Great research starts with great data.

Learn More
More >
Patent Analysis of

Methods of detecting cervical cancer

Updated Time 12 June 2019

Patent Registration Data

Publication Number

US10000808

Application Number

US14/445417

Application Date

29 July 2014

Publication Date

19 June 2018

Current Assignee

CEPHEID

Original Assignee (Applicant)

CEPHEID

International Classification

C12Q1/68

Cooperative Classification

C12Q1/6883,C12Q1/6886,C12Q2600/118,C12Q2600/16,C12Q2600/178

Inventor

BARRIE, CECILIA SVANHOLM,DELFOUR, OLIVIER,PERSING, DAVID H.

Patent Images

This patent contains figures and images illustrating the invention and its embodiment.

US10000808 Methods detecting cervical cancer 1 US10000808 Methods detecting cervical cancer 2 US10000808 Methods detecting cervical cancer 3
See all images <>

Abstract

Methods of detecting cervical dysplasia, such as cervical dysplasia likely to progress to carcinoma in a sample of human cervical cells, are provided. Methods of detecting changes in expression of one or more microRNAs or mRNAs associated with cervical dysplasia or cervical cancer are also provided. Compositions and kits are also provided.

Read more

Claims

1. A method comprising:detecting a level of at least one target RNA in a cervical sample from a human subject, wherein at least one target RNA is miR-1290, wherein miR-1290 comprises the sequence of SEQ ID NO.: 390, wherein the detecting comprises:(i) hybridizing nucleic acids derived from the sample with at least one polynucleotide comprising a sequence that is identical or fully complementary to at least 15 contiguous nucleotides of SEQ ID NO: 209; and(ii) detecting the presence of a complex comprising the polynucleotide hybridized to at least one nucleic acid selected from miR-1290 RNA, a DNA amplicon of miR-1290 RNA, and a complement of miR-1290 RNA; and wherein the at least one target RNA consists of 1 to 8 target RNAs.

2. The method of claim 1, wherein the at least one polynucleotide comprises the sequence SEQ ID NO: 209.

3. The method of claim 1, wherein the method further comprises isolating nucleic acids from the cervical sample.

4. The method of claim 3, wherein the nucleic acids comprise RNA that has been separated from DNA.

5. The method of claim 1, wherein the detecting miR-1290 in the sample is performed using real-time quantitative RT-PCR.

6. The method of claim 1, wherein the cervical sample is a sample of cervical cells obtained by routine Pap smear.

Read more

Claim Tree

  • 1
    1. A method comprising:
    • detecting a level of at least one target RNA in a cervical sample from a human subject, wherein at least one target RNA is miR-1290, wherein miR-1290 comprises the sequence of SEQ ID NO.: 390, wherein the detecting comprises:(i) hybridizing nucleic acids derived from the sample with at least one polynucleotide comprising a sequence that is identical or fully complementary to at least 15 contiguous nucleotides of SEQ ID NO: 209
    • and(ii) detecting the presence of a complex comprising the polynucleotide hybridized to at least one nucleic acid selected from miR-1290 RNA, a DNA amplicon of miR-1290 RNA, and a complement of miR-1290 RNA
    • and wherein the at least one target RNA consists of 1 to 8 target RNAs.
    • 2. The method of claim 1, wherein
      • the at least one polynucleotide comprises
    • 3. The method of claim 1, wherein
      • the method further comprises
    • 5. The method of claim 1, wherein
      • the detecting miR-1290 in the sample is performed using real-time quantitative RT-PCR.
    • 6. The method of claim 1, wherein
      • the cervical sample is a sample of cervical cells obtained by routine Pap smear.
See all independent claims <>

Description

1. BACKGROUND

Cervical cancer is the second most common cause of cancer-related mortality in women worldwide. Epidemiological and laboratory studies suggest a key role for human papillomavirus (HPV) in cervical carcinogenesis (Walboomers, J. M. et al. (1999) J. Pathol. 189:12-19; Zur, H. H. (2002) Nat. Rev. Cancer 2:342-350). Importantly, however, HPV infection alone is not sufficient for cervical carcinogenesis, and additional steps occur over years or decades following initial infection. Most HPV infections resolve spontaneously, but if an oncogenic (high risk) HPV infection persists, there may be progression to a high grade cervical dysplasia or cervical cancer. (Nobbenhuis, M. A. et al. (2001) Lancet 358:1782-1783). High risk HPVs include HPV-16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68, with HPV-16 and 18 accounting for up to 70% of cervical cancers worldwide.

