the polynucleotide compositions that comprise a transfer agent are formulated with counter-ions or other molecules that are known to associate with nucleic acid molecules. Illustrative examples include, tetraalkyl ammonium ions, trialkyl ammonium ions, sulfonium ions, lithium ions, and polyamines such as spermine, spermidine, or putrescine. In certain embodiments, the polynucleotide compositions are formulated with a non-polynucleotide herbicide. Non-polynucleotide herbicidal molecules include, but are not limited to, glyphosate, auxin-like benzoic acid herbicides including dicamba, chloramben and TBA, glufosinate, auxin-like herbicides including phenoxy carboxylic acid herbicide, pyridine carboxylic acid herbicide, quinoline carboxylic acid herbicide, pyrimidine carboxylic acid herbicide, and benazolin-ethyl herbicide, sulfonylureas, imidazolinones, bromoxynil, delapon, cyclohezanedione, protoporphyrionogen oxidase inhibitors, and 4-hydroxyphenyl-pyruvate-dioxygenase inhibiting herbicides.

In certain embodiments, the polynucleotides used in the compositions that are essentially identical or essentially complementary to the BI-1 target gene or transcript will comprise the predominant nucleic acid in the composition. Thus in certain embodiments, the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript will comprise at least about 50%, 75%, 95%, 98%, or 100% of the nucleic acids provided in the composition by either mass or molar concentration. However, in certain embodiments, the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript can comprise at least about 1% to about 50%, about 10% to about 50%, about 20% to about 50%, or about 30% to about 50% of the nucleic acids provided in the composition by either mass or molar concentration. Also provided are compositions where the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript can comprise at least about 1% to 100%, about 10% to 100%, about 20% to about 100%, about 30% to about 50%, or about 50% to a 100% of the nucleic acids provided in the composition by either mass or molar concentration.

Polynucleotides comprising ssDNA, dsDNA, ssRNA, dsRNA, or RNA/DNA hybrids that are essentially identical or complementary to certain plant target genes or transcripts and that can be used in compositions containing transfer agents that include, but are not limited to, organosilicone preparations, to suppress those target genes when topically applied to plants are disclosed in co-assigned U.S. patent application Ser. No. 13/042,856. Various polynucleotide herbicidal molecules, compositions comprising those polynucleotide herbicidal molecules and transfer agents that include, but are not limited to, organosilicone preparations, and methods whereby herbicidal effects are obtained by the topical application of such compositions to plants are also disclosed in co-assigned U.S. patent application Ser. No. 13/042,856 (U.S. Patent Application Publication No. 20110296556), and those polynucleotide herbicidal molecules, compositions, and methods are incorporated herein by reference in their entireties. Genes encoding proteins that can provide tolerance to an herbicide and/or that are targets of a herbicide are collectively referred to herein as “herbicide target genes”. Herbicide target genes include, but are not limited to, a 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), a glyphosate oxidoreductase (GOX), a glyphosate decarboxylase, a glyphosate-N-acetyl transferase (GAT), a dicamba monooxygenase, a phosphinothricin acetyltransferase, a 2,2-dichloropropionic acid dehalogenase, an acetohydroxyacid synthase, an acetolactate synthase, a haloarylnitrilase, an acetyl-coenzyme A carboxylase (ACCase), a dihydropteroate synthase, a phytoene desaturase (PDS), a protoporphyrin IX oxygenase (PPO), a hydroxyphenylpyruvate dioxygenase (HPPD), a para-aminobenzoate synthase, a glutamine synthase, a cellulose synthase, a beta tubulin, and a serine hydroxymethyltransferase gene. The effects of applying certain compositions comprising polynucleotides that are essentially identical or complementary to certain herbicide target genes and transfer agents on plants containing the herbicide target genes was shown to be potentiated or enhanced by subsequent application of an herbicide that targets the same gene as the polynucleotide in co-assigned U.S. patent application Ser. No. 13/042,856. For example, compositions comprising polynucleotides targeting the EPSPS herbicide target gene were potentiated by glyphosate in experiments disclosed in co-assigned U.S. patent application Ser. No. 13/042,856.

In certain embodiments of the compositions and methods disclosed herein, the composition comprising a polynucleotide and a transfer agent can thus further comprise a second polynucleotide comprising at least 19 contiguous nucleotides that are essentially identical or essentially complementary to a transcript to a protein that confers resistance to a herbicide. In certain embodiments, the second polynucleotide does not comprise a polynucleotide that is essentially identical or essentially complementary to a transcript encoding a protein of a target plant that confers resistance to said herbicidal molecule. Thus, in a non-limiting embodiment, the second polynucleotide could be essentially identical or essentially complementary to a transcript encoding a protein that confers resistance to a herbicide in a weed (such as an EPSPS encoding transcript) but would not be essentially identical or essentially complementary to a transcript encoding a protein that confers resistance to that same herbicide in a crop plant.

In certain embodiments, the polynucleotide compositions that comprise a transfer agent can comprise glycerin. Glycerin can be provided in the composition at a concentration of about 0.1% to about 1% (w/v or v/v). A glycerin concentration of about 0.4% to about 0.6%, or about 0.5% (w/v or v/v) can also be used in the polynucleotide compositions that comprise a transfer agent.

In certain embodiments, the polynucleotide compositions that comprise a transfer agent can further comprise organic solvents. Such organic solvents include, but are not limited to, DMSO, DMF, pyridine, N-pyrrolidine, hexamethylphosphoramide, acetonitrile, dioxane, polypropylene glycol, other solvents miscible with water or that will dissolve phosphonucleotides in non-aqueous systems (such as is used in synthetic reactions).

In certain embodiments, the polynucleotide compositions that comprise a transfer agent can further comprise naturally derived or synthetic oils with or without surfactants or emulsifiers. Such oils include, but are not limited to, plant-sourced oils, crop oils (such as those listed in the 9th Compendium of Herbicide Adjuvants, publicly available on line at www.herbicide.adjuvants.com), paraffinic oils, polyol fatty acid esters, or oils with short-chain molecules modified with amides or polyamines such as polyethyleneimine or N-pyrrolidine.

In some embodiments, methods include one or more applications of the composition comprising a polynucleotide and a transfer agent or one or more effective components contained therein. In certain embodiments of the methods, one or more applications of a transfer agent or one or more effective components contained therein can precede one or more applications of the composition comprising a polynucleotide and a transfer agent. In embodiments where a transfer agent and/or one or more effective molecules contained therein is used either by itself as a pre-treatment or as part of a composition that includes a polynucleotide, embodiments of the polynucleotide molecules are double-stranded RNA oligonucleotides, single-stranded RNA oligonucleotides, double-stranded RNA polynucleotides, single-stranded RNA polynucleotides, double-stranded DNA oligonucleotides, single-stranded DNA oligonucleotides, double-stranded DNA polynucleotides, single-stranded DNA polynucleotides, chemically modified RNA or DNA oligonucleotides or polynucleotides or mixtures thereof.

Compositions and methods described herein are useful for modulating or suppressing the expression of an endogenous BAX inhibitor 1 (BI-1) target gene or transgenic BAX inhibitor 1 (BI-1) target gene in a plant cell or plant. In certain embodiments of the methods and compositions provided herein, expression of BI-1 target genes can be suppressed completely, partially and/or transiently to result in an improvement in fungal disease resistance. In various embodiments, a BAX inhibitor 1 (BI-1) target gene includes coding (protein-coding or translatable) sequence, non-coding (non-translatable) sequence, or both coding and non-coding sequence. Compositions can include polynucleotides and oligonucleotides designed to target multiple BAX inhibitor 1 (BI-1) genes, or multiple segments of one or more BAX inhibitor 1 (BI-1) genes. The target gene can include multiple consecutive segments of a target BAX inhibitor 1 (BI-1) gene, multiple non-consecutive segments of a BAX inhibitor 1 (BI-1) target gene, multiple alleles of a target gene, or multiple BAX inhibitor 1 (BI-1) target genes from one or more species. BAX inhibitor 1 (BI-1) target genes include, but are not limited to, the endogenous BAX inhibitor 1 (BI-1) plant genes of SEQ ID NO: or. BAX inhibitor 1 (BI-1) target genes include, but are not limited to, BAX inhibitor 1 (BI-1) plant genes that encode proteins that are orthologous to the proteins encoded by SEQ ID NO:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, or 31. BAX inhibitor 1 (BI-1) target genes include, but are not limited to, BAX inhibitor 1 (BI-1) plant genes that encode the proteins of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, or 31.

Target genes and plants containing those target genes can be obtained from: i) row crop plants including, but are not limited to, corn, soybean, cotton, canola, sugar beet, alfalfa, sugarcane, rice, and wheat; ii) vegetable plants including, but not limited to, tomato, potato, sweet pepper, hot pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, carrots, sweet corn, Chinese cabbage, leek, fennel, pumpkin, squash or gourd, radish, Brussels sprouts, tomatillo, garden beans, dry beans, or okra; iii) culinary plants including, but not limited to, basil, parsley, coffee, or tea; iv) fruit plants including but not limited to apple, pear, cherry, peach, plum, apricot, banana, plantain, table grape, wine grape, citrus, avocado, mango, or berry; v) a tree grown for ornamental or commercial use, including, but not limited to, a fruit or nut tree; or, vi) an ornamental plant (e. g., an ornamental flowering plant or shrub or turf grass). The methods and compositions provided herein can also be applied to plants produced by a cutting, cloning, or grafting process (i. e., a plant not grown from a seed) include fruit trees and plants that include, but are not limited to, citrus, apples, avocados, tomatoes, eggplant, cucumber, melons, watermelons, and grapes as well as various ornamental plants. Such row crop, vegetable, culinary, fruit, tree, or ornamental plants improvements in fungal disease resistance that result from suppressing BAX inhibitor 1 (BI-1) gene expression are provided herein. Such row crop, vegetable, culinary, fruit, tree, or ornamental plant parts or processed plant products exhibiting improvements in fungal disease resistance that result from suppressing BAX inhibitor 1 (BI-1) gene expression are also provided herein. Such plant parts can include, but are not limited to, flowers, stems, tubers, fruit, anthers, meristems, ovules, pollen, leaves, or seeds. Such processed plant products obtained from the plant parts can include, but are not limited to, a meal, a pulp, a feed, or a food product.

In some embodiments, a method for modulating or suppressing expression of an BAX inhibitor 1 (BI-1) gene in a plant including (a) conditioning of a plant to permeation by polynucleotides and (b) treatment of the plant with the polynucleotide molecules, wherein the polynucleotide molecules include at least one segment of 18 or more contiguous nucleotides cloned from or otherwise identified from the BAX inhibitor 1 (BI-1) target gene in either anti-sense or sense orientation, whereby the polynucleotide molecules permeate the interior of the plant and induce modulation of the target gene is provided. The conditioning and polynucleotide application can be performed separately or in a single step. When the conditioning and polynucleotide application are performed in separate steps, the conditioning can precede or can follow the polynucleotide application within minutes, hours, or days. In some embodiments more than one conditioning step or more than one polynucleotide molecule application can be performed on the same plant. In embodiments of the method, the segment can be cloned or identified from (a) coding (protein-encoding), (b) non-coding (promoter and other gene related molecules), or (c) both coding and non-coding parts of the BAX inhibitor 1 (BI-1) target gene. Non-coding parts include DNA, such as promoter regions or the RNA transcribed by the DNA that provide RNA regulatory molecules, including but not limited to: introns, 5′ or 3′ untranslated regions, and microRNAs (miRNA), trans-acting siRNAs, natural anti-sense siRNAs, and other small RNAs with regulatory function or RNAs having structural or enzymatic function including but not limited to: ribozymes, ribosomal RNAs, t-RNAs, aptamers, and riboswitches. In certain embodiments where the polynucleotide used in the composition comprises a promoter sequence essentially identical to, or essentially complementary to at least 18 contiguous nucleotides of the promoter of the endogenous target gene, the promoter sequence of the polynucleotide is not operably linked to another sequence that is transcribed from the promoter sequence.

Compositions comprising a polynucleotide and a transfer agent provided herein can be topically applied to a plant or plant part by any convenient method, e.g., spraying or coating with a powder, or with a liquid composition comprising any of an emulsion, suspension, or solution. Such topically applied sprays or coatings can be of either all or of any a portion of the surface of the plant or plant part. Similarly, compositions that comprise a transfer agent or other pre-treatment can in certain embodiments be applied to the plant or plant part by any convenient method, e. g., spraying or wiping a solution, emulsion, or suspension. Compositions comprising a polynucleotide and a transfer agent provided herein can be topically applied to plant parts that include, but are not limited to, flowers, stems, tubers, meristems, ovules, fruit, anthers, pollen, leaves, or seeds.

Application of compositions comprising a polynucleotide and a transfer agent to seeds is specifically provided herein. Seeds can be contacted with such compositions by spraying, misting, immersion, and the like.

In certain embodiments, application of compositions comprising a polynucleotide and a transfer agent to plants, plant parts, or seeds in particular can provide for an improvement in fungal disease resistance in progeny plants, plant parts, or seeds derived from those treated plants, plant parts, or seeds. In certain embodiments, progeny plants, plant parts, or seeds derived from those treated plants, plant parts, or seeds will exhibit an improvement in an improvement in fungal disease resistance that results from suppressing expression of an BI-1 gene. In certain embodiments, the methods and compositions provided herein can provide for an improvement in an improvement in fungal disease resistance in progeny plants or seeds as a result of epigenetically inherited suppression of BI-1 expression. In certain embodiments, such progeny plants exhibit an improvement in an improvement in fungal disease resistance from epigenetically inherited suppression of BI-1 gene expression that is not caused by a transgene where the polynucleotide is operably linked to a promoter, a viral vector, or a copy of the polynucleotide that is integrated into a non-native location in the chromosomal DNA of the plant. Without seeking to be limited by theory, progeny plants or seeds derived from those treated plants, plant parts, or seeds can exhibit an improvement in an improvement in fungal disease resistance through an epigenetic mechanism that provides for propagation of an epigenetic condition where suppression of BI-1 gene expression occurs in the progeny plants, plant parts, or plant seeds. In certain embodiments, progeny plants or seeds exhibiting an improvement in an improvement in fungal disease resistance as a result of epigenetically inherited suppression of BI-1 gene expression can also exhibit increased methylation, and in particular, increased methylation of cytosine residues, in the endogenous BI-1 gene of the plant. Plant parts, including seeds, of the progeny plants that exhibit an improvement in an improvement in fungal disease resistance as a result of epigenetically inherited suppression of BI-1 gene expression, can also in certain embodiments exhibit increased methylation, and in particular, increased methylation of cytosine residues, in the endogenous BI-1 gene. In certain embodiments, DNA methylation levels in DNA encoding the endogenous BI-1 gene can be compared in plants that exhibit the an improvement in fungal disease resistance and control plants that do not exhibit an improvement in fungal disease resistance to correlate the presence of the an improvement in fungal disease resistance to epigenetically inherited suppression of BI-1 gene expression and to identify plants that comprise the epigenetically inherited improvement in fungal disease resistance.

Various methods of spraying compositions on plants or plant parts can be used to topically apply to a plant surface a composition comprising a polynucleotide that comprises a transfer agent. In the field, a composition can be applied with a boom that extends over the crops and delivers the composition to the surface of the plants or with a boomless sprayer that distributes a composition across a wide area. Agricultural sprayers adapted for directional, broadcast, or banded spraying can also be used in certain embodiments. Sprayers adapted for spraying particular parts of plants including, but not limited to, leaves, the undersides of leaves, flowers, stems, male reproductive organs such as tassels, meristems, pollen, ovules, and the like can also be used. Compositions can also be delivered aerially, such as by a crop dusting airplane. In certain embodiments, the spray can be delivered with a pressurized backpack sprayer calibrated to deliver the appropriate rate of the composition. In certain embodiments, such a backpack sprayer is a carbon dioxide pressurized sprayer with a 11015 flat fan or equivalent spray nozzle with a customized single nozzle assembly (to minimize waste) at a spray pressure of about 0.25 MPa and/or any single nozzle sprayer providing an effective spray swath of 60 cm above the canopy of 3 to 12 inch tall growing plants can be used. Plants in a greenhouse or growth chamber can be treated using a track sprayer or laboratory sprayer with a 11001XR or equivalent spray nozzle to deliver the sample solution at a determined rate. In some embodiments, a non-limiting rate is about 140 L/ha at about 0.25 MPa pressure.

In certain embodiments, it is also contemplated that a plant part can be sprayed with the composition comprising a polynucleotide that comprises a transfer agent. Such plant parts can be sprayed either pre- or post-harvest to provide for an improvement in fungal disease resistance in the plant part that results from suppression of BI-1 gene expression. Compositions can be topically applied to plant parts attached to a plant by a spray as previously described. Compositions can be topically applied to plant parts that are detached from a plant by a spray as previously described or by an alternative method. Alternative methods for applying compositions to detached parts include, but are not limited to, passing the plant parts through a spray by a conveyor belt or trough, or immersing the plant parts in the composition.

Compositions comprising polynucleotides and transfer agents can be applied to plants or plant parts at one or more developmental stages as desired and/or as needed. Application of compositions to pre-germination seeds and/or to post-germination seedlings is provided in certain embodiments. Seeds can be treated with polynucleotide compositions provided herein by methods including, but not limited to, spraying, immersion, or any process that provides for coating, imbibition, and/or uptake of the polynucleotide composition by the seed. Seeds can be treated with polynucleotide compositions using seed batch treatment systems or continuous flow treatment systems. Seed coating systems are at least described in U.S. Pat. Nos. 6,582,516, 5,891,246, 4,079,696, and 4,023,525. Seed treatment can also be effected in laboratory or commercial scale treatment equipment such as a tumbler, a mixer, or a pan granulator. A polynucleotide composition used to treat seeds can contain one or more other desirable components including, but not limited to liquid diluents, binders to serve as a matrix for the polynucleotide, fillers for protecting the seeds during stress conditions, and plasticizers to improve flexibility, adhesion and/or spreadability of the coating. In addition, for oily polynucleotide compositions containing little or no filler, drying agents such as calcium carbonate, kaolin or bentonite clay, perlite, diatomaceous earth or any other adsorbent material can be added. Use of such components in seed treatments is described in U.S. Pat. No. 5,876,739. Additional ingredients can be incorporated into the polynucleotide compositions used in seed treatments. Such ingredients include but are not limited to: conventional sticking agents, dispersing agents such as methylcellulose (Methocel A15LV or Methocel A15C, for example, serve as combined dispersant/sticking agents for use in seed treatments), polyvinyl alcohol (e.g., Elvanol 51-05), lecithin (e.g., Yelkinol P), polymeric dispersants (e.g., polyvinylpyrrolidone/vinyl acetate PVPNA S-630), thickeners (e.g., clay thickeners such as Van Gel B to improve viscosity and reduce settling of particle suspensions), emulsion stabilizers, surfactants, antifreeze compounds (e.g., urea), dyes, colorants, and the like that can be combined with compositions comprising a polynucleotide and a transfer agent. Further ingredients used in compositions that can be applied to seeds can be found in McCutcheon's, vol. 1, “Emulsifiers and Detergents,” MC Publishing Company, Glen Rock, N.J., U.S.A., 1996 and in McCutcheon's, vol. 2, “Functional Materials,” MC Publishing Company, Glen Rock, N.J., U.S.A., 1996. Methods of applying compositions to seeds and pesticidal compositions that can be used to treat seeds are described in US Patent Application publication 20080092256, which is incorporated herein by reference in its entirety.