The Papanicolaou (Pap) smear has become the most commonly used method to screen for cervical dysplasia. It has been a success and the incidence of cervical cancer has been dramatically reduced. However, cytology screening programs have limitations, especially limited sensitivity, estimated at only 51% (Nanda K. et al. (2000) Ann. Intern. Med. 132:810-819), and repeated tests are therefore necessary. In addition, a high-quality cytology screening program requires highly-trained personnel. Furthermore, although cytological screening programs have reduced the incidence of squamous cervical cancer (SCC), the incidence of cervical adenocarcinoma (AC) has continued to increase. The reason for this is unclear, but it may, in part, be due to difficulties detecting the precursor form of AC using conventional screening methods. (Bray, F. B. et al. (2005) Cancer Epidemiol. Biomarkers Prev. 14:2191-2199).

HPV DNA testing can be more sensitive than cytologic testing in detecting high-grade cervical dysplasia. However, HPV testing often has lower specificity than cytologic testing since most HPV infections are transient in nature. (Koliopoulous, G. M. et al. (2007) Gynecol. Oncol. 104:232-246). In order to improve the clinical specificity of the molecular HPV tests, a number of molecular markers associated with cervical cancer precursor lesions (i.e. Cervical Intra-epithelial Neoplasia (“CIN”) grades 1, 2 and 3) have been evaluated. (See e.g., Altieri D. C. (2003) Nat Rev. Cancer 3:46-54; Li C. et al. (2007) Mod. Pathol. 20:242-247; Andersson, S. et al. (2006) Br. J. Cancer 95:331-338; Martin, C. M. et al. (2006) Expert Rev. Mol. Diagn. 6:217-229; Branca, M. et al. (2006) Int. J. Gynecol. Pathol. 25:383-392; Harris C. P. et al. (2003) Genes Chromosomes Cancer 36:233-241). However, there remains a need for molecular markers in cervical dysplasia which indicate a high risk of progression to cancer.

2. SUMMARY

Methods for detecting the presence of cervical dysplasia in a subject are provided. In some embodiments, a method comprises detecting a level of at least one target RNA in a cervical sample from the subject. In some embodiments, the at least one target RNA (i) is capable of specifically hybridizing to a nucleic acid having a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211; or (ii) comprises a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211; or (iii) comprises at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. In some embodiments, a method comprises comparing the level of the at least one target RNA in the cervical sample to a normal level of the at least one target RNA. In some embodiments, a level of at least one target RNA in the sample that is greater than a normal level of the at least one target RNA indicates the presence of cervical dysplasia in the sample.

Methods for facilitating the detection of cervical dysplasia in a subject are also provided. In some embodiments, the method comprises detecting a level of at least one target RNA in a cervical sample from the subject. In some embodiments, the at least one target RNA (i) is capable of specifically hybridizing to a nucleic acid having a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211; or (ii) comprises a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211; or (iii) comprises at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. In some embodiments, a method comprises communicating the results of the detection to a medical practitioner for the purpose of determining whether the subject has cervical dysplasia.

In some embodiments, detecting a level of at least one target RNA in a cervical sample comprises hybridizing nucleic acids of the sample with at least one polynucleotide that is complementary to a target RNA in the sample or to a complement thereof. In some embodiments, a method further comprises detecting at least one complex comprising a polynucleotide hybridized to at least one nucleic acid selected from the target RNA, a DNA amplicon of the target RNA, and a complement of the target RNA.

In some embodiments, a method for detecting the presence of cervical dysplasia in a subject comprises obtaining a cervical sample from the subject and providing the sample to a laboratory for detection of the level of at least one target RNA in the sample. In some embodiments, the at least one target RNA: (i) is capable of specifically hybridizing to a nucleic acid having a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211; or (ii) comprises a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211; or (iii) comprises at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. In some embodiments, the method comprises receiving from the laboratory a communication indicating the level of at least one target RNA in the sample. In some embodiments, a level of at least one target RNA that is greater than a normal level of the at least one target RNA indicates the presence of cervical dysplasia.

In some embodiments, a method comprises detecting levels of at least two, at least three, at least five, or at least ten target RNAs. In some embodiments, detection of a level of at least one target RNA that is greater than a normal level of the at least one target RNA indicates the presence of cervical dysplasia. In some embodiments, detection of levels of at least two target RNAs that are greater than normal levels of the at least two target RNAs indicates the presence of cervical dysplasia. In some embodiments, detection of levels of at least three target RNAs that are greater than normal levels of the at least two target RNAs indicates the presence of cervical dysplasia. In some embodiments, detection of levels of at least five target RNAs that are greater than normal levels of the at least two target RNAs indicates the presence of cervical dysplasia.