Application of the compositions in early, mid-, and late vegetative stages of plant development is provided in certain embodiments. Application of the compositions in early, mid-, and late reproductive stages is also provided in certain embodiments. Application of the compositions to plant parts at different stages of maturation is also provided.

The following examples are included to demonstrate certain embodiments. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

EXAMPLES

Example 1. BI-1 Target Gene Sequences

Target BI-1 genes at least occur in the genome of plants provided in Table 2. The BI-1 genes and provided in Table 2 or their corresponding transcripts, can be used as targets of polynucleotide compositions comprising a polynucleotide that of at least 18 contiguous nucleotides that are essentially identical or essentially complementary to those genes or transcripts. The genes and proteins provided in Table 2, or sequences contained within those genes provided herewith in Example 5 can also be used to obtain orthologous BI-1 genes from plants not listed in Table 2. Such orthologous genes and their transcripts can then serve as targets of polynucleotides provided herein or as a source of polynucleotides that are specifically designed to target the orthologous genes or transcripts.


TABLE 2
BAX inhibitor 1 (BI-1) sequences from various plants that are useful
targets for topical suppression to control fungal pathogens.
SEQ ID NO: 1
Arabidopsis thaliana
Arabidopsis
BI-1 protein
SEQ ID NO: 2
Arabidopsis thaliana
Arabidopsis
BI-1 gene
SEQ ID NO: 3
Lactuca sativa
Lettuce BI-1 protein
SEQ ID NO: 4
Lactuca sativa
Lettuce BI-1 gene
SEQ ID NO: 5
Q ID NO: 4; opersicum
Tomato BI-1 protein
SEQ ID NO: 6
Solanum lycopersicum
Tomato BI-1 gene
SEQ ID NO: 7
Vitis vinifera
Grape BI-1 protein
SEQ ID NO: 8
Vitis vinifera
Grape BI-1 gene
SEQ ID NO: 9
Capsicum annuum
Pepper BI-1 protein
SEQ ID NO: 10
Capsicum annuum
Pepper BI-1 gene
SEQ ID NO: 11
Glycine max
Soybean BI-1 protein
SEQ ID NO: 12
Glycine max
Soybean BI-1 gene
SEQ ID NO: 13
Sorghum bicolor
Sorghum BI-1 protein
SEQ ID NO: 14
Sorghum bicolor
Sorghum BI-1 gene
SEQ ID NO: 15
Zea mays
Corn BI-1 protein
SEQ ID NO: 16
Zea mays
Corn BI-1 gene
SEQ ID NO: 17
Triticum aestivum
Wheat BI-1 protein
SEQ ID NO: 18
Triticum aestivum
Wheat BI-1 gene
SEQ ID NO: 19
Triticum aestivum
Wheat BI-1 protein
SEQ ID NO: 20
Triticum aestivum
Wheat BI-1 gene
SEQ ID NO: 21
Glycine max
Soybean BI-2 protein
SEQ ID NO: 22
Glycine max
Soybean BI-2 gene
SEQ ID NO: 23
Hordeum vulgare
Barley BI-1 protein
SEQ ID NO: 24
Hordeum vulgare
Barley BI-1 gene
SEQ ID NO: 25
Oryza sativa subsp. Japonica
Rice BI-1 protein
SEQ ID NO: 26
Oryza sativa subsp. Japonica
Rice BI-1 gene
SEQ ID NO: 27
Cucumis sativus
BI-1 protein
SEQ ID NO: 28
Cucumis sativus
BI-1 gene
SEQ ID NO: 29
Cucumis sativus
Cucumber BI-1 protein
SEQ ID NO: 30
Cucumis sativus
Cucumber BI-1 gene
SEQ ID NO: 31
Gossypium hirsutum
Cotton BI-1 protein
SEQ ID NO: 32
Gossypium hirsutum
Cotton BI-1 gene

Table 2 contains the target BI-1 DNA sequences from the indicated plant species. For each gene having a DNA sequence provided in Table 2, polynucleotides such as single stranded or double stranded DNA or RNA fragments in sense and/or antisense orientation will be mixed with an organosilicone preparation. These compositions will be topically applied to plants to effect expression of the target genes in the specified plant to obtain the plants that exhibit disease resistance. In particular, plants that are resistant to powdery mildew, downy mildew, rust and/or other fungal infections will be obtained through the application of such compositions.

Example 2. Identification of Orthologous BI-1 Genes

The sequences disclosed in SEQ ID NO: 1 through 32, along with the phylogenetic method for functional assignment described above, can be used to efficiently identify and clone BI-1 homologs useful for the control on pathogens causing powdery mildews, downy mildews or rusts, from other plant species not explicitly described here.

Example 3. Polynucleotides that can be Used to Reduce BI-1 Expression in Various Plants

Examples of polynucleotides that can be used to reduce expression of BI-1 genes in various plants is provided herewith as SEQ ID NOS: 33-106, 109-140, and 142-146. Other regions of BI-1 genes can also be targeted to modify expression including the use of antisense DNA oligonucleotides against coding regions and/or targeting promoter regions using sense/antisense dsRNA, sense or antisense ssDNA as well as sense/antisense double stranded DNA. For example, a polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32 can be used to downregulate expression of those BI-1 genes.

Example 4. Topical Oligonucleotide Application and Powdery Mildew Testing Methods

Barley seeds are planted in 2 inch pots in the greenhouse. Five days later, barley seedlings are sprayed with polynucleotides such as ssDNA and/or dsRNA oligos directed to the promoter and/or targeting the coding region of a target gene of interest. The nucleotide solution applied consists of 6-20 nm of each ssDNA oligonucleotide or 0.5-4 nm dsRNA, 0.1 to 0.3% L77 silwet, 50 mM NaPO4 in a final volume of 40 microliters of water. Two to 4 days post spraying, seedlings will be infected with dry spores of barley powdery mildew (Blumeria graminis f. sp. hordei) and 7 days post infection, disease development is scored for the percentage of leaf area covered with powdery mildew.

Cucumber seeds are planted in a 3-inch square pot and thinned to one plant per pot after emergence. When the first true leaf is fully expanded and the second leaf is opening, a polynucleotide solution such as ssDNA and/or dsRNA oligos directed to the promoter and/or targeting the coding region of a target gene of interest is applied to the first true leaf or the cotyledons. The nucleotide solution applied consists of 6-20 nm of each ssDNA oligonucleotide or 0.5-4 nm dsRNA, 0.1 to 0.3% L77 Silwet, 50 mM NaPO4 in a final volume of 40 microliters of water. Two days later the entire cucumber plant is inoculated with a shower of dry spores of cucumber powdery mildew (Sphaerotheca fuliginea) shaken off diseased plants. Disease severity will be evaluated on the treated leaf and succeeding leaves 10 days later and at subsequent intervals.

Tomato seeds are planted in a 3-inch square pot and thinned to one plant per pot after emergence. Two weeks old tomato seedlings are treated with 6-20 nm of each ssDNA oligonucleotide or 0.5-4 nm dsRNA, 0.2-0.5% L77 silwet, 50 mM NaPO4, 1% ammonium sulfate in a final volume of 30 microliters of water. Two to 4 days post spraying plants are innoculated with dry spores of tomato powdery mildew (Oidium neolycopersici) and 13 days post infection, disease development is scored for the percentage of leaf area covered with powdery mildew.

Example 5. Control of Powdery Mildew with Oligonucleotide Applications

Barley plants were treated with control and oligonucleotide containing solutions essentially as indicated in Example 4. More specifically, Barley seeds (Perry variety) are planted about ¼″ into soil in 2 inch pots in the growth chamber and grown at 25° C. with a 16 hr light cycle in 50% humidity. Before polynucleotide application the plants are randomized. Application of polynucleotides (either ssDNA oligos and/or dsRNA) is performed by pipet application where 5 μL of solution containing nucleotides is applied to both sides of the first leaf. The nucleotide solution applied consists of ˜3-15 nm of each ssDNA oligonucleotide or ˜0.5-1 nm dsRNA, 0.1-0.3% Silwet L-77, 5 mM NaPO4, and 1% AMS in Gibco ultra pure water. Two days post treatment seedlings are infected with barley powdery mildew (Blumeria graminis f. sp. hordei). The growth chamber settings for the infection are as follows: 23° C., with a 12 hr light cycle in 70% humidity. At seven days post infection disease severity is scored for the percentage of leaf area covered with powdery mildew.

Data is analyzed using Anova Single Factor Analysis (α=0.1). The ½ A LSD is calculated and custom error bars created for the bar graphs. Percent disease reduction is compared to formulation blank and nucleic acid control

Experiments were conducted using pools of polynucleotides from the following Table 3.


TABLE 3
Polynucleotides
SEQ
Sequence
Sequence
ID
Type
name
Sequence
Length
NO:
antisense DNA
T5895
TCAGGGCAATGTGTAGGTAAGCACC
 25
 93
antisense DNA
T5896
AGCATTGTCAGCATCCCGCCGATGT
 25
 94
antisense DNA
T5897
TTCCAGGAGGGCTGCACCCATCAGC
 25
 95
antisense DNA
T5898
CAATCAGAGGTCCAACCGAAGCCCC
 25
 96
antisense DNA
T5899
CTTGGGTCAAAGTCTATGGCAAGCT
 25
 97
antisense DNA
T5900
TCCGACAAACCCTGTCACGAGGATG
 25
 98
antisense DNA
T5901
AGAAGCACCCAAAGGCGATGGCGGT
 25
 99
antisense DNA
T5902
CGCTTGGCGATGATGGCGGCGCCAG
 25
100
antisense DNA
T5903
GCCACCGAGGTACAGGTACTCCCTG
 25
101
antisense DNA
T5904
GGATCGACAGGCCAGACGAGAGCA
 25
102
G
antisense DNA
T5905
GACGTGACAAACTGCAGCCAGAGCA
 25
103
antisense DNA
T5906
GCTGCCAGAGGAGTGGCCAAAGATG
 25
104
antisense DNA
T5907
GGCCAAAGTAAACCTCAAACATGAA
 25
105
antisense DNA
T5908
ACCATGTACCCCAGGAAGATCAACA
 25
106
antisense DNA
T4211
GGGGTGCTGGAGAGGCCCAGGTGG
 24
107
sense
T4211_S
CCACCTGGGCCTCTCCAGCACCCC
 24
108
antisense DNA
T5909
CTCGATGATCTCCTGCGTGTCGTAC
 25
109
antisense DNA
T4223A_AS
GACCCCCTCTTCCTCTTCTTCTTG
 24
110
antisense DNA
T4223B_AS
CGTTCTTGAGCATGATGATGAGGA
 24
111
antisense DNA
T4223C_AS
GCAACAAAGTCGGTGAAGAGG
 21
112
antisense DNA
T4223D_AS
GTCAGCATCCCGCCGATGTTCAG
 23
113
antisense DNA
T4223E_AS
CCACGGCAGATGAGGCCAGTGCA
 23
114
antisense DNA
T4223F_AS
TAAACGAGCTTGAGGTGGGACTG
 23
115
antisense DNA
T4223G_AS
AACTGCAGCCAGAGCAGGATCG
 22
116
antisense DNA
T4223H_AS
AGCAGGCCACCGAGGTACAGGT
 22
117
antisense DNA
T4223I_AS
GGCGGCGCCAGAGAAGCACCC
 21
118
dsRNA
T5942
ATGGACGCCTTCTACTCGACCTCGTC
150
119
GGCGGCGGCGAGCGGCTGGGGCCA
CGACTCCCTCAAGAACTTCCGCCAGA
TCTCCCCCGCCGTGCAGTCCCACCTC
AAGCTCGTTTACCTGACTCTATGCTTT
GCACTGGCCTCATCTGCCGTG
dsRNA
T5943
AGGGCGCACCATGGCGACATGGACT
150
120
ACATCAAGCACGCCCTCACCCTCTTC
ACCGACTTTGTTGCCGTCCTCGTCCG
AGTCCTCATCATCATGCTCAAGAACG
CAGGCGACAAGTCGGAGGACAAGA
AGAAGAGGAAGAGGGGGTCCTGA
dsRNA
T5944
CGCTTGTGTCGGAACTATCGCCTGGA
150
121
TGTTCTCGGTGCCAGTCTATGAGGAG
AGGAAGAGGTTTGGGCTGCTGATGG
GTGCAGCCCTCCTGGAAGGGGCTTC
GGTTGGACCTCTGATTGAGCTTGCCA
TAGACTTTGACCCAAGCATCCT

Table 4 provides a summary of the results obtained.


TABLE 4
Powdery Mildew control results
Anova: Single Factor
SUMMARY
Average
Oligos
Percent
in
Disease
Vari-
Groups
pool
Count
Sum
Area
ance
Non Treated
10
256
25.6
480.2667
Blank
10
321
32.1
405.2111
MLO_T42111
SEQ ID NO:
10
6
0.6
0.266667
107
BI1_T5895-98
SEQ ID NO:
10
14
1.4
1.6
93, 94, 95, 96
BI1_T5899-02
SEQ ID NO:
10
31
3.1
14.98889
97, 98, 99, 100
BI1_T5903-06
SEQ ID NO:
10
42
4.2
56.17778
101, 102, 103,
104
BI1_T5907-09
SEQ ID NO:
10
78
7.8
52.17778
105, 106, 109
1A positive control oligonucleotide that suppresses the endogenous barley Mildew Resistance Locus O (MLO) gene and provides fungal disease control.

Example 6. Topical Oligonucleotide Application and Nematode Testing Methods

Application of Oligonucleotides to Seeds for Nematode Control

Cucumber seeds are soaked approximately 5-72 hours in nucleotides, either ssDNA and/or dsRNA oligos directed to the promoter and/or the coding region of a target of interest. Optionally, seeds can be soaked in water for a few hours prior to soaking in oligonucleotide solution. Soaking solution consists of 20 nm of each ssDNA nucleotide or 0.03-1 nm dsRNA, 0.1% silwet L77, 50 mM NaPO4 in a final volume 200 uL in water. The radicals of the cucumber seeds emerge within 72 hours, after which the seeds are placed on germination paper until root length is approximately 2 inches. Seedlings are transplanted to sand vials for RKN inoculation 24 hours later. Ten mL dry sand is added to each vial and seedlings are planted by tilting the vial and laying the seedling in the correct orientation so that the cotyledons are just above the sand and then tilting back to cover the radicles with sand. 3.3 ml water is added to each vial and the vials placed in racks under fluorescent light banks. 500 vermiform eggs or 300 J2 RKN are inoculated in each tube in 50 uL of deionized or spring water. Harvest of the cucumber plants is performed 10 to 12 days after inoculation by washing sand off the roots. A root gall rating and visual phytotoxicity rating is assigned using the following scales: Gall rating scale (Gall: % root mass galled): 0=0-5%; 1=6-20%; 2=21-50%; and 3=51-100%. The average of the triplicate gall rating is then calculated: no galls=0.00-0.33; mild galling=0.67-1.33; moderate galling=1.67-2.33; severe galling=2.67-3.00. Visual phytotoxicity scale is also assigned (Vis. tox; visual reduction in root mass compared to the control): rs1=mild stunting; rs2=moderate stunting; rs3=severe stunting.

Experiments in soybeans using soy cyst nematodes (SCN) are similar to RKN assays except for the following changes. After 5-72 hours of soaking soybean seeds are planted in 100% sand in two inch square plastic pots. Optionally, seeds are soaked in water for a few hours prior to soaking in oligonucleotide solution. Seven days after planting the soybean seed, the nematode soybean cyst nematode (SCN) inoculum (1000 vermiform eggs or 1000 J2s) are applied to the pot. Watering of the test plants is then restricted to only water as needed to prevent wilt for a period of 24 hours. After the 24 hour restricted watering, normal sub-irrigation watering is done for the duration of the test. Twenty eight days after inoculation the test is harvested and cysts counted.

Experiments in corn using lesion nematodes are similar to above except for the following changes. After 5-72 hours of soaking, corn seeds are planted in a sand:Turface mix 2:1 in 4 inch deep pots (Turface™ MVP, Profile Products, LLC., Buffalo Grove, Ill.). Optionally, seeds are soaked in water for a few hours prior to soaking in oligonucleotide solution. Inoculum of 2 gm of roots P. scribneri infested corn roots are applied to seedings and removed from the pot after 7 days. Watering of the test plants is then restricted to only water as needed to prevent wilt for a period of 24 hours after inoculation. After the 24 hour restricted watering, normal sub-irrigation watering as needed is done for the duration of the test. 12-14 days post inoculation, plants are harvested and nematodes extracted for 6 days from the cut up roots in a mist tent.

RKN and SCN J2s are prepared from hatchbowls using the following solutions: RKN solution: 1 L aerated tap water, 1 ml of 50 mg/ml kanamycin, 0.5 ml of 20 mg/ml imazalil sulfate; SCN solution: 1 L aerated tap water, 1 ml of 50 mg/ml kanamycin, 0.5 ml of 20 mg/ml imazalil sulfate, 1430 mg zinc sulfate.

Hatchbowls are autoclaved 6 oz bowls, lined with screen mesh and paper filter. Approximately 20 ml of appropriate hatch solution is poured into each bowl. Eggs are then place in the bowls and covered with foil. The bowls are then placed in a 25° C. incubator overnight. The next day the hatched J2's are extracted, additional solution added as needed and replaced in the incubator. Each bowl is used for 2 weeks and then disposed.

Example 7. Protection of Soybean from Soy Cyst Nematode (SCN)

Soybean cotyledons of the variety W82 were treated with the treatments indicated in Table 5 by topical application of the oligonucleotide solution in 5 mM NaPO4, 1% Ammonium Sulfate, and 0.20% Silwet™ (wt percent). Approximately 50 μl of solution containing the ssDNA oligonucleotides of Table 6, in pools of 4 ssDNAs/pool, was applied to each cotyledon of the plants and 4 plants were subjected to each treatment. One day following treatment, the plants were infected with approximately 1000 vermiform eggs of Soy Cyst Nematode applied directly to the pot. Twenty eight days after inoculation the root weights and cyst counts were recorded. ANOVA analysis for cyst count is provided in Table 8 and root weight is in Table 10. FIG. 1 shows the bar chart for cyst count and root weight.