In some embodiments, a method comprises detecting a level of at least one target RNA that (i) does not specifically hybridize to a nucleic acid having a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211; and (ii) does not comprise a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211; and (iii) does not comprise at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388.

In some embodiments, a method further comprises detection of a level of at least one target RNA that is an mRNA. In some embodiments, the mRNA is selected from CDKN2A, MKI67, TOP2A, MCM5, BIRC5, MMP9, and MCM2.

In some embodiments, a synthetic polynucleotide is provided. In some embodiments, a synthetic polynucleotide comprises a first region, wherein the first region comprises a sequence of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleotides that is identical or complementary to a sequence of at least 8 contiguous nucleotides of one of SEQ ID NOs: 1 to 7, 9 to 37, 133 to 201, and 345 to 388. In some embodiments, the first region is identical or complementary to a region of a target RNA. In some embodiments, a synthetic polynucleotide comprises a second region that is not identical or complementary to a region of the target RNA. In some embodiments, a synthetic polynucleotide comprises a detectable label. In some embodiments, a synthetic polynucleotide comprises a FRET label. In some embodiments, the synthetic polynucleotide comprises a second region that is not identical or complementary to a region of the target RNA.

In some embodiments, a composition is provided. In some embodiments, a composition comprises a plurality of synthetic polynucleotides. In some embodiments, a kit is provided. In some embodiments, a kit comprises a synthetic polynucleotide. In some embodiments, a kit comprises a composition. In some embodiments, a kit comprises at least one polymerase and/or dNTPs.

Further embodiments and details of the inventions are described below.

3. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows an exemplary electropherogram obtained on an Agilent Bioanalyser 2100 to assess the quality of total RNA purified as described in Example 1. Total RNA from cell line CaSki is shown.

FIG. 2 provides analysis by agarose gel electrophoresis under denaturing conditions of the quality of total RNA purified as described in Example 1 from cell lines CaSki, SW756, ME180, SiHA, C-4I, and C-4II.

FIGS. 3A and 3B show the log 2 fold-changes±SD of certain mRNAs in tumor and normal samples relative to the Ambion normal sample, as discussed in Example 4. For each pair of bars, the left bar represents tumor samples and the right bar represents normal samples.

FIG. 4 shows relative log 2 fold changes of certain mRNAs in liquid PAP samples, as discussed in Example 5.

FIG. 5 shows relative log 2 fold changes±SD of miR-205 in cervical tumor samples and normal tissue, as discussed in Example 6. The left bar represents SCC samples, the middle bar represents ADC samples, and the right bar represents normal samples.

FIG. 6 shows relative log 2 fold changes±SD of miR-1290 in cervical tumor samples and normal tissue, as discussed in Example 6. The left bar represents tumor samples and the right bar represents normal samples.

4. DETAILED DESCRIPTION

4.1. Detecting Cervical Dysplasia

4.1.1. General Methods

Methods of measuring levels of microRNA species disclosed herein are provided, wherein elevated levels of the microRNA species is indicative of cervical dysplasia. In some embodiments, methods are presented for detecting human cervical dysplasia, such as cervical dysplasia likely to progress to carcinoma. In some embodiments, the method comprises detecting an above-normal level of at least one target RNA that is capable of specifically hybridizing to a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211. In some embodiments, the method comprises detecting an above-normal level of at least one target RNA, wherein at least one target RNA comprises at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. In some embodiments, the method comprises detecting an above-normal level of at least one target RNA that comprises a sequence that is complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of a sequence selected from SEQ ID NO.:1 to 41 and 133 to 211. In some embodiments, the target RNA, in its mature form, comprises fewer than 30 nucleotides. The target RNA, in some embodiments, is a microRNA.

In the present disclosure, “a sequence selected from” encompasses both “one sequence selected from” and “one or more sequences selected from.” Thus, when “a sequence selected from” is used, it is to be understood that one, or more than one, of the listed sequences may be chosen.

Detection of a level of target RNA that is greater than a normal level of target RNA indicates the presence of cervical dysplasia in the sample. In some embodiments, the detecting is done quantitatively. In other embodiments, the detecting is done qualitatively. In some embodiments, detecting a target RNA comprises forming a complex comprising a polynucleotide and a nucleic acid selected from a target RNA, a DNA amplicon of a target RNA, and a complement of a target RNA. In some embodiments, the level of the complex is then detected and compared to a normal level of the same complex. The level of the complex, in some embodiments, correlates with the level of the target RNA in the sample.

“Cervical dysplasia,” which is also known as cervical intraepithelial neoplasia (“CIN”), corresponds to precancerous changes of the cervix that are evidenced by an abnormal growth on the surface of the cervix. Cervical dysplasia is divided into three categories: CIN 1, which is mild dysplasia in which only a few cells are abnormal; CIN 2, which is moderate to marked dysplasia in which the abnormal cells involve about one-half of the thickness of the surface lining of the cervix; and CIN 3, which includes severe dysplasia to carcinoma-in-situ (i.e., precancerous cells limited to the top epithelial layer of the cervix). CIN 3 is unlikely to regress spontaneously, and if left untreated, can penetrate the basement membrane and become an invasive carcinoma.

Table 1, below, lists 41 hybridization probes that have been found to be complementary to, and hybridize with, target RNAs in cancer cells. These target RNAs were detected at elevated levels in certain human cervical cell lines that were assayed using microarrays (Example 1). Thirty-six of the probes are believed to be complementary to, and hybridize with, target RNA species that are expressed in human cells. The other five probes are complementary to, and hybridize with, publicly known microRNAs that have been deposited by others into miRBase (http://microrna.sanger.ac.uk/; see Griffiths-Jones S. et al. (2007) Nucl. Acids Res. 36:154-158): hsa-miR-423-5p, hsa-miR-765, hsa-miR-92b*, hsa-miR-663, and hsa-miR-936). However, to the knowledge of the inventors, these five known microRNAs have not been disclosed to have utility for detecting cervical dysplasia.

Table 11, below, lists hybridization probes that have been found to be complementary to, and hybridize with, target RNAs in cancer cells. These target RNAs were detected at elevated levels in certain human clinical cervix samples that were assayed using microarrays (Example 3). Seventy-three of the probes are believed to be complementary to, and hybridize with, target RNA species that are expressed in human cells. Four of those 73 probes were also detected at elevated levels in certain human cervical cell lines that were assayed using microarrays (Example 1), and are also in Table 1 (836-R4-1, 3371-L4-1, 9053-R3-1, and 9691-L4-1). The remaining 19 probes are complementary to, and hybridize with, publicly known microRNAs that have been deposited by others into miRBase (http://microrna.sanger.ac.uk/; see Griffiths-Jones S. et al. (2007) Nucl. Acids Res. 36:154-158). One of those 19 probes was also detected at elevated levels in certain human cervical cell lines that were assayed using microarrays (Example 1), and is also in Table 1 (miR-765). To the knowledge of the inventors, at least 11 of those microRNAs, miR-1246, miR-1290, miR-1308, miR-1826, miR-200c, miR-451, miR-483-5p, miR-491-3p, miR-494, miR-720, and miR-765 have not been disclosed to have utility for detecting cervical dysplasia.

Table 28, below, lists 44 microRNAs that may be present at elevated levels in certain human cervical cancer cells lines and/or human clinical cervix samples. Some microRNAs in Table 28 are isomirs of one another. In some embodiments, two isomirs have a common core sequence with one or both ends varying by one to three nucleotides. For example, AGCCGCTCTTCTCCCTGCCCACA (SEQ ID NO: 355) and AGCCGCTCTTCTCCCTGCCCACA (SEQ ID NO: 356) are isomirs. Similarly, CCCGGAGAGCGGAGCACAACACA (SEQ ID NO: 346) and CCGGAGAGCGGAGCACAAC (SEQ ID NO: 347) are isomirs. When multiple isomirs are listed in Table 28, one or more than one of the isomirs may be present at elevated levels in a cervical dysplasia. In some embodiments, a method comprises detecting multiple isomirs with a single probe. Detection of an elevated level of one or multiple isomirs is considered to be indicative of cervical dysplasia.