TABLE 5
Treatments
Treatment #
Description
Oligo Final Conc.
1
Bi1-1 pool 1 AS coding
80 nmol/4 × 10 μL
2
Bi1-1 pool 2 AS coding
80 nmol/4 × 10 μL
3
Bi1-1 pool 3 AS coding
80 nmol/4 × 10 μL
4
Bi 1-2 pool 4 AS coding
80 nmol/4 × 10 μL
5
Bi1-2 pool 5 AS coding
80 nmol/4 × 10 μL
6
GFP AS control
80 nmol/4 × 10 μL
7
Mock treated no Silwet L-77
8
Formulation


TABLE 6
Oligonucleotides used
SEQ
ID
Pool
NO
Sequence
Maps to
ID
122
TTGAATCGAAGAAGGAATTGAAGGAGTCCAT
Soybean
1
Bil-1
SEQ ID
NO 12
123
AGGTAAGCCCCAACAGCCGCAGCAACCA
Soybean
1
Bil-1
SEQ ID
NO 12
124
CTCTTTTCCTCTCTTCAAAAGGAGGTGTC
Soybean
1
Bil-1
SEQ ID
NO 12
125
TGCACTAAAGATAAGGCTTGGATCGAT
Soybean
1
Bil-1
SEQ ID
NO 12
126
ATCCAGAAGAAACCAAGCCACCAAGGT
Soybean
2
Bil-1
SEQ ID
NO 12
127
CCTACAAACACCAAAAGCCCAAAGTAC
Soybean
2
Bil-1
SEQ ID
NO 12
128
ACTGCAACCAAATCGGTAAACAAGGTCAA
Soybean
2
Bil-1
SEQ ID
NO 12
129
TCAATCTCTCCTCTTCTTTTTCTTC
Soybean
2
Bil-1
SEQ ID
NO 12
130
TCAAGGGACCAACGAAGGCTAATTTCG
Soybean
3
Bil-1
SEQ ID
NO 12
131
GGCTTTGAATTTCAACACCCCTAATT
Soybean
3
Bil-1
SEQ ID
NO 12
132
GCTTGCAATCGGAGAAACACAAATTT
Soybean
3
Bil-1
SEQ ID
NO 12
133
ATGGGGACTTGAAGAAAGTGTCCAT
Soybean
4
Bil-2
SEQ ID
NO 22
134
TAAAATAAACCAGTTTGATGTGATTCTG
Soybean
4
Bil-2
SEQ ID
NO 22
135
TGCTCCCAATGGAAGCCACCGTGGTGA
Soybean
4
Bil-2
SEQ ID
NO 22
136
AATCAGAGGTCCAATGGAAGCACCCTGA
Soybean
4
Bil-2
SEQ ID
NO 22
137
GCCTTGCAACTAAGGCTACTGCAGAAAA
Soybean
5
Bil-2
SEQ ID
NO 22
138
AGAGCTATAGAGCCCCCAAAGAGAGAGG
Soybean
5
Bil-2
SEQ ID
NO 22
139
TCCAGGTCACCAAAGTGAGCCCTCTCA
Soybean
5
Bil-2
SEQ ID
NO 22
140
CTTCTCATTTCTCTTAGATGAATTATT
Soybean
5
Bil-2
SEQ ID
NO 22
141
GTTGTAGTTGTACTCCATCTTATTG
GFP
Control


TABLE 7
Cyst counts
trt#
rep1
rep2
rep3
rep4
avg
1
143.0
109.0
90.0
111.0
113.3
2
42.0
46.0
44.0
31.0
40.8
3
78.0
197.0
193.0
101.0
142.3
4
138.0
75.0
80.0
51.0
86.0
5
141.0
136.0
92.0
107.0
119.0
6
72.0
67.0
75.0
95.0
77.3
7
83.0
128.0
52.0
103.0
91.5
8
179.0
122.0
165.0
184.0
162.5


TABLE 8
ANOVA Single Factor analysis of Cyst counts
Anova: Single Factor
SUMMARY
Groups
Count
Sum
Average
Variance
Row 1
4
453
113.25
482.9167
Row 2
4
163
40.75
44.91667
Row 3
4
569
142.25
3800.917
Row 4
4
344
86
1362
Row 5
4
476
119
548.6667
Row 6
4
309
77.25
150.9167
Row 7
4
366
91.5
1032.333
Row 8
4
650
162.5
793.6667
ANOVA
Source of
SS
df
MS
F
P-value
F crit
Variation
Between
41568.88
7
5938.411
5.782054
0.000521
2.422629
Groups
Within
24649
24
1027.042
Groups
Total
66217.88
31
std of diff
22.6
df = 1.711
Isd
38.8
½ Isd
19.4


TABLE 9
Root Weight
trt#
rep1
rep2
rep3
rep4
avg
1
16.0
18.4
14.8
18.8
17.0
2
13.5
16.7
18.6
4.0
13.2
3
5.6
15.1
11.7
10.5
10.7
4
14.8
14.1
12.6
12.4
13.5
5
12.9
13.1
14.1
12.4
13.1
6
15.8
17.0
19.8
16.9
17.4
7
15.6
15.1
14.0
11.5
14.1
8
14.2
16.2
17.2
14.8
15.6


TABLE 10
ANOVA analysis of root weight
Anova: Single Factor
SUMMARY
Treatment
Count
Sum
Average
Variance
1
4
68
17
3.68
2
4
52.8
13.2
42.04667
3
4
42.9
10.725
15.46917
4
4
53.9
13.475
1.355833
5
4
52.5
13.125
0.509167
6
4
69.5
17.375
2.909167
7
4
56.2
14.05
3.336667
8
4
62.4
15.6
1.84
ANOVA
Source of
Variation
SS
df
MS
F
P-value
F crit
Between
138.1888
7
19.74125
2.219781
0.068719
2.422629
Treatm.
Within
Treatment
213.44
24
8.893333
Total
351.6288
31
std of diff
2.1
df = 1.711
Isd
3.6
½ Isd
1.8

Example 8. Protection of Cucumber from Root Knot Nematode (RKN)

Cucumber seed were soaked for 72 hr in dsRNA polynucleotide solution directed to the coding sequence of soybean Bi-1 gene. Soaking solution consisted of 0.01-1 nm dsRNA, 0.2% Silwet L77, 20 mM NaPO4 in a final volume 200 uL in water as outlined in Table 11. The radicals of the cucumber seeds emerged within 72 hours, after which the seeds were placed on germination paper until root length was approximately 2 inches. Seedlings were transplanted to sand vials for RKN inoculation 24 hours later. Ten mL dry sand was added to each vial and seedlings were planted by tilting the vial and laying the seedling in the correct orientation so that the cotyledons were just above the sand and then tilting back to cover the radicles with sand. 3.3 ml water was added to each vial and the vials placed in racks under fluorescent light banks. 500 vermiform eggs or 300 J2 RKN were inoculated in each tube in 50 uL of deionized or spring water. Harvest of the cucumber plants was performed 10 to 12 days after inoculation by washing sand off the roots.

A root gall rating and visual phytotoxicity rating was assigned using the following scales: Gall rating scale (Gall: % root mass galled): 0=0-5%; 1=6-20%; 2=21-50%; and 3=51-100%. The average of the triplicate gall rating was then calculated: no galls=0.00-0.33; mild galling=0.67-1.33; moderate galling=1.67-2.33; severe galling=2.67-3.00. Table 11 summarizes the treatments performed and Table 12 shows the gall rating results. These results are also graphically displayed in FIG. 2.


TABLE 11
Treatments
SEQ
Volume
Treat-
Trigger
ID
Conc
of each
ment#
type
Trigger
NOs
(nmol/μL)
dsRNA
1
dsRNA
Bi-1
142
0.0172
0.70
0.06 nmol
143
0.022
0.55
(0.012 nmol each)
144
0.0148
0.81
145
0.0195
0.62
146
0.0216
0.56
2
dsRNA
Bi-1
142
0.0172
1.74
0.15 nmol
143
0.022
1.36
(0.03 nmol each)
144
0.0148
2.03
145
0.0195
1.54
146
0.0216
1.39
3
dsRNA
GFP
147
0.0157
3.82
control
0.06 nmol
4
dsRNA
GFP
147
0.0157
9.55
control
0.15 nmol
5
Mock, no
Silwet
6
Formulation


TABLE 12
RKN Assay Results
Treat-
ment
No.
Treatment
Score %
AVG
St Dev
1
Bax1 dsRNA
15
25
10
10
15
7.071067812
coding
.06 nmol
(.012 nmol
each)
2
Bax1 dsRNA
10
40
5
20
18.76
15.47847968
coding
.15 nmol
(0.03 nmol
each)
3
GFP dsRNA
15
40
50
20
31.25
16.52
control
.06 nmol
4
GFP dsRNA
50
65
57.50
10.61
control
.15 nmol
5
Mock no
25
50
40
40
38.75
10.31
silwet
6
Formulation
50
30
70
30
45
19.15