For convenience of reference herein, and not by way of limitation, some “target RNA” species are denominated “microRNAs” in the tables set forth herein and Example 1. In some embodiments, the target RNA is a single mature microRNA capable of specifically hybridizing to a hybridization probe set forth in Table 1 or Table 11. In some embodiments, a target RNA is a single mature microRNA that comprises a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NO.:1 to 41 and 133 to 211. In some embodiments, a target RNA is a single mature microRNA that comprises at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. In some embodiments, target RNA may include a plurality of target RNAs, all of which are capable of specifically hybridizing to a single complementary probe sequence (for example, when two or more target microRNAs are isomirs). In some embodiments, the so-denominated “microRNA” is one or more RNA species capable of specifically hybridizing to the respective hybridization probe, such that one or more target RNAs do not meet canonical definitions for mature microRNAs. In some embodiments, a target RNA is an mRNA.

Mature human microRNAs are typically composed of 17-27 contiguous ribonucleotides, and often are 21 or 22 nucleotides in length. The sequences of some target microRNAs that can be detected in accordance with the present disclosure can be found within the pre-microRNA sequences shown in Table 2 (SEQ ID NOs: 42 to 82) and Table 12 (SEQ ID NOs: 226 to 314). The sequences of some microRNAs are shown in Table 28. Further, in some embodiments, a microRNA comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, or at least 26 contiguous nucleotides of a sequence in Table 28 (SEQ ID NOs: 345 to 388). The sequences of the 23 publicly known mature microRNAs, obtained by query of miRBase, are also shown below in Table 3, along with the sequences of other previously known microRNAs that, in some embodiments, can be detected in the methods described herein.

While not intending to be bound by theory, mammalian microRNAs mature as described herein. A gene coding for a microRNA is transcribed, leading to production of a microRNA precursor known as the “pri-microRNA” or “pri-miRNA.” The pri-miRNA can be part of a polycistronic RNA comprising multiple pri-miRNAs. In some circumstances, the pri-miRNA forms a hairpin with a stem and loop, which may comprise mismatched bases. The hairpin structure of the pri-miRNA is recognized by Drosha, which is an RNase III endonuclease protein. Drosha can recognize terminal loops in the pri-miRNA and cleave approximately two helical turns into the stem to produce a 60-70 nucleotide precursor known as the “pre-microRNA” or “pre-miRNA.” Drosha can cleave the pri-miRNA with a staggered cut typical of RNase III endonucleases yielding a pre-miRNA stem loop with a 5′ phosphate and an approximately 2-nucleotide 3′ overhang. Approximately one helical turn of the stem (about 10 nucleotides) extending beyond the Drosha cleavage site can be essential for efficient processing. The pre-miRNA is subsequently actively transported from the nucleus to the cytoplasm by Ran-GTP and the export receptor Exportin-5.

The pre-miRNA can be recognized by Dicer, another RNase III endonuclease. In some circumstances, Dicer recognizes the double-stranded stem of the pre-miRNA. Dicer may also recognize the 5′ phosphate and 3′ overhang at the base of the stem loop. Dicer may cleave off the terminal loop two helical turns away from the base of the stem loop leaving an additional 5′ phosphate and an approximately 2-nucleotide 3′ overhang. The resulting siRNA-like duplex, which may comprise mismatches, comprises the mature microRNA and a similar-sized fragment known as the microRNA*. The microRNA and microRNA* may be derived from opposing arms of the pri-miRNA and pre-miRNA. The mature microRNA is then loaded into the RNA-induced silencing complex (“RISC”), a ribonucleoprotein complex. In some cases, the microRNA* also has gene silencing or other activity.