<160> NUMBER OF SEQ ID NOS: 147

<210> SEQ ID NO: 1

<211> LENGTH: 247

<212> TYPE: PRT

<213> ORGANISM: Arabidopsis thaliana

<400> SEQENCE: 1

Met Asp Ala Phe Ser Ser Phe Phe Asp Ser Gln Pro Gly Ser Arg Ser

1 5 10 15

Trp Ser Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Ala Val

20 25 30

Gln Asn His Leu Lys Arg Val Tyr Leu Thr Leu Cys Cys Ala Leu Val

35 40 45

Ala Ser Ala Phe Gly Ala Tyr Leu His Val Leu Trp Asn Ile Gly Gly

50 55 60

Ile Leu Thr Thr Ile Gly Cys Ile Gly Thr Met Ile Trp Leu Leu Ser

65 70 75 80

Cys Pro Pro Tyr Glu His Gln Lys Arg Leu Ser Leu Leu Phe Val Ser

85 90 95

Ala Val Leu Glu Gly Ala Ser Val Gly Pro Leu Ile Lys Val Ala Ile

100 105 110

Asp Val Asp Pro Ser Ile Leu Ile Thr Ala Phe Val Gly Thr Ala Ile

115 120 125

Ala Phe Val Cys Phe Ser Ala Ala Ala Met Leu Ala Arg Arg Arg Glu

130 135 140

Tyr Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Leu Ser Met Leu Met

145 150 155 160

Trp Leu Gln Phe Ala Ser Ser Ile Phe Gly Gly Ser Ala Ser Ile Phe

165 170 175

Lys Phe Glu Leu Tyr Phe Gly Leu Leu Ile Phe Val Gly Tyr Met Val

180 185 190

Val Asp Thr Gln Glu Ile Ile Glu Lys Ala His Leu Gly Asp Met Asp

195 200 205

Tyr Val Lys His Ser Leu Thr Leu Phe Thr Asp Phe Val Ala Val Phe

210 215 220

Val Arg Ile Leu Ile Ile Met Leu Lys Asn Ser Ala Asp Lys Glu Glu

225 230 235 240

Lys Lys Lys Lys Arg Arg Asn

245

<210> SEQ ID NO: 2

<211> LENGTH: 1149

<212> TYPE: DNA

<213> ORGANISM: Arabidopsis thaliana

<400> SEQENCE: 2

aatattttca ttaatcgatt ctcaaagtca agcaaaaaaa acgaaacaat ggatgcgttc 60

tcttccttct tcgattctca acctggtagc agaagctgga gctatgattc tcttaaaaac 120

ttccgtcaga tttctccagc cgttcagaat catcttaaac gggtttattt gaccttatgt 180

tgtgctcttg tggcgtctgc ctttggagct tacctccatg tgctctggaa tatcggcggt 240

attcttacaa cgattggatg tattggaact atgatttggc tcctttcatg tcctccttat 300

gaacaccaaa aaaggctttc tcttctgttt gtgtctgctg ttcttgaagg tgcttctgtt 360

ggccccttga tcaaagtggc aattgatgtt gacccaagca tccttatcac tgcatttgtt 420

ggaactgcga tagcgtttgt ctgtttctca gcagcagcaa tgttagcaag acgcagggag 480

tatctctacc ttggaggact gctttcatct ggcttgtcta tgctaatgtg gctccagttt 540

gcctcttcaa tctttggtgg ctctgcatct atctttaagt ttgagttgta ctttggactt 600

ttgatctttg tgggatacat ggtggtggac acacaagaga ttatagaaaa ggcacacctc 660

ggtgacatgg actatgtaaa acattcgttg acccttttca ctgactttgt agctgtgttt 720

gttcggattc tcatcataat gttgaagaac tcagcagata aagaagagaa gaagaagaaa 780

aggagaaact gaggggatgt aaagtaaatt taactttatg gttgttatcg tgtgtggcca 840

ctttgaagat attacttgtt agcactctct attggtgacc agacatgttt ccactaaaaa 900

ggatctgctt gtttcacttc tgcacaagta ccatcttcag attgtaaatg actcgagtgt 960

tgttcttctt ttcataaact tttgttcttt aagagtttgg ttctactgat tgcatcttac 1020

caagctaaga ataatgtagg aaaatgataa tcctgtttaa attttctaaa atgtgtgcat 1080

ttcagattct cacagttgca acatttgcta ttgcttggaa gttgtaatcg aaaaataact 1140

tgcaatttc 1149

<210> SEQ ID NO: 3

<211> LENGTH: 250

<212> TYPE: PRT

<213> ORGANISM: Lactuca sativa

<400> SEQENCE: 3

Met Glu Ser Phe Ser Ser Phe Phe Asp Ser Gln Ser Arg Ser Ala Ser

1 5 10 15

Pro Asn Ser Trp Thr Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser

20 25 30

Pro Leu Val Gln Thr His Leu Lys Gln Val Tyr Leu Ser Leu Cys Cys

35 40 45

Ala Leu Met Ala Ser Ala Val Gly Ala Tyr Leu His Ile Leu Trp Asn

50 55 60

Ile Gly Gly Leu Leu Thr Thr Phe Gly Thr Leu Gly Cys Met Phe Trp

65 70 75 80

Leu Leu Ala Thr Pro Gln Tyr Gln Glu Gln Lys Arg Val Ser Leu Leu

85 90 95

Met Ala Ser Ser Leu Leu Gln Gly Ala Ser Ile Gly Pro Leu Ile Asp

100 105 110

Leu Ala Ile Glu Phe Asp Pro Ser Ile Leu Val Ser Ala Phe Met Gly

115 120 125

Thr Ala Ile Ala Phe Ala Cys Phe Ser Gly Ala Ala Met Leu Ala Arg

130 135 140

Arg Arg Glu Tyr Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Val Ser

145 150 155 160

Ile Leu Phe Trp Leu His Phe Ala Ser Ser Ile Phe Gly Gly Ser Val

165 170 175

Ala Leu Phe Lys Phe Glu Leu Tyr Phe Gly Leu Leu Val Phe Val Gly

180 185 190

Tyr Met Val Val Asp Thr Gln Asp Ile Ile Glu Lys Ala His Leu Gly

195 200 205

Asp Leu Asp Tyr Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe Ile

210 215 220

Ala Val Phe Val Arg Ile Leu Ile Ile Met Leu Lys Asn Ser Ala Glu

225 230 235 240

Arg Glu Glu Lys Lys Lys Lys Arg Arg Asp

245 250

<210> SEQ ID NO: 4

<211> LENGTH: 1251

<212> TYPE: DNA

<213> ORGANISM: Lactuca sativa

<400> SEQENCE: 4

ggcgacttcg cgaaactacc ggattactta actatgtctg caaacgtgta ctataaatat 60

cgcatatttt cttcccccaa aagtcatcgg ttcaatacca aaatttcata gttctttgtt 120

ttcttcaact accatggaat cattctcatc gttcttcgat tcacaatcgc gatcggcttc 180

tccaaacagc tggacctacg attctctcaa gaatttccgt caaatctctc ccttagttca 240

gactcatctc aaacaggttt acctctcact atgttgtgct ctcatggcat ctgcagttgg 300

ggcttacctt cacatcctat ggaacatcgg tggccttcta accaccttcg gaacgttggg 360

ctgcatgttt tggctactcg ccactccaca atatcaagag caaaaaagag tctctctatt 420

aatggcatct tctcttctcc aaggagcctc catcggtcct ctaatcgact tagccataga 480

atttgaccca agcatcttgg tgagcgcgtt catgggaact gcaatcgcat ttgcttgttt 540

ctcaggagct gccatgttag caagacgcag agagtatctt tatcttggag gtcttctttc 600

ttctggtgtt tcaatccttt tctggttaca ttttgcctca tcaatctttg gtggctctgt 660

tgcccttttc aaatttgagt tgtactttgg gctgttggtg tttgttgggt acatggtggt 720

tgacacccaa gatatcattg aaaaggctca tcttggagat ttggattatg tgaaacatgc 780

tcttacgctt ttcactgatt tcattgctgt ttttgttcgc attcttatca tcatgttgaa 840

gaattcggct gaaagagaag agaagaagaa gaagaggagg gattagggtg tttgtgaatg 900

agaaaaatgt gaagctttct gactacaaat aaaatgcgat gtagttgtta cttttgtgta 960

gtacattgtt ttttttaaca tgagtgacgt atatgtccta tgtcaatttg agattatgtg 1020

attaaaccct tataaaccca acaatctatc tcaatgtggg gttatttaaa ttatcccatg 1080

tactcgatcc aagtgtttaa aagctcatta cattacatta tcttcgaata ctaataattt 1140

atcgtattca catgcgtatg gggtttccta ctttactagt acattacccc agatttttaa 1200

gaccaagttg aattgcattt ttaagtactc ctaattttgt gcaaaccacg t 1251

<210> SEQ ID NO: 5

<211> LENGTH: 248

<212> TYPE: PRT

<213> ORGANISM: Solanum lycopersicum

<400> SEQENCE: 5

Met Glu Gly Phe Thr Ser Phe Phe Asp Ser Gln Ser Ala Ser Arg Asn

1 5 10 15

Arg Trp Ser Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Leu

20 25 30

Val Gln Thr His Leu Lys Gln Val Tyr Leu Thr Leu Cys Cys Ala Leu

35 40 45

Val Ala Ser Ala Ala Gly Ala Tyr Leu His Ile Leu Trp Asn Ile Gly

50 55 60

Gly Leu Leu Thr Thr Met Ala Cys Met Gly Ser Met Val Trp Leu Leu

65 70 75 80

Ser Ala Pro Pro Tyr Gln Glu Gln Lys Arg Val Ala Leu Leu Met Ala

85 90 95

Ala Ala Leu Phe Glu Gly Ala Ser Ile Gly Pro Leu Ile Glu Leu Gly

100 105 110

Ile Asn Phe Asp Pro Ser Ile Val Phe Gly Ala Phe Val Gly Cys Ala

115 120 125

Val Val Phe Gly Cys Phe Ser Ala Ala Ala Met Leu Ala Arg Arg Arg

130 135 140

Glu Tyr Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Val Ser Leu Leu

145 150 155 160

Phe Trp Leu His Phe Ala Ser Ser Ile Phe Gly Gly Ser Met Ala Val

165 170 175

Phe Lys Phe Glu Leu Tyr Phe Gly Leu Leu Val Phe Val Gly Tyr Ile

180 185 190

Val Phe Asp Thr Gln Glu Ile Ile Glu Lys Ala His Leu Gly Asp Met

195 200 205

Asp Tyr Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val

210 215 220

Phe Val Arg Ile Leu Ile Ile Met Leu Lys Asn Ala Ser Glu Lys Glu

225 230 235 240

Glu Lys Lys Lys Lys Arg Arg Asn

245

<210> SEQ ID NO: 6

<211> LENGTH: 1127

<212> TYPE: DNA

<213> ORGANISM: Solanum lycopersicum

<400> SEQENCE: 6

caacgcctta caggcagacg actttcgcat atcggtatag caaacataac attgtctacg 60

ttcagataaa tatcctttgc tcatttcagt tccaaaaact cgaagaagaa gaagaagaga 120

acaatggaag gtttcacatc gttcttcgac tcgcaatctg cctctcgcaa ccgctggagt 180

tatgattctc tcaaaaactt ccgccagatc tcacctctcg ttcaaactca tctcaagcag 240

gtgtacctta cgctatgctg tgctttagtg gcatcggctg ctggggctta ccttcacatt 300

ctatggaata tcggtggcct cctcacaaca atggcttgca tgggaagcat ggtgtggctt 360

ctctcagctc ctccttatca agagcaaaaa agggtggctc ttctgatggc agctgcactt 420

tttgaaggcg cctctattgg tcctctgatt gagctgggca ttaacttcga tccaagcatt 480

gtgtttggcg cttttgtagg ttgtgctgtg gtttttggtt gcttctcagc tgctgccatg 540

ttggcaaggc gcagggagta cttgtacctc gggggccttc tttcatctgg cgtctccctt 600

ctcttctggt tgcactttgc atcctccatt tttggtggtt ccatggctgt tttcaagttt 660

gagttgtatt ttggactctt ggtgtttgtg ggctacatcg tctttgacac ccaagaaatt 720

attgagaagg ctcacttggg tgatatggat tacgttaagc atgcattgac ccttttcaca 780

gattttgtcg ctgtttttgt gcggattctg atcatcatgt taaagaatgc atctgagaag 840

gaagagaaga agaagaagag gagaaactag atttgcttct caacttgtgg tttccataac 900

tccttgtgtt cacctgaaac aagcatgtta atagtttgat acttgcttca ctttagcata 960

ggctgtgatg taatgtcgtg tgacatgcca ttatggctgt gtgattgagc atctagcctt 1020

tttatcttct aaagcttttt tcttaacatt gataaggaaa gttccttgtg ataacattta 1080

agaccatttt aatttctcct ttctcattca aaaaaaaaaa aaaaaaa 1127

<210> SEQ ID NO: 7

<211> LENGTH: 248

<212> TYPE: PRT

<213> ORGANISM: Vitis vinifera

<400> SEQENCE: 7

Met Glu Ala Phe Ser Ala Phe Phe Asp Ser Gln Ser Ser Ser Arg Ser

1 5 10 15

Gly Trp Thr Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Ala

20 25 30

Val Gln Thr His Leu Lys Gln Val Tyr Leu Ser Leu Cys Cys Ala Leu

35 40 45

Ile Ala Ser Ala Ala Gly Ala Tyr Leu His Leu Leu Trp Asn Ile Gly

50 55 60

Gly Leu Leu Thr Thr Phe Ala Cys Phe Gly Ser Ile Ile Trp Leu Leu

65 70 75 80

Ser Ala Pro Ser Tyr Glu Glu Lys Lys Arg Val Ser Leu Leu Met Ala

85 90 95

Val Ala Leu Phe Gln Gly Ala Ser Ile Gly Pro Leu Ile Asp Leu Ala

100 105 110

Ile Glu Ile Asp Pro Ser Ile Leu Val Ser Ala Phe Val Gly Thr Ala

115 120 125

Val Ala Phe Gly Cys Phe Ser Ala Ala Ala Met Leu Ala Arg Arg Arg

130 135 140

Glu Tyr Leu Tyr Leu Gly Gly Val Leu Ser Ser Gly Leu Ser Ile Leu

145 150 155 160

Phe Trp Leu His Phe Ala Ser Ser Leu Phe Gly Gly Ser Thr Ala Ile

165 170 175

Phe Lys Phe Glu Leu Tyr Phe Gly Leu Leu Val Phe Val Gly Tyr Met

180 185 190

Val Val Asp Thr Gln Asp Ile Ile Glu Lys Ala His Leu Gly Asp Arg

195 200 205

Asp Tyr Val Lys His Ser Leu Leu Leu Phe Thr Asp Phe Ala Ala Val

210 215 220

Phe Val Arg Ile Leu Ile Ile Met Leu Lys Asn Ser Ala Glu Lys Ser

225 230 235 240

Glu Lys Lys Lys Lys Arg Arg Asn

245

<210> SEQ ID NO: 8

<211> LENGTH: 1097

<212> TYPE: DNA

<213> ORGANISM: Vitis vinifera

<400> SEQENCE: 8

aaagaggatt gttggaatta ggttttcaat ggaggcgttc tctgcgtttt tcgattcaca 60

atcgagctca aggagcggtt ggacctacga ttcactcaag aatttccgcc agatttctcc 120

tgccgttcaa actcatctca agcaggttta tctctccctg tgctgtgcct tgattgcatc 180

tgctgcagga gcttacctgc atcttctctg gaatattggt ggccttctta ctacttttgc 240

atgctttgga agcatcatat ggctactctc tgcaccttca tatgaagaga aaaagagggt 300

ttcactattg atggctgtgg ccctttttca aggagcctct atcggtcctt tgattgactt 360

ggctattgaa attgacccaa gcattcttgt tagtgctttt gtgggaactg cagtggcctt 420

tggctgtttc tctgcggctg caatgttggc aaggcgcaga gagtacctgt acttgggagg 480

ggttctttcg tctggcctct ccatcctttt ctggttgcac tttgcctcct cgttgtttgg 540

gggatccact gccatcttta agtttgagtt gtattttgga ctgttggtgt ttgtgggcta 600

catggtagta gacacccagg acataataga gaaagcccat ctcggggatc gggactatgt 660

gaaacattct ctcctccttt tcactgattt tgctgcagtt tttgttcgaa tcctgattat 720

catgttgaag aactcggctg aaaagagtga gaagaagaag aaaaggagaa attgaatgat 780

gggagactaa tgagcttaac ttgaactctg gttgaacaaa acaagagatt gtgtatgaac 840

ttgatgcttg tttctttctt tcccctaagt gagattatga tttttgaaac atgtgatacg 900

ctgggcgcta tggcagtgta catacgaatt gctcggttat gacattctgc atgttttaat 960

atatggggtt ggttttaaat aagaggacac tcgaatttgt tataatttga gaaacagttt 1020

gtatttcaaa atagaaacgg ttttctgtta aaaatttcta atattgcaag gaaaattgaa 1080

tgtgatatat ttttttt 1097

<210> SEQ ID NO: 9

<211> LENGTH: 248

<212> TYPE: PRT

<213> ORGANISM: Capsicum annuum

<400> SEQENCE: 9

Met Glu Gly Phe Thr Ser Phe Phe Glu Ser Gln Ser Ala Ser Arg Ser

1 5 10 15

Arg Trp Asn Tyr Asp Ala Leu Lys Asn Phe His Gln Ile Ser Pro Arg

20 25 30

Val Gln Thr His Leu Lys Gln Val Tyr Leu Thr Leu Cys Cys Ala Leu

35 40 45

Val Ala Ser Ala Ala Gly Ala Tyr Leu His Ile Leu Trp Asn Ile Gly

50 55 60

Gly Phe Leu Thr Thr Leu Ala Cys Ile Gly Ser Met Val Trp Leu Leu

65 70 75 80

Ala Thr Pro Pro Tyr Gln Glu Gln Lys Arg Val Ala Leu Leu Met Ala

85 90 95

Ala Ala Leu Phe Glu Gly Ala Ser Ile Gly Pro Leu Ile Glu Leu Gly

100 105 110

Ile Asn Phe Asp Pro Ser Ile Val Leu Gly Ala Phe Val Gly Cys Gly

115 120 125

Val Val Phe Gly Cys Phe Ser Ala Ala Ala Met Leu Ala Arg Arg Arg

130 135 140

Glu Tyr Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Val Ser Leu Leu

145 150 155 160

Met Trp Leu His Phe Ala Ser Ser Ile Phe Gly Gly Ala Met Ala Leu

165 170 175

Phe Lys Phe Glu Val Tyr Phe Gly Phe Leu Val Phe Val Gly Tyr Ile

180 185 190

Val Phe Asp Thr Gln Glu Ile Ile Glu Lys Ala His Leu Gly Asp Met

195 200 205

Asp Tyr Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val

210 215 220

Phe Val Arg Ile Leu Ile Ile Met Leu Lys Asn Ala Phe Glu Lys Glu

225 230 235 240

Glu Lys Lys Lys Lys Arg Arg Asn

245

<210> SEQ ID NO: 10

<211> LENGTH: 747

<212> TYPE: DNA

<213> ORGANISM: Capsicum annuum

<400> SEQENCE: 10

atggagggtt tcacgtcgtt cttcgaatcg caatcggctt ctcgcagtcg ctggaattat 60

gatgctctca aaaacttcca tcagatctct cctcgtgttc aaactcatct caaacaggtc 120

tacctcacac tatgctgtgc tttagtcgca tcagctgctg gggcttacct tcacattctt 180

tggaacatcg gtggcttcct cacaacactg gcttgcattg gaagcatggt gtggcttctg 240

gcaactcctc cttatcaaga gcaaaaaagg gtggcacttc tgatggcagc tgcactcttt 300

gaaggcgctt caattggtcc tctgattgaa ctgggcatca acttcgaccc aagcattgtg 360

cttggtgctt ttgtaggttg tggtgtggtt tttggttgct tctcagctgc tgccatgttg 420

gcaaggcgca gggagtactt gtaccttgga ggccttcttt catctggtgt ctccctcctc 480

atgtggttgc actttgcatc ctccattttt ggtggtgcca tggccctttt caagtttgag 540

gtgtattttg gtttcttggt gtttgtgggc tacatagttt ttgacaccca agaaatcatt 600

gagaaggctc acttgggtga tatggattac gtcaagcatg cactcaccct cttcacagat 660

tttgttgcag tctttgtgcg gattttgatc atcatgttga agaatgcatt tgagaaggaa 720

gagaagaaga agaagaggag aaactag 747

<210> SEQ ID NO: 11

<211> LENGTH: 244

<212> TYPE: PRT

<213> ORGANISM: Glycine max

<400> SEQENCE: 11

Met Asp Ser Phe Asn Ser Phe Phe Asp Ser Thr Asn Arg Trp Asn Tyr

1 5 10 15

Asp Thr Leu Lys Asn Phe Arg Gln Ile Ser Pro Val Val Gln Asn His

20 25 30

Leu Lys Gln Val Tyr Phe Thr Leu Cys Phe Ala Val Val Ala Ala Ala

35 40 45

Val Gly Ala Tyr Leu His Val Leu Leu Asn Ile Gly Gly Phe Leu Thr

50 55 60

Thr Val Ala Cys Val Gly Ser Ser Val Trp Leu Leu Ser Thr Pro Pro

65 70 75 80

Phe Glu Glu Arg Lys Arg Val Thr Leu Leu Met Ala Ala Ser Leu Phe

85 90 95

Gln Gly Ala Ser Ile Gly Pro Leu Ile Asp Leu Ala Ile Gln Ile Asp

100 105 110

Pro Ser Leu Ile Phe Ser Ala Phe Val Gly Thr Ser Leu Ala Phe Ala

115 120 125

Cys Phe Ser Gly Ala Ala Leu Val Ala Arg Arg Arg Glu Tyr Leu Tyr

130 135 140

Leu Gly Gly Leu Val Ser Ser Gly Leu Ser Ile Leu Leu Trp Leu His

145 150 155 160

Phe Ala Ser Ser Ile Phe Gly Gly Ser Thr Ala Leu Phe Lys Phe Glu

165 170 175

Leu Tyr Phe Gly Leu Leu Val Phe Val Gly Tyr Ile Val Val Asp Thr

180 185 190

Gln Glu Ile Val Glu Arg Ala His Leu Gly Asp Leu Asp Tyr Val Lys

195 200 205

His Ala Leu Thr Leu Phe Thr Asp Leu Val Ala Val Phe Val Arg Ile

210 215 220

Leu Val Ile Met Leu Lys Asn Ser Ala Glu Arg Asn Glu Lys Lys Lys

225 230 235 240

Lys Arg Arg Asp

<210> SEQ ID NO: 12

<211> LENGTH: 1077

<212> TYPE: DNA

<213> ORGANISM: Glycine max

<400> SEQENCE: 12

tttttttttt ttttttttaa cgtaaaaatt tatcttatta gagaactcaa aacatgtcaa 60

catgtactag tgtactactg atataaagca aacaaacgac taaactgcac agttggagca 120

agcttaacaa gtgaacaaca ctgtatagac agctgtttta agtattacag tccaagggag 180

ttgaagtgtt aactgagcag attggtaaga aaatcaatct ctcctcttct ttttcttctc 240

attcctctca gccgaattct tcaacataat aacaagaatc cggacaaaaa ctgcaaccaa 300

atcggtaaac aaggtcaagg catgctttac atagtccaga tcgcccaagt gtgccctctc 360

aactatttct tgggtgtcta ctacaatgta acctacaaac accaaaagcc caaagtacaa 420

ctcaaactta aagagagctg ttgaacctcc aaagatggaa gaagcaaagt gcaaccagag 480

aaggatggac aatccagaag aaaccaagcc accaaggtac aggtactccc tacgcctagc 540

aaccaaagct gctcctgaga agcatgcaaa ggccaaggat gttcccacaa atgcactaaa 600

gataaggctt ggatcgattt gaatagccaa atctatcaag ggtccaatag aggcaccctg 660

aaacagtgat gcggccatca acaaagtcac tcttttcctc tcttcaaaag gaggtgtcga 720

gagtaaccaa acactgcttc ccacgcatgc cactgtagta agaaaacccc caatgttcaa 780

gaggacatga aggtaagccc caacagccgc agcaaccacg gcgaaacaca gagtaaaata 840

aacctgcttg aggtgattct gaacgaccgg agaaatttga cggaagtttt tgagagtatc 900

gtaattccat cggtttgttg aatcgaagaa ggaattgaag gagtccattg cttgcaatcg 960

gagaaacaca aatttggtta atgacggata tggctttgaa tttcaacacc cctaatttat 1020

acttcaatca agggaccaac gaaggctaat ttcgcagaag gttccactta agattcc 1077

<210> SEQ ID NO: 13

<211> LENGTH: 258

<212> TYPE: PRT

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 13

Met Asp Ala Phe Tyr Ser Thr Ser Ser Ser Ser Ser Ser Ser Gly Pro

1 5 10 15

Tyr Gly Ala Ala Ala Tyr Gly Gly Ser Gly Trp Gly Tyr Asp Ser Leu

20 25 30

Lys Asn Phe Arg Gln Ile Ser Pro Ala Val Gln Thr His Leu Lys Leu

35 40 45

Val Tyr Leu Thr Leu Cys Val Ala Leu Ala Ser Ser Ala Leu Gly Ala

50 55 60

Tyr Leu His Val Val Trp Asn Ile Gly Gly Met Leu Thr Met Leu Gly

65 70 75 80

Cys Val Gly Ser Ile Ala Trp Leu Phe Ser Val Pro Val Tyr Glu Glu

85 90 95

Arg Lys Arg Tyr Gly Leu Leu Met Ala Ala Ala Leu Leu Glu Gly Ala

100 105 110

Ser Val Gly Pro Leu Ile Lys Leu Ala Val Glu Phe Asp Pro Ser Ile

115 120 125

Leu Val Thr Ala Phe Val Gly Thr Ala Ile Ala Phe Ala Cys Phe Ser

130 135 140

Cys Ala Ala Val Val Ala Lys Arg Arg Glu Tyr Leu Tyr Leu Gly Gly

145 150 155 160

Leu Leu Ser Ser Gly Leu Ser Ile Leu Leu Trp Leu Gln Phe Ala Ala

165 170 175

Ser Ile Phe Gly His Ser Thr Ser Thr Phe Met Phe Glu Val Tyr Phe

180 185 190

Gly Leu Leu Ile Phe Leu Gly Tyr Met Val Tyr Asp Thr Gln Glu Ile

195 200 205

Ile Glu Arg Ala His His Gly Asp Met Asp Tyr Ile Lys His Ala Leu

210 215 220

Thr Leu Phe Thr Asp Phe Val Ala Val Leu Val Arg Ile Leu Val Ile

225 230 235 240

Met Leu Lys Asn Ala Ala Asp Lys Ser Glu Asp Lys Lys Arg Lys Lys

245 250 255

Arg Ser

<210> SEQ ID NO: 14

<211> LENGTH: 1326

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 14

agatcaaatc aaatccacga gacgagaaca aaacctggtt ccgacccagc acgagacacg 60

actcctccat tccaaatcca aatccatcca ttcccccttt gcgtgtggtg cgaggcccac 120

cgatcccatc cgatccgatc catttcgcgt cgcgtctacc agagggatca cgacacaccc 180

gccgccggag ccggaagaga gagagagaga gatggacgcg ttctactcga cctcctcgtc 240

gtcgtcgtcc tcggggccgt acggcgcggc ggcgtacggc ggcagcggct ggggctacga 300

ctcgctcaag aacttccgcc agatcagccc cgccgtccag acccacctca agctcgttta 360

cctgaccctc tgcgtggcgc tggcctcgtc ggcgctgggc gcttacctgc acgtcgtctg 420

gaacatcggc gggatgctga ccatgctcgg ctgcgtcggc agtatcgcct ggctcttctc 480

ggtgcccgtc tacgaggaga ggaagaggta cggactgctg atggcggctg ccctcctgga 540

aggggcttcg gttggacccc tcatcaagct ggccgtggaa tttgacccaa gcatcctggt 600

gacagcgttt gtgggaactg ccattgcgtt cgcgtgcttc tcttgcgcgg ccgtggttgc 660

caagcgcagg gagtacctct acctgggcgg gctgctctct tcggggctct ccatcctgct 720

ctggctgcag ttcgccgcct ccatctttgg ccactccact agcaccttca tgtttgaggt 780

ttactttggg ctgcttatct tcctgggata catggtgtac gacacgcagg agatcatcga 840

gagggcgcac cacggcgaca tggactacat caagcacgcc ctcaccctct tcaccgactt 900

cgtggctgtc cttgtccgca tcctcgtcat catgctcaag aacgcggctg acaagtcgga 960

ggacaagaag aggaagaaga ggtcgtgagc ggtctcacct gtgcgtaagt gcaacactga 1020

aggaaggaaa ggcacggcgg gctgcctgct gctactagta gtacaatata tatgaatatg 1080

aatcgaagct cctgcatatt atatatagga ggagtaactg ggtgcttgtg atggaactga 1140

aagaaagtgt ttcttcgttt tcttgctctc ttattagtct gttagttgtc ctgtaaattg 1200

agtctggtaa ggttttgttg cataaacgat acgagcgctg caacaaattg gatctgcttg 1260

ccggtgtttt ccggcctgaa aactctgaag atggatggaa tgcgattaag aatgttgcct 1320

ttgcac 1326

<210> SEQ ID NO: 15

<211> LENGTH: 252

<212> TYPE: PRT

<213> ORGANISM: Zea mays

<400> SEQENCE: 15

Met Asp Ala Phe Phe Ser Ala Ser Ser Ala Ser Ala Pro Tyr Gly Tyr

1 5 10 15

Gly Ala Gly Gly Trp Ser Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile

20 25 30

Thr Pro Ala Val Gln Thr His Leu Lys Leu Val Tyr Leu Thr Leu Cys

35 40 45

Ala Ala Leu Ala Ser Ser Ala Val Gly Ala Tyr Leu His Val Val Trp

50 55 60

Asn Ile Gly Gly Thr Leu Thr Met Leu Gly Cys Val Gly Ser Ile Ala

65 70 75 80

Trp Leu Phe Ser Val Pro Val Tyr Glu Glu Arg Lys Arg Tyr Gly Leu

85 90 95

Leu Met Ala Ala Ala Leu Leu Glu Gly Ala Ser Val Gly Pro Leu Val

100 105 110

Lys Leu Ala Val Glu Phe Asp Pro Ser Ile Leu Val Thr Ala Phe Val

115 120 125

Gly Thr Ala Ile Ala Phe Ala Cys Phe Thr Gly Ala Ala Met Val Ala

130 135 140

Arg Arg Arg Glu Tyr Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Leu

145 150 155 160

Ser Ile Leu Leu Trp Leu Gln Leu Ala Gly Ser Ile Phe Gly His Ser

165 170 175

Ala Thr Ser Phe Met Phe Glu Val Tyr Phe Gly Leu Leu Ile Phe Leu

180 185 190

Gly Tyr Val Val Tyr Asp Thr Gln Glu Ile Ile Glu Arg Ala His Arg

195 200 205

Gly Asp Met Asp His Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe

210 215 220

Val Ala Val Leu Val Arg Val Leu Val Ile Met Leu Lys Asn Gly Ala

225 230 235 240

Asp Lys Ser Glu Asp Lys Lys Arg Lys Lys Arg Ser

245 250

<210> SEQ ID NO: 16

<211> LENGTH: 1173

<212> TYPE: DNA

<213> ORGANISM: Zea mays

<400> SEQENCE: 16

tcgtccttct ccttcccacc gccacgccac gccacgccac gccggctcgg tacatatact 60

agcctgcctc gatcggcctc cctcgcattc cccctcgatc ggcctccctc ccccaagatc 120

ctccactcga tcccaaacaa accaacaaat ccatccatcg cacatggacg cgttcttctc 180

ggcctcctcc gcgtcggcgc cctacggcta cggcgccggc ggatggagct acgactcgct 240

caagaacttc cgccagatca cccccgccgt ccagacccac ctcaagctcg tctacctcac 300

cctgtgcgcg gcgctggcct cgtcggcggt gggcgcttac ctgcacgtgg tctggaacat 360

cggcggtacg ctgacaatgc tcggttgcgt cggcagcatc gcctggctct tctcggtgcc 420

cgtctacgag gagaggaaga ggtatgggct gctgatggcg gctgccctcc tggaaggcgc 480

ttcggtcgga cccctcgtca agctcgccgt ggaatttgac ccaagcatcc tggtgacggc 540

gttcgtgggg actgccatcg cgttcgcgtg cttcaccggc gcggccatgg tggccaggcg 600

cagggagtac ctctacctgg gtgggctgct ctcgtcgggg ctctccatcc tgctctggct 660

gcagctagcc ggctccatct tcggccactc cgcaaccagc ttcatgttcg aggtctactt 720

cgggctgctc atcttcctgg gctacgtggt gtacgacacg caggagatca tcgagagggc 780

gcaccgcggc gacatggacc acgtcaagca cgccctcacc ctcttcacag acttcgtggc 840

cgtcctcgtc cgcgtcctcg tcatcatgct caagaacggg gccgacaagt cggaggacaa 900

gaagaggaag aagaggtcgt gagcgcgtcg agaagggaag ctcttccact tccacatatg 960

cataggagta actgctgggg ttccttcctg gggtggaagt gtggaactga gctgagtgtt 1020

cagaagtgtt cctttgttcg gcacctttgt tctcttcctc tcttgatgag tctgtaaata 1080

gctatgtcaa tctggttaag cttggtttgg ttgcctgtgc ctgtgttcgc tggcctttgg 1140

atagaatgca aattaaagat gttgctattg cac 1173

<210> SEQ ID NO: 17

<211> LENGTH: 247

<212> TYPE: PRT

<213> ORGANISM: Triticum aestivum

<400> SEQENCE: 17

Met Asp Ala Phe Tyr Ser Thr Ser Ser Ala Ala Ala Ser Gly Trp Gly

1 5 10 15

Tyr Asp Ser Leu Lys Asn Phe Arg Glu Ile Ser Pro Ala Val Gln Ser

20 25 30

His Leu Lys Leu Val Tyr Leu Thr Leu Cys Phe Ala Leu Ala Ser Ser

35 40 45

Ala Val Gly Ala Tyr Leu His Ile Ala Leu Asn Ile Gly Gly Met Leu

50 55 60

Thr Met Leu Ala Cys Ile Gly Thr Ile Ala Trp Met Phe Ser Val Pro

65 70 75 80

Val Tyr Glu Glu Arg Lys Arg Phe Gly Leu Leu Met Gly Ala Ala Leu

85 90 95

Leu Glu Gly Ala Ser Val Gly Pro Leu Ile Glu Leu Ala Ile Asp Phe

100 105 110

Asp Pro Ser Ile Leu Val Thr Gly Phe Val Gly Thr Ala Ile Ala Phe

115 120 125

Gly Cys Phe Ser Gly Ala Ala Ile Ile Ala Lys Arg Arg Glu Tyr Leu

130 135 140

Tyr Leu Gly Gly Leu Leu Ser Ser Gly Leu Ser Ile Leu Leu Trp Leu

145 150 155 160

Gln Phe Ala Thr Ser Ile Phe Gly His Ser Ser Gly Ser Phe Met Phe

165 170 175

Glu Val Tyr Phe Gly Leu Leu Ile Phe Leu Gly Tyr Met Val Tyr Asp

180 185 190

Thr Gln Glu Ile Ile Glu Arg Ala His His Gly Asp Met Asp Tyr Ile

195 200 205

Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val Leu Val Arg

210 215 220

Ile Leu Ile Ile Met Leu Lys Asn Ala Gly Asp Lys Ser Glu Asp Lys

225 230 235 240

Lys Lys Arg Lys Arg Arg Ser

245

<210> SEQ ID NO: 18

<211> LENGTH: 744

<212> TYPE: DNA

<213> ORGANISM: Triticum aestivum

<400> SEQENCE: 18

atggacgcct tctactcgac ctcgtcggcg gcggccagcg gatggggcta cgactccctc 60

aagaacttcc gcgagatctc ccccgccgtg cagtcccacc tcaagctcgt ttacctgacc 120

ctatgctttg ccctggcctc atctgccgtg ggtgcttacc tgcacattgc cctgaacatt 180

ggcgggatgc tgacaatgct cgcgtgtatc ggaaccatcg cctggatgtt ctcggtgcca 240

gtctatgagg agaggaagag gtttgggctg ctgatgggtg cagccctcct ggaaggggct 300

tcagttggac ctctgattga gcttgccata gactttgacc caagcatcct cgtgacaggg 360

tttgtcggaa ccgccatcgc cttcgggtgc ttctctggcg ccgccatcat cgccaagcgc 420

agggagtacc tgtacctcgg cggcctgctc tcctctggcc tgtcgatcct gctctggctg 480

cagtttgcca cgtccatctt tggccactcc tctggcagct tcatgtttga ggtctacttt 540

ggcctgttga tcttcctggg gtacatggtg tacgacacgc aggagatcat cgagagggcg 600

caccacggtg acatggacta catcaagcac gcgctcaccc tcttcaccga cttcgtcgcc 660

gtcctcgtcc gcatcctcat catcatgctc aagaacgcag gcgacaagtc ggaggacaag 720

aagaagagga agaggaggtc ctga 744

<210> SEQ ID NO: 19

<211> LENGTH: 247

<212> TYPE: PRT

<213> ORGANISM: Triticum aestivum

<400> SEQENCE: 19

Met Asp Ala Phe Tyr Ser Thr Ser Ser Ala Ala Ala Ser Gly Trp Gly

1 5 10 15

Tyr Asp Ser Leu Lys Asn Phe Arg Glu Ile Ser Pro Ala Val Gln Ser

20 25 30

His Leu Lys Leu Val Tyr Leu Thr Leu Cys Phe Ala Leu Ala Ser Ser

35 40 45

Ala Val Gly Ala Tyr Leu His Ile Ala Leu Asn Ile Gly Gly Met Leu

50 55 60

Thr Met Leu Ala Cys Val Gly Thr Ile Ala Trp Met Phe Ser Val Pro

65 70 75 80

Val Tyr Glu Glu Arg Lys Arg Phe Gly Leu Leu Met Gly Ala Ala Leu

85 90 95

Leu Glu Gly Ala Ser Val Gly Pro Leu Ile Glu Leu Ala Ile Asp Phe

100 105 110

Asp Pro Ser Ile Leu Val Thr Gly Phe Val Gly Thr Ala Ile Ala Phe

115 120 125

Gly Cys Phe Ser Gly Ala Ala Ile Ile Ala Lys Arg Arg Glu Tyr Leu

130 135 140

Tyr Leu Gly Gly Leu Leu Ser Ser Gly Leu Ser Ile Leu Leu Trp Leu

145 150 155 160

Gln Phe Ala Thr Ser Ile Phe Gly His Ser Ser Gly Ser Phe Met Phe

165 170 175

Glu Val Tyr Phe Gly Leu Leu Ile Phe Leu Gly Tyr Met Val Tyr Asp

180 185 190

Thr Gln Glu Ile Ile Glu Arg Ala His His Gly Asp Met Asp Tyr Ile

195 200 205

Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val Leu Val Arg

210 215 220

Ile Leu Ile Ile Met Leu Lys Asn Ala Gly Asp Lys Ser Glu Asp Lys

225 230 235 240

Lys Lys Arg Lys Arg Arg Ser

245

<210> SEQ ID NO: 20

<211> LENGTH: 744

<212> TYPE: DNA

<213> ORGANISM: Triticum aestivum

<400> SEQENCE: 20

atggacgcct tctactcgac ctcgtcggcg gcggcgagcg gctggggcta cgactccctc 60

aagaacttcc gcgagatctc ccccgccgtg cagtcccacc tcaagctcgt ttacctgacc 120

ctatgctttg ccctggcctc atctgccgtg ggtgcttacc tgcacattgc cctgaacatc 180

ggtgggatgc tgacaatgct cgcgtgtgtt ggaaccatcg cctggatgtt ctctgtgcca 240

gtctatgagg agaggaagag gtttgggctg ctgatgggtg cagccctcct ggaaggggct 300

tcggttggac ctctgattga gcttgccata gactttgacc caagtatcct cgtgacaggg 360

tttgtcggaa ccgccatcgc cttcgggtgc ttctctggcg ccgccatcat cgccaagcgc 420

agggagtacc tgtacctcgg tggcctgctc tcctccggcc tgtcgatcct gctctggctg 480

cagtttgcca cgtccatctt tggccactcc tctggcagct tcatgtttga ggtttacttt 540

ggcctgttga tctttctggg atacatggtg tacgacacgc aggagatcat cgagagggcg 600

caccacggcg acatggacta catcaagcac gcgctcaccc tcttcaccga ctttgtcgcc 660

gtcctcgtcc ggatcctcat catcatgctc aagaacgcag gcgacaagtc ggaggacaag 720

aagaagagga agaggaggtc ctga 744

<210> SEQ ID NO: 21

<211> LENGTH: 246

<212> TYPE: PRT

<213> ORGANISM: Glycine max

<400> SEQENCE: 21

Met Asp Thr Phe Phe Lys Ser Pro Ser Ser Ser Ser Ser Arg Ser Ser

1 5 10 15

Trp Ser Tyr Asp Thr Leu Lys Asn Phe Arg Glu Ile Ser Pro Leu Val

20 25 30

Gln Asn His Ile Lys Leu Val Tyr Phe Thr Leu Cys Cys Ala Val Val

35 40 45

Ala Ala Ala Val Gly Ala Phe Leu His Val Leu Trp Asn Ile Gly Gly

50 55 60

Phe Leu Thr Thr Val Ala Ser Ile Gly Ser Met Phe Trp Leu Leu Ser

65 70 75 80

Thr Pro Pro Phe Glu Glu Gln Lys Arg Leu Ser Leu Leu Met Ala Ser

85 90 95

Ala Leu Phe Gln Gly Ala Ser Ile Gly Pro Leu Ile Gly Leu Ala Phe

100 105 110

Ala Ile Asp Pro Gly Leu Ile Ile Gly Ala Phe Val Ala Thr Ser Leu

115 120 125

Ala Phe Ala Cys Phe Ser Ala Val Ala Leu Val Ala Arg Arg Arg Glu

130 135 140

Tyr Pro Tyr Leu Gly Gly Leu Leu Ser Ser Trp Leu Ser Ile Leu Met

145 150 155 160

Trp Leu His Ser Asp Ser Ser Leu Phe Gly Gly Ser Ile Ala Leu Phe

165 170 175

Lys Phe Glu Leu Tyr Phe Gly Leu Leu Val Phe Val Gly Tyr Val Ile

180 185 190

Val Asp Thr Gln Val Ile Ile Glu Arg Ala His Phe Gly Asp Leu Asp

195 200 205

Tyr Val Lys His Ala Leu Thr Leu Phe Thr Asp Leu Ala Ala Ile Phe

210 215 220

Val Arg Ile Leu Asn Ile Met Leu Asn Asn Ser Ser Lys Arg Asn Glu

225 230 235 240

Lys Lys Arg Arg Arg Asp

245

<210> SEQ ID NO: 22

<211> LENGTH: 1051

<212> TYPE: DNA

<213> ORGANISM: Glycine max

<400> SEQENCE: 22

tttttttttt ttttttgaaa caaaggcagt aaataatcat ttggaagaac ctgtccgcaa 60

gtttatacta tatattatga ttattagcaa atacatatga aaatgtttaa aagaaatcct 120

gacatttacc attacagcaa acacatagct aactactaac tacacaaggg gaccaacaac 180

ttctaaacag ctaattatgt attctctaca aaccaaatta ctctacacat agcaatcggt 240

caacctatta atctctcctc ctcttcttct catttctctt agatgaatta ttcaacatta 300

tattaagaat tcgcacaaag attgcagcca aatcagtgaa cagtgtcaat gcatgcttaa 360

cataatccag gtcaccaaag tgagccctct caatgattac ttgagtgtct actataacgt 420

agcccacaaa caccaaaagc ccaaagtaca actcaaattt gaatagagct atagagcccc 480

caaagagaga ggaatcagag tgcaaccaca taagaatgga aagccaagaa gaaagcaaac 540

caccaaggta ggggtactcc cttcgccttg caactaaggc tactgcagaa aagcaagcaa 600

aagccaaaga agttgccaca aatgcgccaa tgataaggcc aggatcaatg gcaaaagcca 660

aaccaatcag aggtccaatg gaagcaccct gaaacagggc cgaagccatc aacagagaca 720

acctcttctg ctcttcaaaa gggggtgtag atagcaacca aaacatgctc ccaatggaag 780

ccaccgtggt gagaaaaccg ccaatgttcc acagaacatg aaggaaggct ccaacagcag 840

cagccaccac agcgcaacat aacgtaaaat aaaccagttt gatgtgattc tgaacgagcg 900

gagagatctc gcggaaattc ttgagagtat cgtaactcca gctgcttcta gaagaagaag 960

acgatgggga cttgaagaaa gtgtccatcg aaaacaagga atcaaatcgt atcgttttcg 1020

tgatgtgatt attacaagca caattggttc c 1051

<210> SEQ ID NO: 23

<211> LENGTH: 247

<212> TYPE: PRT

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 23

Met Asp Ala Phe Tyr Ser Thr Ser Ser Ala Ala Ala Ser Gly Trp Gly

1 5 10 15

His Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Ala Val Gln Ser

20 25 30

His Leu Lys Leu Val Tyr Leu Thr Leu Cys Phe Ala Leu Ala Ser Ser

35 40 45

Ala Val Gly Ala Tyr Leu His Ile Ala Leu Asn Ile Gly Gly Met Leu

50 55 60

Thr Met Leu Ala Cys Val Gly Thr Ile Ala Trp Met Phe Ser Val Pro

65 70 75 80

Val Tyr Glu Glu Arg Lys Arg Phe Gly Leu Leu Met Gly Ala Ala Leu

85 90 95

Leu Glu Gly Ala Ser Val Gly Pro Leu Ile Glu Leu Ala Ile Asp Phe

100 105 110

Asp Pro Ser Ile Leu Val Thr Gly Phe Val Gly Thr Ala Ile Ala Phe

115 120 125

Gly Cys Phe Ser Gly Ala Ala Ile Ile Ala Lys Arg Arg Glu Tyr Leu

130 135 140

Tyr Leu Gly Gly Leu Leu Ser Ser Gly Leu Ser Ile Leu Leu Trp Leu

145 150 155 160

Gln Phe Ala Thr Ser Ile Phe Gly His Ser Ser Gly Ser Phe Met Phe

165 170 175

Glu Val Tyr Phe Gly Leu Leu Ile Phe Leu Gly Tyr Met Val Tyr Asp

180 185 190

Thr Gln Glu Ile Ile Glu Arg Ala His His Gly Asp Met Asp Tyr Ile

195 200 205

Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val Leu Val Arg

210 215 220

Val Leu Ile Ile Met Leu Lys Asn Ala Gly Asp Lys Ser Glu Asp Lys

225 230 235 240

Lys Lys Arg Lys Arg Arg Ser

245

<210> SEQ ID NO: 24

<211> LENGTH: 1177

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 24

gagcggagaa ggcgaaaaac agaaggagaa aaatccaccc caaaacgcga gcgcaggaca 60

agcgaggaac cttgcgtgcg aggcgaggcc gccccgctcc gattcgattc gacgcgcagg 120

cgcaggcgca gggatggacg ccttctactc gacctcgtcg gcggcggcga gcggctgggg 180

ccacgactcc ctcaagaact tccgccagat ctcccccgcc gtgcagtccc acctcaagct 240

cgtttacctg actctatgct ttgcactggc ctcatctgcc gtgggtgctt acctacacat 300

tgccctgaac atcggcggga tgctgacaat gctcgcttgt gtcggaacta tcgcctggat 360

gttctcggtg ccagtctatg aggagaggaa gaggtttggg ctgctgatgg gtgcagccct 420

cctggaaggg gcttcggttg gacctctgat tgagcttgcc atagactttg acccaagcat 480

cctcgtgaca gggtttgtcg gaaccgccat cgcctttggg tgcttctctg gcgccgccat 540

catcgccaag cgcagggagt acctgtacct cggtggcctg ctctcgtctg gcctgtcgat 600

cctgctctgg ctgcagtttg ccacgtccat ctttggccac tcctctggca gcttcatgtt 660

tgaggtttac tttggcctgt tgatcttcct ggggtacatg gtgtacgaca cgcaggagat 720

catcgagagg gcgcaccatg gcgacatgga ctacatcaag cacgccctca ccctcttcac 780

cgactttgtt gccgtcctcg tccgagtcct catcatcatg ctcaagaacg caggcgacaa 840

gtcggaggac aagaagaaga ggaagaggag gtcctgaacg tttttcccgc acatgtagat 900

accgtcaccg ccgccgctac tggtaccccc ccccccgcta agtacgtagt aggaattaag 960

ctggcgcagt aacttggcgc cgtgccatcc ttgttaattt gtgttcgtgt gaaccttgtg 1020

tgagtctgct gctgctgatg aagcttttgc agccgcccgt ctgcgttccg aatctcttgt 1080

gttgttgtta ctgtcaggat aatgaatcga acgaaacctg agacgatttg gttttggttt 1140

ggtttgcgaa gaacatggct acgcttgttt gtgaatg 1177

<210> SEQ ID NO: 25

<211> LENGTH: 249

<212> TYPE: PRT

<213> ORGANISM: Oryza sativa

<400> SEQENCE: 25

Met Asp Ala Phe Tyr Ser Thr Ser Ser Ala Tyr Gly Ala Ala Ala Ser

1 5 10 15

Gly Trp Gly Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Ala

20 25 30

Val Gln Ser His Leu Lys Leu Val Tyr Leu Thr Leu Cys Val Ala Leu

35 40 45

Ala Ala Ser Ala Val Gly Ala Tyr Leu His Val Ala Leu Asn Ile Gly

50 55 60

Gly Met Leu Thr Met Leu Gly Cys Val Gly Ser Ile Ala Trp Leu Phe

65 70 75 80

Ser Val Pro Val Phe Glu Glu Arg Lys Arg Phe Gly Ile Leu Leu Ala

85 90 95

Ala Ala Leu Leu Glu Gly Ala Ser Val Gly Pro Leu Ile Lys Leu Ala

100 105 110

Val Asp Phe Asp Ser Ser Ile Leu Val Thr Ala Phe Val Gly Thr Ala

115 120 125

Ile Ala Phe Gly Cys Phe Thr Cys Ala Ala Ile Val Ala Lys Arg Arg

130 135 140

Glu Tyr Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Leu Ser Ile Leu

145 150 155 160

Leu Trp Leu Gln Phe Ala Ala Ser Ile Phe Gly His Ser Thr Gly Ser

165 170 175

Phe Met Phe Glu Val Tyr Phe Gly Leu Leu Ile Phe Leu Gly Tyr Met

180 185 190

Val Tyr Asp Thr Gln Glu Ile Ile Glu Arg Ala His His Gly Asp Met

195 200 205

Asp Tyr Ile Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val

210 215 220

Leu Val Arg Ile Leu Val Ile Met Leu Lys Asn Ala Ser Asp Lys Ser

225 230 235 240

Glu Glu Lys Lys Arg Lys Lys Arg Ser

245

<210> SEQ ID NO: 26

<211> LENGTH: 1191

<212> TYPE: DNA

<213> ORGANISM: Oryza sativa

<400> SEQENCE: 26

ttccttttta tccgacgatt caaaaaattc gaagccatcc accaacgaag aaaaaaaaaa 60

gggagaaaaa aaaatccacg cacactttgc gtgcgaggcg aggcggttcg attcgagagg 120

agagagagag agagagagag agagagagat ggacgccttc tactcgacct cgtcggcgta 180

cggagcggcg gcgagcggct ggggctacga ctcgctgaag aacttccgcc agatctcccc 240

cgccgtccag tcccacctca agctcgttta cctgacacta tgcgtcgccc tggctgcgtc 300

ggcggtgggc gcatacctgc acgtcgcctt gaacatcggc gggatgttga ctatgctcgg 360

gtgcgtgggg agcatcgcct ggttgttctc ggtgcctgtc tttgaggaga ggaagaggtt 420

tgggattctc ttggccgctg ccctgctgga aggggcttca gttgggcctc tgatcaagct 480

tgctgtagac tttgactcaa gcattctcgt aacagcattt gttggaactg ccattgcatt 540

tgggtgcttc acttgcgctg ccatcgttgc caagcgtagg gagtacctct accttggtgg 600

tttgctctct tctggcctct ccatcctgct ctggctgcag tttgccgcat ccatctttgg 660

ccactccacc ggcagcttca tgtttgaggt ttactttggc ctgttgatct tcctggggta 720

catggtgtat gacacgcagg agatcatcga gagggctcac cacggtgaca tggactacat 780

caagcacgca ctcaccctct tcactgactt cgtggccgtc cttgtccgga tcctcgtcat 840

catgctcaag aacgcgtctg acaagtcgga ggagaagaag aggaagaaga ggtcttgaga 900

gcttctcttc ccgctttgca cataagaaaa aaccaccgcg gctattgcct ctacgtatta 960

tgacagagcc gcacttcaac tgggttttat ggtgaataca agttcttttg cattttgttg 1020

atacggtgtg aatcttctca ggtttgtcgt cgtagtagct ttgcaaatac tagcatgcta 1080

catgacacgg atctttctgt aatggtggtc gcgttgatcg aaacgtgaaa acacatcttc 1140

atttgcgact aatttgtttg ccttttggtg attgatgatg atcctttccc c 1191

<210> SEQ ID NO: 27

<211> LENGTH: 250

<212> TYPE: PRT

<213> ORGANISM: Cucumis sativus

<400> SEQENCE: 27

Met Asp Ala Phe Ser Ser Phe Phe Asp Ser Gln Ser Gly Ser Arg Thr

1 5 10 15

Arg Trp Ser His Glu Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Ala

20 25 30

Val Gln Ser His Leu Gln Arg Val Tyr Leu Thr Leu Gly Cys Ala Leu

35 40 45

Val Ala Ser Ala Ala Gly Ala Tyr Leu His Ile Leu Trp Asn Ile Gly

50 55 60

Gly Phe Leu Thr Thr Leu Ala Thr Ile Gly Cys Ile Thr Trp Leu Met

65 70 75 80

Ala Thr Pro Pro Tyr Glu Glu Lys Lys Arg Ala Ser Ile Leu Leu Gly

85 90 95

Ala Ala Leu Leu Glu Gly Ala Ser Ile Gly Pro Leu Ile Ser Leu Ala

100 105 110

Ile Asp Phe Asp Pro Ser Val Leu Val Ser Ala Phe Val Gly Thr Ala

115 120 125

Val Ala Phe Cys Cys Phe Ser Gly Ala Ala Leu Leu Ala Arg Arg Arg

130 135 140

Glu Phe Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Val Ser Met Leu

145 150 155 160

Leu Trp Leu His Phe Ala Ser Ser Leu Phe Gly Gly Ser Thr Ala Leu

165 170 175

Phe Lys Phe Glu Leu Tyr Phe Gly Leu Leu Val Phe Val Gly Tyr Met

180 185 190

Val Val Asp Thr Gln Glu Ile Ile Glu Met Ala His Met Gly Asp Met

195 200 205

Asp Tyr Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe Ile Ala Val

210 215 220

Phe Val Arg Ile Leu Ile Ile Met Leu Lys Asn Ser Ala Glu Lys Asn

225 230 235 240

Glu Arg Glu Arg Lys Lys Lys Arg Arg Asp

245 250

<210> SEQ ID NO: 28

<211> LENGTH: 753

<212> TYPE: DNA

<213> ORGANISM: Cucumis sativus

<400> SEQENCE: 28

atggacgcat tctcttcttt cttcgattct caatctggat ccagaacccg ctggagtcat 60

gaatctctca agaacttccg gcagatttcg cccgccgttc aatctcatct tcagcgggtt 120

tatctcactc ttggttgtgc tttggttgca tctgctgctg gagcttatct gcatatactt 180

tggaatattg gtggttttct tacaacactt gcaactatcg gatgtattac atggctaatg 240

gccactcctc cttatgaaga gaaaaagagg gcctctattt tacttggggc tgctcttctc 300

gaaggggctt ccattggtcc tttgatcagt ctggctattg attttgaccc aagtgttctg 360

gtgagcgctt tcgtgggaac tgcggttgcc ttttgttgtt tctcaggagc agccttgttg 420

gcaagacgta gagaattcct ttatctcggt ggcttacttt cttccggtgt atccatgtta 480

ctctggttac atttcgcctc ctctttattc ggtggttcta ctgccctttt caagtttgag 540

ttgtactttg ggctgttggt ttttgttggc tacatggtag ttgatactca ggaaataatt 600

gagatggcac atatgggtga tatggattat gtgaaacatg cattaactct cttcactgat 660

ttcattgcgg tgtttgtccg aattctcatt ataatgctaa agaactctgc tgagaagaac 720

gagagggaga ggaagaagaa gaggagggac tga 753

<210> SEQ ID NO: 29

<211> LENGTH: 249

<212> TYPE: PRT

<213> ORGANISM: Cucumis sativus

<400> SEQENCE: 29

Met Asp Ala Phe Ser Ser Phe Phe Asp Ser Gln Gln Pro Ser Thr Asn

1 5 10 15

Pro Trp Thr Tyr Asp Ser Leu Lys Asn Phe Arg Gln Ile Ser Pro Val

20 25 30

Val Gln Ser His Leu His Gln Val Tyr Leu Thr Leu Gly Cys Ala Leu

35 40 45

Val Ala Ser Ala Ala Gly Ala Tyr Leu His Ile Leu Trp Asn Ile Gly

50 55 60

Gly Ile Leu Thr Ala Leu Ala Gly Ile Gly Cys Ile Thr Trp Leu Met

65 70 75 80

Ala Thr Pro Pro Tyr Glu Glu Arg Lys Arg Leu Ser Met Leu Met Ala

85 90 95

Ala Ala Leu Leu Glu Gly Ala Ser Ile Gly Pro Leu Ile Gly Leu Ala

100 105 110

Ile Glu Ile Asp Pro Ser Val Leu Val Ser Ala Phe Val Gly Thr Ala

115 120 125

Val Ala Phe Gly Cys Phe Ser Ala Ala Ala Met Leu Ala Arg Arg Arg

130 135 140

Glu Phe Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Ile Ser Met Leu

145 150 155 160

Leu Trp Leu His Phe Ala Ser Ser Ile Phe Gly Gly Ser Thr Ala Leu

165 170 175

Phe Lys Phe Glu Leu Tyr Phe Gly Leu Leu Leu Phe Val Gly Tyr Met

180 185 190

Val Val Asp Thr Gln Glu Ile Ile Glu Arg Ala His Leu Gly Asp Met

195 200 205

Asp Tyr Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Gly Val

210 215 220

Phe Val Arg Leu Leu Ile Ile Met Val Arg Asn Ser Val Glu Lys Asn

225 230 235 240

Glu Glu Lys Lys Lys Lys Arg Arg Asp

245

<210> SEQ ID NO: 30

<211> LENGTH: 750

<212> TYPE: DNA

<213> ORGANISM: Cucumis sativus

<400> SEQENCE: 30

atggatgcct tttcatcttt cttcgattct caacaacctt ctacaaaccc ttggacctac 60

gattctctca agaatttccg gcagatttcc cccgtcgttc aatctcatct ccaccaggtt 120

taccttactc tgggttgtgc tttggttgca tctgctgctg gagcttatct ccatattctg 180

tggaacattg gcggaatcct cactgcactt gctggtattg gatgcatcac atggctaatg 240

gccactcctc cttatgaaga gagaaagagg ctttctatgt taatggcggc tgctcttctt 300

gaaggagcat caattggtcc tttgattggg ttggctatcg agattgatcc aagtgttctg 360

gtcagtgcct ttgtgggaac tgctgtggct tttggttgtt tctctgcagc agccatgttg 420

gcaagacgta gagaattcct ttacctgggt ggcttacttt cttctgggat atccatgtta 480

ctctggttgc atttcgcttc atctatattc ggtggttcta ctgctctttt caagtttgag 540

ttgtactttg ggctattgct gtttgtgggc tacatggtag ttgatactca agaaataatc 600

gagagggctc atcttggtga tatggactat gtgaagcatg ccctgactct tttcactgat 660

ttcgttggtg ttttcgtccg acttctcatt attatggtaa ggaactcggt agagaagaat 720

gaggagaaaa agaagaagag gagggactaa 750

<210> SEQ ID NO: 31

<211> LENGTH: 247

<212> TYPE: PRT

<213> ORGANISM: Gossypium hirsutum

<400> SEQENCE: 31

Met Gly Thr Phe Ser Ser Phe Phe Asp Ser Gln Ser Arg Ser Gln Trp

1 5 10 15

Asn Tyr Asn Thr Leu Lys Asn Phe Arg Gln Ile Ser Pro Ile Val Gln

20 25 30

Thr His Leu Lys Lys Val Tyr Met Thr Leu Cys Cys Met Leu Val Ala

35 40 45

Ser Ala Phe Gly Ala Tyr Leu His Ile Ile Trp Asn Ile Gly Gly Tyr

50 55 60

Leu Thr Thr Phe Ala Cys Phe Gly Ala Ile Ile Trp Leu Arg Ser Thr

65 70 75 80

Pro Pro Cys Gln Glu Gln Lys Arg Val Ser Leu Leu Met Ala Ser Ala

85 90 95

Val Phe Glu Gly Ala Ser Ile Gly Pro Leu Ile Asp Leu Ala Ile Gln

100 105 110

Ile Asp Pro Ser Val Leu Val Ala Ala Phe Val Gly Thr Ala Leu Ala

115 120 125

Phe Ala Cys Phe Ser Arg Ala Ala Met Leu Ala Arg Arg Arg Glu Tyr

130 135 140

Leu Tyr Leu Gly Gly Leu Leu Ser Ser Gly Val Ser Met Leu Leu Trp

145 150 155 160

Leu His Phe Ala Ser Ser Ile Phe Gly Gly Ser Thr Ala Leu Phe Lys

165 170 175

Met Glu Ile Tyr Leu Gly Leu Leu Val Phe Val Gly Tyr Met Val Val

180 185 190

Asp Thr Gln Asp Ile Ile Glu Lys Ala His Leu Gly Asp Leu Asp Tyr

195 200 205

Val Lys His Ala Leu Thr Leu Phe Thr Asp Phe Val Ala Val Phe Val

210 215 220

Arg Ile Leu Ile Ile Met Leu Lys Asn Ser Ala Glu Lys Gly Glu Arg

225 230 235 240

Gln Lys Lys Lys Arg Ser Asp

245

<210> SEQ ID NO: 32

<211> LENGTH: 934

<212> TYPE: DNA

<213> ORGANISM: Gossypium hirsutum

<400> SEQENCE: 32

aacgaacgat gggcacgttc tcgtctttct tcgattctca atcgagaagc cagtggaatt 60

acaacactct caagaatttc cgtcagatct ctccgattgt tcaaacgcat ctcaaaaagg 120

tttatatgac cctatgttgt atgcttgttg cctctgcctt tggggcttat cttcatataa 180

tttggaacat tgggggttac ctcacgacat ttgcatgctt tggagccata atttggctcc 240

gttctacccc tccttgtcaa gagcaaaaga gggtttctct tctaatggca tcagcagttt 300

ttgaaggagc ttcaattggt cctctaattg acttggccat tcaaattgac ccaagtgttc 360

tggtagctgc attcgtggga acagcattgg cctttgcatg cttttcaaga gctgccatgt 420

tagcaaggcg gagagagtac ctctaccttg gtggcttgct ttcatctggt gtgtccatgc 480

ttctctggtt gcattttgct tcttctatct ttggtggttc tacagccctc tttaagatgg 540

agatctactt agggctcttg gtgtttgttg gctacatggt agtggacaca caagacataa 600

ttgagaaggc acacttgggt gatctggatt atgtaaagca tgctttgaca ctttttactg 660

atttcgttgc cgtatttgtt cgcattctga taatcatgtt gaaaaattca gctgagaagg 720

gtgagagaca gaagaagaag aggagtgact aaatcataaa gcaccctatg gaataggctt 780

ctcatctaat cctccgtgtt gaactctatt tttaatacaa gttttatttc ttgattccat 840

tgtgaataca tgtgttgata tacgggaagg ttaggtcttt actgtttctg tttcttcggt 900

ggtttttctg atatggaacc tttaaactaa tgac 934

<210> SEQ ID NO: 33

<211> LENGTH: 1127

<212> TYPE: DNA

<213> ORGANISM: Lactuca sativa

<400> SEQENCE: 33

caacgcctta caggcagacg actttcgcat atcggtatag caaacataac attgtctacg 60

ttcagataaa tatcctttgc tcatttcagt tccaaaaact cgaagaagaa gaagaagaga 120

acaatggaag gtttcacatc gttcttcgac tcgcaatctg cctctcgcaa ccgctggagt 180

tatgattctc tcaaaaactt ccgccagatc tcacctctcg ttcaaactca tctcaagcag 240

gtgtacctta cgctatgctg tgctttagtg gcatcggctg ctggggctta ccttcacatt 300

ctatggaata tcggtggcct cctcacaaca atggcttgca tgggaagcat ggtgtggctt 360

ctctcagctc ctccttatca agagcaaaaa agggtggctc ttctgatggc agctgcactt 420

tttgaaggcg cctctattgg tcctctgatt gagctgggca ttaacttcga tccaagcatt 480

gtgtttggcg cttttgtagg ttgtgctgtg gtttttggtt gcttctcagc tgctgccatg 540

ttggcaaggc gcagggagta cttgtacctc gggggccttc tttcatctgg cgtctccctt 600

ctcttctggt tgcactttgc atcctccatt tttggtggtt ccatggctgt tttcaagttt 660

gagttgtatt ttggactctt ggtgtttgtg ggctacatcg tctttgacac ccaagaaatt 720

attgagaagg ctcacttggg tgatatggat tacgttaagc atgcattgac ccttttcaca 780

gattttgtcg ctgtttttgt gcggattctg atcatcatgt taaagaatgc atctgagaag 840

gaagagaaga agaagaagag gagaaactag atttgcttct caacttgtgg tttccataac 900

tccttgtgtt cacctgaaac aagcatgtta atagtttgat acttgcttca ctttagcata 960

ggctgtgatg taatgtcgtg tgacatgcca ttatggctgt gtgattgagc atctagcctt 1020

tttatcttct aaagcttttt tcttaacatt gataaggaaa gttccttgtg ataacattta 1080

agaccatttt aatttctcct ttctcattca aaaaaaaaaa aaaaaaa 1127

<210> SEQ ID NO: 34

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Lactuca sativa

<400> SEQENCE: 34

ccaccgatgt tccataggat gtgaaggtaa gccccaactg cagatgccat gagagcacaa 60

catagtgaga ggtaaacctg tttgagatga gtctgaacta agggagagat ttgacggaaa 120

ttcttgagag aatcgtaggt ccagctgttt ggagaagccg atcgcgattg tgaatcgaag 180

aacgatgaga atgattccat 200

<210> SEQ ID NO: 35

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Lactuca sativa

<400> SEQENCE: 35

ttgggctgtt ggtgtttgtt gggtacatgg tggttgacac ccaagatatc attgaaaagg 60

ctcatcttgg agatttggat tatgtgaaac atgctcttac gcttttcact gatttcattg 120

ctgtttttgt tcgcattctt atcatcatgt tgaagaattc ggctgaaaga gaagagaaga 180

agaagaagag gagggattag 200

<210> SEQ ID NO: 36

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Lactuca sativa

<400> SEQENCE: 36

ctaatccctc ctcttcttct tcttctcttc tctttcagcc gaattcttca acatgatgat 60

aagaatgcga acaaaaacag caatgaaatc agtgaaaagc gtaagagcat gtttcacata 120

atccaaatct ccaagatgag ccttttcaat gatatcttgg gtgtcaacca ccatgtaccc 180

aacaaacacc aacagcccaa 200

<210> SEQ ID NO: 37

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Solanum lycopersicum

<400> SEQENCE: 37

atggaaggtt tcacatcgtt cttcgactcg caatctgcct ctcgcaaccg ctggagttat 60

gattctctca aaaacttccg ccagatctca cctctcgttc aaactcatct caagcaggtg 120

taccttacgc tatgctgtgc tttagtggca tcggctgctg gggcttacct tcacattcta 180

tggaatatcg gtggcctcct 200

<210> SEQ ID NO: 38

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Solanum lycopersicum

<400> SEQENCE: 38

aggaggccac cgatattcca tagaatgtga aggtaagccc cagcagccga tgccactaaa 60

gcacagcata gcgtaaggta cacctgcttg agatgagttt gaacgagagg tgagatctgg 120

cggaagtttt tgagagaatc ataactccag cggttgcgag aggcagattg cgagtcgaag 180

aacgatgtga aaccttccat 200

<210> SEQ ID NO: 39

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Solanum lycopersicum

<400> SEQENCE: 39

ttggactctt ggtgtttgtg ggctacatcg tctttgacac ccaagaaatt attgagaagg 60

ctcacttggg tgatatggat tacgttaagc atgcattgac ccttttcaca gattttgtcg 120

ctgtttttgt gcggattctg atcatcatgt taaagaatgc atctgagaag gaagagaaga 180

agaagaagag gagaaactag 200

<210> SEQ ID NO: 40

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Solanum lycopersicum

<400> SEQENCE: 40

ctagtttctc ctcttcttct tcttctcttc cttctcagat gcattcttta acatgatgat 60

cagaatccgc acaaaaacag cgacaaaatc tgtgaaaagg gtcaatgcat gcttaacgta 120

atccatatca cccaagtgag ccttctcaat aatttcttgg gtgtcaaaga cgatgtagcc 180

cacaaacacc aagagtccaa 200

<210> SEQ ID NO: 41

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Vitis vinifera

<400> SEQENCE: 41

atggaggcgt tctctgcgtt tttcgattca caatcgagct caaggagcgg ttggacctac 60

gattcactca agaatttccg ccagatttct cctgccgttc aaactcatct caagcaggtt 120

tatctctccc tgtgctgtgc cttgattgca tctgctgcag gagcttacct gcatcttctc 180

tggaatattg gtggccttct 200

<210> SEQ ID NO: 42

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Vitis vinifera

<400> SEQENCE: 42

agaaggccac caatattcca gagaagatgc aggtaagctc ctgcagcaga tgcaatcaag 60

gcacagcaca gggagagata aacctgcttg agatgagttt gaacggcagg agaaatctgg 120

cggaaattct tgagtgaatc gtaggtccaa ccgctccttg agctcgattg tgaatcgaaa 180

aacgcagaga acgcctccat 200

<210> SEQ ID NO: 43

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Vitis vinifera

<400> SEQENCE: 43

ttggactgtt ggtgtttgtg ggctacatgg tagtagacac ccaggacata atagagaaag 60

cccatctcgg ggatcgggac tatgtgaaac attctctcct ccttttcact gattttgctg 120

cagtttttgt tcgaatcctg attatcatgt tgaagaactc ggctgaaaag agtgagaaga 180

agaagaaaag gagaaattga 200

<210> SEQ ID NO: 44

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Vitis vinifera

<400> SEQENCE: 44

tcaatttctc cttttcttct tcttctcact cttttcagcc gagttcttca acatgataat 60

caggattcga acaaaaactg cagcaaaatc agtgaaaagg aggagagaat gtttcacata 120

gtcccgatcc ccgagatggg ctttctctat tatgtcctgg gtgtctacta ccatgtagcc 180

cacaaacacc aacagtccaa 200

<210> SEQ ID NO: 45

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Capsicum annuum

<400> SEQENCE: 45

atggagggtt tcacgtcgtt cttcgaatcg caatcggctt ctcgcagtcg ctggaattat 60

gatgctctca aaaacttcca tcagatctct cctcgtgttc aaactcatct caaacaggtc 120

tacctcacac tatgctgtgc tttagtcgca tcagctgctg gggcttacct tcacattctt 180

tggaacatcg gtggcttcct 200

<210> SEQ ID NO: 46

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Capsicum annuum

<400> SEQENCE: 46

aggaagccac cgatgttcca aagaatgtga aggtaagccc cagcagctga tgcgactaaa 60

gcacagcata gtgtgaggta gacctgtttg agatgagttt gaacacgagg agagatctga 120

tggaagtttt tgagagcatc ataattccag cgactgcgag aagccgattg cgattcgaag 180

aacgacgtga aaccctccat 200

<210> SEQ ID NO: 47

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Capsicum annuum

<400> SEQENCE: 47

ttggtttctt ggtgtttgtg ggctacatag tttttgacac ccaagaaatc attgagaagg 60

ctcacttggg tgatatggat tacgtcaagc atgcactcac cctcttcaca gattttgttg 120

cagtctttgt gcggattttg atcatcatgt tgaagaatgc atttgagaag gaagagaaga 180

agaagaagag gagaaactag 200

<210> SEQ ID NO: 48

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Capsicum annuum

<400> SEQENCE: 48

ctagtttctc ctcttcttct tcttctcttc cttctcaaat gcattcttca acatgatgat 60

caaaatccgc acaaagactg caacaaaatc tgtgaagagg gtgagtgcat gcttgacgta 120

atccatatca cccaagtgag ccttctcaat gatttcttgg gtgtcaaaaa ctatgtagcc 180

cacaaacacc aagaaaccaa 200

<210> SEQ ID NO: 49

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Glycine max

<400> SEQENCE: 49

atggactcct tcaattcctt cttcgattca acaaaccgat ggaattacga tactctcaaa 60

aacttccgtc aaatttctcc ggtcgttcag aatcacctca agcaggttta ttttactctg 120

tgtttcgccg tggttgctgc ggctgttggg gcttaccttc atgtcctctt gaacattggg 180

ggttttctta ctacagtggc 200

<210> SEQ ID NO: 50

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Glycine max

<400> SEQENCE: 50

gccactgtag taagaaaacc cccaatgttc aagaggacat gaaggtaagc cccaacagcc 60

gcagcaacca cggcgaaaca cagagtaaaa taaacctgct tgaggtgatt ctgaacgacc 120

ggagaaattt gacggaagtt tttgagagta tcgtaattcc atcggtttgt tgaatcgaag 180

aaggaattga aggagtccat 200

<210> SEQ ID NO: 51

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Glycine max

<400> SEQENCE: 51

ttgggctttt ggtgtttgta ggttacattg tagtagacac ccaagaaata gttgagaggg 60

cacacttggg cgatctggac tatgtaaagc atgccttgac cttgtttacc gatttggttg 120

cagtttttgt ccggattctt gttattatgt tgaagaattc ggctgagagg aatgagaaga 180

aaaagaagag gagagattga 200

<210> SEQ ID NO: 52

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Glycine max

<400> SEQENCE: 52

tcaatctctc ctcttctttt tcttctcatt cctctcagcc gaattcttca acataataac 60

aagaatccgg acaaaaactg caaccaaatc ggtaaacaag gtcaaggcat gctttacata 120

gtccagatcg cccaagtgtg ccctctcaac tatttcttgg gtgtctacta caatgtaacc 180

tacaaacacc aaaagcccaa 200

<210> SEQ ID NO: 53

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 53

atggacgcgt tctactcgac ctcctcgtcg tcgtcgtcct cggggccgta cggcgcggcg 60

gcgtacggcg gcagcggctg gggctacgac tcgctcaaga acttccgcca gatcagcccc 120

gccgtccaga cccacctcaa gctcgtttac ctgaccctct gcgtggcgct ggcctcgtcg 180

gcgctgggcg cttacctgca 200

<210> SEQ ID NO: 54

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 54

tgcaggtaag cgcccagcgc cgacgaggcc agcgccacgc agagggtcag gtaaacgagc 60

ttgaggtggg tctggacggc ggggctgatc tggcggaagt tcttgagcga gtcgtagccc 120

cagccgctgc cgccgtacgc cgccgcgccg tacggccccg aggacgacga cgacgaggag 180

gtcgagtaga acgcgtccat 200

<210> SEQ ID NO: 55

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 55

ggctgcttat cttcctggga tacatggtgt acgacacgca ggagatcatc gagagggcgc 60

accacggcga catggactac atcaagcacg ccctcaccct cttcaccgac ttcgtggctg 120

tccttgtccg catcctcgtc atcatgctca agaacgcggc tgacaagtcg gaggacaaga 180

agaggaagaa gaggtcgtga 200

<210> SEQ ID NO: 56

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Sorghum bicolor

<400> SEQENCE: 56

tcacgacctc ttcttcctct tcttgtcctc cgacttgtca gccgcgttct tgagcatgat 60

gacgaggatg cggacaagga cagccacgaa gtcggtgaag agggtgaggg cgtgcttgat 120

gtagtccatg tcgccgtggt gcgccctctc gatgatctcc tgcgtgtcgt acaccatgta 180

tcccaggaag ataagcagcc 200

<210> SEQ ID NO: 57

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Zea mays

<400> SEQENCE: 57

atggacgcgt tcttctcggc ctcctccgcg tcggcgccct acggctacgg cgccggcgga 60

tggagctacg actcgctcaa gaacttccgc cagatcaccc ccgccgtcca gacccacctc 120

aagctcgtct acctcaccct gtgcgcggcg ctggcctcgt cggcggtggg cgcttacctg 180

cacgtggtct ggaacatcgg 200

<210> SEQ ID NO: 58

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Zea mays

<400> SEQENCE: 58

ccgatgttcc agaccacgtg caggtaagcg cccaccgccg acgaggccag cgccgcgcac 60

agggtgaggt agacgagctt gaggtgggtc tggacggcgg gggtgatctg gcggaagttc 120

ttgagcgagt cgtagctcca tccgccggcg ccgtagccgt agggcgccga cgcggaggag 180

gccgagaaga acgcgtccat 200

<210> SEQ ID NO: 59

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Zea mays

<400> SEQENCE: 59

ggctgctcat cttcctgggc tacgtggtgt acgacacgca ggagatcatc gagagggcgc 60

accgcggcga catggaccac gtcaagcacg ccctcaccct cttcacagac ttcgtggccg 120

tcctcgtccg cgtcctcgtc atcatgctca agaacggggc cgacaagtcg gaggacaaga 180

agaggaagaa gaggtcgtga 200

<210> SEQ ID NO: 60

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Zea mays

<400> SEQENCE: 60

tcacgacctc ttcttcctct tcttgtcctc cgacttgtcg gccccgttct tgagcatgat 60

gacgaggacg cggacgagga cggccacgaa gtctgtgaag agggtgaggg cgtgcttgac 120

gtggtccatg tcgccgcggt gcgccctctc gatgatctcc tgcgtgtcgt acaccacgta 180

gcccaggaag atgagcagcc 200

<210> SEQ ID NO: 61

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Triticum aestivum

<400> SEQENCE: 61

atggacgcct tctactcgac ctcgtcggcg gcggccagcg gatggggcta cgactccctc 60

aagaacttcc gcgagatctc ccccgccgtg cagtcccacc tcaagctcgt ttacctgacc 120

ctatgctttg ccctggcctc atctgccgtg ggtgcttacc tgcacattgc cctgaacatt 180

ggcgggatgc tgacaatgct 200

<210> SEQ ID NO: 62

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Triticum aestivum

<400> SEQENCE: 62

agcattgtca gcatcccgcc aatgttcagg gcaatgtgca ggtaagcacc cacggcagat 60

gaggccaggg caaagcatag ggtcaggtaa acgagcttga ggtgggactg cacggcgggg 120

gagatctcgc ggaagttctt gagggagtcg tagccccatc cgctggccgc cgccgacgag 180

gtcgagtaga aggcgtccat 200

<210> SEQ ID NO: 63

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Triticum aestivum

<400> SEQENCE: 63

tgttgatctt cctggggtac atggtgtacg acacgcagga gatcatcgag agggcgcacc 60

acggtgacat ggactacatc aagcacgcgc tcaccctctt caccgacttc gtcgccgtcc 120

tcgtccgcat cctcatcatc atgctcaaga acgcaggcga caagtcggag gacaagaaga 180

agaggaagag gaggtcctga 200

<210> SEQ ID NO: 64

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: TRiticum aestivum

<400> SEQENCE: 64

tcaggacctc ctcttcctct tcttcttgtc ctccgacttg tcgcctgcgt tcttgagcat 60

gatgatgagg atgcggacga ggacggcgac gaagtcggtg aagagggtga gcgcgtgctt 120

gatgtagtcc atgtcaccgt ggtgcgccct ctcgatgatc tcctgcgtgt cgtacaccat 180

gtaccccagg aagatcaaca 200

<210> SEQ ID NO: 65

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Triticum aestivum

<400> SEQENCE: 65

atggacgcct tctactcgac ctcgtcggcg gcggcgagcg gctggggcta cgactccctc 60

aagaacttcc gcgagatctc ccccgccgtg cagtcccacc tcaagctcgt ttacctgacc 120

ctatgctttg ccctggcctc atctgccgtg ggtgcttacc tgcacattgc cctgaacatc 180

ggtgggatgc tgacaatgct 200

<210> SEQ ID NO: 66

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Triticum aestivum

<400> SEQENCE: 66

agcattgtca gcatcccacc gatgttcagg gcaatgtgca ggtaagcacc cacggcagat 60

gaggccaggg caaagcatag ggtcaggtaa acgagcttga ggtgggactg cacggcgggg 120

gagatctcgc ggaagttctt gagggagtcg tagccccagc cgctcgccgc cgccgacgag 180

gtcgagtaga aggcgtccat 200

<210> SEQ ID NO: 67

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Triticum aestivum

<400> SEQENCE: 67

tgttgatctt tctgggatac atggtgtacg acacgcagga gatcatcgag agggcgcacc 60

acggcgacat ggactacatc aagcacgcgc tcaccctctt caccgacttt gtcgccgtcc 120

tcgtccggat cctcatcatc atgctcaaga acgcaggcga caagtcggag gacaagaaga 180

agaggaagag gaggtcctga 200

<210> SEQ ID NO: 68

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Triticum aestivum

<400> SEQENCE: 68

tcaggacctc ctcttcctct tcttcttgtc ctccgacttg tcgcctgcgt tcttgagcat 60

gatgatgagg atccggacga ggacggcgac aaagtcggtg aagagggtga gcgcgtgctt 120

gatgtagtcc atgtcgccgt ggtgcgccct ctcgatgatc tcctgcgtgt cgtacaccat 180

gtatcccaga aagatcaaca 200

<210> SEQ ID NO: 69

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Glycine max

<400> SEQENCE: 69

atggacactt tcttcaagtc cccatcgtct tcttcttcta gaagcagctg gagttacgat 60

actctcaaga atttccgcga gatctctccg ctcgttcaga atcacatcaa actggtttat 120

tttacgttat gttgcgctgt ggtggctgct gctgttggag ccttccttca tgttctgtgg 180

aacattggcg gttttctcac 200

<210> SEQ ID NO: 70

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Glycine max

<400> SEQENCE: 70

gtgagaaaac cgccaatgtt ccacagaaca tgaaggaagg ctccaacagc agcagccacc 60

acagcgcaac ataacgtaaa ataaaccagt ttgatgtgat tctgaacgag cggagagatc 120

tcgcggaaat tcttgagagt atcgtaactc cagctgcttc tagaagaaga agacgatggg 180

gacttgaaga aagtgtccat 200

<210> SEQ ID NO: 71

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Glycine max

<400> SEQENCE: 71

actttgggct tttggtgttt gtgggctacg ttatagtaga cactcaagta atcattgaga 60

gggctcactt tggtgacctg gattatgtta agcatgcatt gacactgttc actgatttgg 120

ctgcaatctt tgtgcgaatt cttaatataa tgttgaataa ttcatctaag agaaatgaga 180

agaagaggag gagagattaa 200

<210> SEQ ID NO: 72

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Glycine max

<400> SEQENCE: 72

ttaatctctc ctcctcttct tctcatttct cttagatgaa ttattcaaca ttatattaag 60

aattcgcaca aagattgcag ccaaatcagt gaacagtgtc aatgcatgct taacataatc 120

caggtcacca aagtgagccc tctcaatgat tacttgagtg tctactataa cgtagcccac 180

aaacaccaaa agcccaaagt 200

<210> SEQ ID NO: 73

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 73

atggacgcct tctactcgac ctcgtcggcg gcggcgagcg gctggggcca cgactccctc 60

aagaacttcc gccagatctc ccccgccgtg cagtcccacc tcaagctcgt ttacctgact 120

ctatgctttg cactggcctc atctgccgtg ggtgcttacc tacacattgc cctgaacatc 180

ggcgggatgc tgacaatgct 200

<210> SEQ ID NO: 74

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 74

agcattgtca gcatcccgcc gatgttcagg gcaatgtgta ggtaagcacc cacggcagat 60

gaggccagtg caaagcatag agtcaggtaa acgagcttga ggtgggactg cacggcgggg 120

gagatctggc ggaagttctt gagggagtcg tggccccagc cgctcgccgc cgccgacgag 180

gtcgagtaga aggcgtccat 200

<210> SEQ ID NO: 75

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 75

tgttgatctt cctggggtac atggtgtacg acacgcagga gatcatcgag agggcgcacc 60

atggcgacat ggactacatc aagcacgccc tcaccctctt caccgacttt gttgccgtcc 120

tcgtccgagt cctcatcatc atgctcaaga acgcaggcga caagtcggag gacaagaaga 180

agaggaagag gaggtcctga 200

<210> SEQ ID NO: 76

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 76

tcaggacctc ctcttcctct tcttcttgtc ctccgacttg tcgcctgcgt tcttgagcat 60

gatgatgagg actcggacga ggacggcaac aaagtcggtg aagagggtga gggcgtgctt 120

gatgtagtcc atgtcgccat ggtgcgccct ctcgatgatc tcctgcgtgt cgtacaccat 180

gtaccccagg aagatcaaca 200

<210> SEQ ID NO: 77

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Oryza sativa

<400> SEQENCE: 77

atggacgcct tctactcgac ctcgtcggcg tacggagcgg cggcgagcgg ctggggctac 60

gactcgctga agaacttccg ccagatctcc cccgccgtcc agtcccacct caagctcgtt 120

tacctgacac tatgcgtcgc cctggctgcg tcggcggtgg gcgcatacct gcacgtcgcc 180

ttgaacatcg gcgggatgtt 200

<210> SEQ ID NO: 78

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Oryza sativa

<400> SEQENCE: 78

aacatcccgc cgatgttcaa ggcgacgtgc aggtatgcgc ccaccgccga cgcagccagg 60

gcgacgcata gtgtcaggta aacgagcttg aggtgggact ggacggcggg ggagatctgg 120

cggaagttct tcagcgagtc gtagccccag ccgctcgccg ccgctccgta cgccgacgag 180

gtcgagtaga aggcgtccat 200

<210> SEQ ID NO: 79

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Oryza sativa

<400> SEQENCE: 79

gcctgttgat cttcctgggg tacatggtgt atgacacgca ggagatcatc gagagggctc 60

accacggtga catggactac atcaagcacg cactcaccct cttcactgac ttcgtggccg 120

tccttgtccg gatcctcgtc atcatgctca agaacgcgtc tgacaagtcg gaggagaaga 180

agaggaagaa gaggtcttga 200

<210> SEQ ID NO: 80

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Oryza sativa

<400> SEQENCE: 80

tcaagacctc ttcttcctct tcttctcctc cgacttgtca gacgcgttct tgagcatgat 60

gacgaggatc cggacaagga cggccacgaa gtcagtgaag agggtgagtg cgtgcttgat 120

gtagtccatg tcaccgtggt gagccctctc gatgatctcc tgcgtgtcat acaccatgta 180

ccccaggaag atcaacaggc 200

<210> SEQ ID NO: 81

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Cucumis sativus

<400> SEQENCE: 81

atggacgcat tctcttcttt cttcgattct caatctggat ccagaacccg ctggagtcat 60

gaatctctca agaacttccg gcagatttcg cccgccgttc aatctcatct tcagcgggtt 120

tatctcactc ttggttgtgc tttggttgca tctgctgctg gagcttatct gcatatactt 180

tggaatattg gtggttttct 200

<210> SEQ ID NO: 82

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Cucumis sativus

<400> SEQENCE: 82

agaaaaccac caatattcca aagtatatgc agataagctc cagcagcaga tgcaaccaaa 60

gcacaaccaa gagtgagata aacccgctga agatgagatt gaacggcggg cgaaatctgc 120

cggaagttct tgagagattc atgactccag cgggttctgg atccagattg agaatcgaag 180

aaagaagaga atgcgtccat 200

<210> SEQ ID NO: 83

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Cucumis sativus

<400> SEQENCE: 83

tgttggtttt tgttggctac atggtagttg atactcagga aataattgag atggcacata 60

tgggtgatat ggattatgtg aaacatgcat taactctctt cactgatttc attgcggtgt 120

ttgtccgaat tctcattata atgctaaaga actctgctga gaagaacgag agggagagga 180

agaagaagag gagggactga 200

<210> SEQ ID NO: 84

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Cucumis sativus

<400> SEQENCE: 84

tcagtccctc ctcttcttct tcctctccct ctcgttcttc tcagcagagt tctttagcat 60

tataatgaga attcggacaa acaccgcaat gaaatcagtg aagagagtta atgcatgttt 120

cacataatcc atatcaccca tatgtgccat ctcaattatt tcctgagtat caactaccat 180

gtagccaaca aaaaccaaca 200

<210> SEQ ID NO: 85

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Cucumis sativus

<400> SEQENCE: 85

atggatgcct tttcatcttt cttcgattct caacaacctt ctacaaaccc ttggacctac 60

gattctctca agaatttccg gcagatttcc cccgtcgttc aatctcatct ccaccaggtt 120

taccttactc tgggttgtgc tttggttgca tctgctgctg gagcttatct ccatattctg 180

tggaacattg gcggaatcct 200

<210> SEQ ID NO: 86

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Cucumis sativus

<400> SEQENCE: 86

aggattccgc caatgttcca cagaatatgg agataagctc cagcagcaga tgcaaccaaa 60

gcacaaccca gagtaaggta aacctggtgg agatgagatt gaacgacggg ggaaatctgc 120

cggaaattct tgagagaatc gtaggtccaa gggtttgtag aaggttgttg agaatcgaag 180

aaagatgaaa aggcatccat 200

<210> SEQ ID NO: 87

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Cucumis sativus

<400> SEQENCE: 87

ggctattgct gtttgtgggc tacatggtag ttgatactca agaaataatc gagagggctc 60

atcttggtga tatggactat gtgaagcatg ccctgactct tttcactgat ttcgttggtg 120

ttttcgtccg acttctcatt attatggtaa ggaactcggt agagaagaat gaggagaaaa 180

agaagaagag gagggactaa 200

<210> SEQ ID NO: 88

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Cucumis sativus

<400> SEQENCE: 88

ttagtccctc ctcttcttct ttttctcctc attcttctct accgagttcc ttaccataat 60

aatgagaagt cggacgaaaa caccaacgaa atcagtgaaa agagtcaggg catgcttcac 120

atagtccata tcaccaagat gagccctctc gattatttct tgagtatcaa ctaccatgta 180

gcccacaaac agcaatagcc 200

<210> SEQ ID NO: 89

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Gossypium hirsutum

<400> SEQENCE: 89

atgggcacgt tctcgtcttt cttcgattct caatcgagaa gccagtggaa ttacaacact 60

ctcaagaatt tccgtcagat ctctccgatt gttcaaacgc atctcaaaaa ggtttatatg 120

accctatgtt gtatgcttgt tgcctctgcc tttggggctt atcttcatat aatttggaac 180

attgggggtt acctcacgac 200

<210> SEQ ID NO: 90

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Gossypium hirsutum

<400> SEQENCE: 90

gtcgtgaggt aacccccaat gttccaaatt atatgaagat aagccccaaa ggcagaggca 60

acaagcatac aacatagggt catataaacc tttttgagat gcgtttgaac aatcggagag 120

atctgacgga aattcttgag agtgttgtaa ttccactggc ttctcgattg agaatcgaag 180

aaagacgaga acgtgcccat 200

<210> SEQ ID NO: 91

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Gossypium hirsutum

<400> SEQENCE: 91

ggctcttggt gtttgttggc tacatggtag tggacacaca agacataatt gagaaggcac 60

acttgggtga tctggattat gtaaagcatg ctttgacact ttttactgat ttcgttgccg 120

tatttgttcg cattctgata atcatgttga aaaattcagc tgagaagggt gagagacaga 180

agaagaagag gagtgactaa 200

<210> SEQ ID NO: 92

<211> LENGTH: 200

<212> TYPE: DNA

<213> ORGANISM: Gossypium hirsutum

<400> SEQENCE: 92

ttagtcactc ctcttcttct tctgtctctc acccttctca gctgaatttt tcaacatgat 60

tatcagaatg cgaacaaata cggcaacgaa atcagtaaaa agtgtcaaag catgctttac 120

ataatccaga tcacccaagt gtgccttctc aattatgtct tgtgtgtcca ctaccatgta 180

gccaacaaac accaagagcc 200

<210> SEQ ID NO: 93

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 93

tcagggcaat gtgtaggtaa gcacc 25

<210> SEQ ID NO: 94

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 94

agcattgtca gcatcccgcc gatgt 25

<210> SEQ ID NO: 95

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 95

caatcagagg tccaaccgaa gcccc 25

<210> SEQ ID NO: 96

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 96

caatcagagg tccaaccgaa gcccc 25

<210> SEQ ID NO: 97

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 97

cttgggtcaa agtctatggc aagct 25

<210> SEQ ID NO: 98

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 98

tccgacaaac cctgtcacga ggatg 25

<210> SEQ ID NO: 99

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 99

agaagcaccc aaaggcgatg gcggt 25

<210> SEQ ID NO: 100

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 100

cgcttggcga tgatggcggc gccag 25

<210> SEQ ID NO: 101

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 101

gccaccgagg tacaggtact ccctg 25

<210> SEQ ID NO: 102

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 102

ggatcgacag gccagacgag agcag 25

<210> SEQ ID NO: 103

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 103

gacgtgacaa actgcagcca gagca 25

<210> SEQ ID NO: 104

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 104

gctgccagag gagtggccaa agatg 25

<210> SEQ ID NO: 105

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 105

ggccaaagta aacctcaaac atgaa 25

<210> SEQ ID NO: 106

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 106

accatgtacc ccaggaagat caaca 25

<210> SEQ ID NO: 107

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 107

ctcgatgatc tcctgcgtgt cgtac 25

<210> SEQ ID NO: 108

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 108

ccacctgggc ctctccagca cccc 24

<210> SEQ ID NO: 109

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 109

ggggtgctgg agaggcccag gtgg 24

<210> SEQ ID NO: 110

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 110

gaccccctct tcctcttctt cttg 24

<210> SEQ ID NO: 111

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 111

cgttcttgag catgatgatg agga 24

<210> SEQ ID NO: 112

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 112

gcaacaaagt cggtgaagag g 21

<210> SEQ ID NO: 113

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 113

gtcagcatcc cgccgatgtt cag 23

<210> SEQ ID NO: 114

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 114

ccacggcaga tgaggccagt gca 23

<210> SEQ ID NO: 115

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 115

taaacgagct tgaggtggga ctg 23

<210> SEQ ID NO: 116

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 116

aactgcagcc agagcaggat cg 22

<210> SEQ ID NO: 117

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 117

agcaggccac cgaggtacag gt 22

<210> SEQ ID NO: 118

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 118

ggcggcgcca gagaagcacc c 21

<210> SEQ ID NO: 119

<211> LENGTH: 150

<212> TYPE: RNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 119

auggacgccu ucuacucgac cucgucggcg gcggcgagcg gcuggggcca cgacucccuc 60

aagaacuucc gccagaucuc ccccgccgug cagucccacc ucaagcucgu uuaccugacu 120

cuaugcuuug cacuggccuc aucugccgug 150

<210> SEQ ID NO: 120

<211> LENGTH: 150

<212> TYPE: RNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 120

agggcgcacc auggcgacau ggacuacauc aagcacgccc ucacccucuu caccgacuuu 60

guugccgucc ucguccgagu ccucaucauc augcucaaga acgcaggcga caagucggag 120

gacaagaaga agaggaagag gggguccuga 150

<210> SEQ ID NO: 121

<211> LENGTH: 150

<212> TYPE: RNA

<213> ORGANISM: Hordeum vulgare

<400> SEQENCE: 121

cgcuuguguc ggaacuaucg ccuggauguu cucggugcca gucuaugagg agaggaagag 60

guuugggcug cugaugggug cagcccuccu ggaaggggcu ucgguuggac cucugauuga 120

gcuugccaua gacuuugacc caagcauccu 150

<210> SEQ ID NO: 122

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 122

ttgaatcgaa gaaggaattg aaggagtcca t 31

<210> SEQ ID NO: 123

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 123

aggtaagccc caacagccgc agcaacca 28

<210> SEQ ID NO: 124

<211> LENGTH: 29

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 124

ctcttttcct ctcttcaaaa ggaggtgtc 29

<210> SEQ ID NO: 125

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 125

tgcactaaag ataaggcttg gatcgat 27

<210> SEQ ID NO: 126

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 126

atccagaaga aaccaagcca ccaaggt 27

<210> SEQ ID NO: 127

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 127

cctacaaaca ccaaaagccc aaagtac 27

<210> SEQ ID NO: 128

<211> LENGTH: 29

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 128

actgcaacca aatcggtaaa caaggtcaa 29

<210> SEQ ID NO: 129

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 129

tcaatctctc ctcttctttt tcttc 25

<210> SEQ ID NO: 130

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 130

tcaagggacc aacgaaggct aatttcg 27

<210> SEQ ID NO: 131

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 131

ggctttgaat ttcaacaccc ctaatt 26

<210> SEQ ID NO: 132

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 132

gcttgcaatc ggagaaacac aaattt 26

<210> SEQ ID NO: 133

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 133

atggggactt gaagaaagtg tccat 25

<210> SEQ ID NO: 134

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 134

taaaataaac cagtttgatg tgattctg 28

<210> SEQ ID NO: 135

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 135

tgctcccaat ggaagccacc gtggtga 27

<210> SEQ ID NO: 136

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 136

aatcagaggt ccaatggaag caccctga 28

<210> SEQ ID NO: 137

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 137

gccttgcaac taaggctact gcagaaaa 28

<210> SEQ ID NO: 138

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 138

agagctatag agcccccaaa gagagagg 28

<210> SEQ ID NO: 139

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 139

tccaggtcac caaagtgagc cctctca 27

<210> SEQ ID NO: 140

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 140

cttctcattt ctcttagatg aattatt 27

<210> SEQ ID NO: 141

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic

<400> SEQENCE: 141

gttgtagttg tactccatct tattg 25

<210> SEQ ID NO: 142

<211> LENGTH: 200

<212> TYPE: RNA

<213> ORGANISM: Cucumber

<400> SEQENCE: 142

acuaucggau guauuacaug gcuaauggcc acuccuccuu augaagagaa aaagagggcc 60

ucuauuuuac uuggggcugc ucuucucgaa ggggcuucca uugguccuuu gaucagucug 120

gcuauugauu uugacccaag uguucuggug agcgcuuucg ugggaacugc gguugccuuu 180

uguuguuucu caggagcagc 200

<210> SEQ ID NO: 143

<211> LENGTH: 200

<212> TYPE: RNA

<213> ORGANISM: Cucumber

<400> SEQENCE: 143

cuuuaucucg guggcuuacu uucuuccggu guauccaugu uacucugguu acauuucgcc 60

uccucuuuau ucggugguuc uacugcccuu uucaaguuug aguuguacuu ugggcuguug 120

guuuuuguug gcuacauggu aguugauacu caggaaauaa uugagauggc acauaugggu 180

gauauggauu augugaaaca 200

<210> SEQ ID NO: 144

<211> LENGTH: 200

<212> TYPE: RNA

<213> ORGANISM: Cucumber

<400> SEQENCE: 144

auggaugccu uuucaucuuu cuucgauucu caacaaccuu cuacaaaccc uuggaccuac 60

gauucucuca agaauuuccg gcagauuucc cccgucguuc aaucucaucu ccaccagguu 120

uaccuuacuc uggguugugc uuugguugca ucugcugcug gagcuuaucu ccauauucug 180

uggaacauug gcggaauccu 200

<210> SEQ ID NO: 145

<211> LENGTH: 200

<212> TYPE: RNA

<213> ORGANISM: Cucumber

<400> SEQENCE: 145

auuggaugca ucacauggcu aauggccacu ccuccuuaug aagagagaaa gaggcuuucu 60

auguuaaugg cggcugcucu ucuugaagga gcaucaauug guccuuugau uggguuggcu 120

aucgagauug auccaagugu ucuggucagu gccuuugugg gaacugcugu ggcuuuuggu 180

uguuucucug cagcagccau 200

<210> SEQ ID NO: 146

<211> LENGTH: 200

<212> TYPE: RNA

<213> ORGANISM: Cucumber

<400> SEQENCE: 146

cuuuaccugg guggcuuacu uucuucuggg auauccaugu uacucugguu gcauuucgcu 60

ucaucuauau ucggugguuc uacugcucuu uucaaguuug aguuguacuu ugggcuauug 120

cuguuugugg gcuacauggu aguugauacu caagaaauaa ucgagagggc ucaucuuggu 180

gauauggacu augugaagca 200

<210> SEQ ID NO: 147

<211> LENGTH: 202

<212> TYPE: RNA

<213> ORGANISM: Aqueoria victoria

<400> SEQENCE: 147

guucgagggc gauacccugg ugaaucgcau cgagcugacc ggcaccgauu ucaaggagga 60

uggcaacauc cugggcaaua agauggagua caacuacaac gcccacaaug uguacaucau 120

gaccgacaag gccaagaaug gcaucaaggu gaacuucaag auccgccaca acaucgagga 180

uggcagcgug cagcuggccg ac 202

Read more
PatSnap Solutions

Great research starts with great data.

Use the most comprehensive innovation intelligence platform to maximise ROI on research.

Learn More

Patent Valuation

$

Reveal the value <>

25.0/100 Score

Market Attractiveness

It shows from an IP point of view how many competitors are active and innovations are made in the different technical fields of the company. On a company level, the market attractiveness is often also an indicator of how diversified a company is. Here we look into the commercial relevance of the market.

27.0/100 Score

Market Coverage

It shows the sizes of the market that is covered with the IP and in how many countries the IP guarantees protection. It reflects a market size that is potentially addressable with the invented technology/formulation with a legal protection which also includes a freedom to operate. Here we look into the size of the impacted market.

74.0/100 Score

Technology Quality

It shows the degree of innovation that can be derived from a company’s IP. Here we look into ease of detection, ability to design around and significance of the patented feature to the product/service.

65.0/100 Score

Assignee Score

It takes the R&D behavior of the company itself into account that results in IP. During the invention phase, larger companies are considered to assign a higher R&D budget on a certain technology field, these companies have a better influence on their market, on what is marketable and what might lead to a standard.

21.0/100 Score

Legal Score

It shows the legal strength of IP in terms of its degree of protecting effect. Here we look into claim scope, claim breadth, claim quality, stability and priority.

Citation

Patents Cited in This Cited by
Title Current Assignee Application Date Publication Date
Method for facilitating pathogen resistance THE UNIVERSITY OF QUEENSLAND,THE STATE OF QUEENSLAND ACTING THROUGH ITS DEPARTMENT OF EMPLOYMENT, ECONOMIC DEVELOPMENT & INNOVATION 07 November 2002 07 August 2003
Sugarbeet regeneration and transformation MONSANTO TECHNOLOGY LLC 06 December 2000 15 November 2001
Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA MEDICAL COLLEGE OF GEORGIA RESEARCH INSTITUTE, INC. 04 January 2002 22 August 2002
Method for modifying plant biomass MENDEL BIOTECHNOLOGY, INC. 30 March 2001 04 September 2003
Short interfering nucleic acid hybrids and methods thereof REGENTS OF THE UNIVERSITY OF CALIFORNIA, THE 08 April 2003 18 March 2004
See full citation <>

More Patents & Intellectual Property

PatSnap Solutions

PatSnap solutions are used by R&D teams, legal and IP professionals, those in business intelligence and strategic planning roles and by research staff at academic institutions globally.

PatSnap Solutions
Search & Analyze
The widest range of IP search tools makes getting the right answers and asking the right questions easier than ever. One click analysis extracts meaningful information on competitors and technology trends from IP data.
Business Intelligence
Gain powerful insights into future technology changes, market shifts and competitor strategies.
Workflow
Manage IP-related processes across multiple teams and departments with integrated collaboration and workflow tools.
Contact Sales
Clsoe
US10000767 Methods compositions plant 1 US10000767 Methods compositions plant 2 US10000767 Methods compositions plant 3