TABLE 1
probe
fold-changes vs. normal Cervix
SEQ
ME180
C33A
Array
Array probe sequence
ID
CaSki
SiHa
sw756
C4-I
C4-II
HPV68
HPV
probe
(5′ to 3′, without linker)
NO:
HPV16
HPV16
HPV18
HPV18
HPV18
metastasis
neg
3371-L4-1
TTTCCTTTCCTCCCCTCCACACCCCATGACTCCCCACACT
1
6.14
8.9
6.9
5.43
12.37
4.94
12.18
TGAG
4315_D-
GGAAAGTCAGCCCCCAGCGCCCCCCGGAGTTCTTGG
2
6.91
4.11
3.25
7.01
12.19
8.37
14.35
R4-1
4988-R4-1
CTCCTCCTCCCCGTCTTTGGATACCAAACACTGGAC
3
3.46
2.72
2.89
4.59
6.32
4.15
10.48
6647-R2-1
CTCAGCCCCAGCTGGAGAATTTTTCCCCTCATTA
4
4.49
5.48
4.91
3.05
8.35
2.42
4.16
9053-R3-1
TTCTTGCCCTCCAATCCCCGGGCTCCACCAGCC
5
5.40
2.51
3.69
5.76
10.31
5.55
24.91
6803-R3-1
GCTCCCTCTCTGGTTGGACCTCACCCAAAGAT
6
2.68
2.00
2.14
3.86
5.38
4.19
19.50
9691-L4-1
AATCATCCATTTCATCCGCATCTCCCTCTTGGCCCCTTGC
7
2.83
2.74
2.49
3.82
4.69
5.30
11.57
miR-423-5p
AAAGTCTCGCTCTCTGCCCCTCA
8
4.53
3.01
2.89
5.15
7.27
5.86
11.22
6584-L1-1
TCGGCCCTGCCTCCTCCTCCT
9
2.16
1.9
1.9
2.69
5.23
2.36
4.03
7421-R2-1
TAAAGAGACTTCCTCCACTGCCAGAGATCT
10
2.46
3.01
2.99
1.5
3.32
2.41
3.5
8016-L3-1
TCAGCGCAACAAGCCCCGCAGTCACCCCTCT
11
3.31
1.8
1.8
3.41
5.71
3.74
9.14
8433-L3-1
AAATGGCTCCTTTCCCCTTTCCCTCCACCG
12
2.40
2.60
1.6
2.68
4.59
2.61
5.71
4361-R3-1
CGTCTCCCTCCCTCATGTGC
13
2.21
2.84
2.67
4.72
3.52
10.04
10010_H-
ACAGGCTACTTTCAGCAAATATGTCCATCCT
14
3.67
3.56
1.6
2.92
4.44
3.1
L4-1
12223-L4-1
CCCAGAAGACATCAGACAGAGTTGTTTCTTCTCCCTCTA
15
2.62
2.56
3.73
24.42
4610-R3-1
GCCCTCTGGCCCCTGCCTAATTGGCTGC
16
1.8
1.6
2.2
3.56
2.99
6.81
5192-L3-2
CATTTTTCCCCTTCCTTCCTCTATATCAGCAA
17
5.45
5.05
7.11
7.21
2.99
6.59
5782-L3-1
GATTCCAGCCCCTTCCCCC
18
2.20
1.5
2.57
2.84
5.04
5836-R3-2
CATTAACCCCCATTATCACAGCACGCCCCATTC
19
2.05
7.58
2.61
2.97
6183-R3-1
GATTCCACTTTTCTTAATGACTTTCCCCTCCT
20
2.68
2.12
2.72
2.74
6287-L3-2
GCCCCGCCCCACCTTTCGGGGCTCACCTGGC
21
2.20
1.5
2.70
4.43
4.42
5.90
6522-L3-1
GGGTTGCCTCTAATGTGGTAATAGATGTCATT
22
2.58
0.9
4.69
2.78
3.76
6752-R1-1
CCCTCCTTTCCCCACCTCAGT
23
3.58
2.99
2.66
5.44
2.26
5.13
6825-R3-1
CTCAGCTGTTCCCGGTGCCAG
24
2.13
5.17
2.68
2.94
6930-R3-1
ATTAATCCTTCTCTCCCCTCTG
25
3.12
2.52
5.01
5.16
5.17
20.54
7352-R3-2
GCCCCTGCCAGAATCCTCTAACAGCTCTAATTGG
26
1.6
4.29
5.18
14.54
8.13
7356-L2-1
ACCGCGACATAGCCTCGCCCCC
27
2.14
1.9
2.46
4.60
2.76
5.57
7384-R3-1
CTCGCAAAGGATCTCCTTCATCCCTCCCCA
28
2.26
0.7
1.7
3.27
2.18
3.96
7764-R3-2
CCCTCTCTGCCTCTCTCATCACCAATAACAGAC
29
2.15
2.12
2.41
4.33
3.00
7.07
8075-L3-1
CCCAGCTACACCTCCACGCA
30
2.90
2.67
4.02
5.12
2.8
8316-R3-1
ATCAGGGTATCCTCTCCCCA
31
1.5
2.59
2.84
2.46
9.39
836-R4-1
AAATAATCATTCCAAATGGTTCTCCCTGCTATGATTCAC
32
2.56
3.24
2.25
3.60
15.95
8433_D-
CCCGAGCCCGGCGCCCTGTGTTGTGCTCCGCTCTCC-
33
2.89
2.08
3.53
6.19
3.10
8.85
R4-1
GGGAAATGCCATCACTAAT
8724-R3-1
GCCAAGCTTGGAACCTCTCCCTGCCAGCATCAC
34
1.6
1.7
3.31
3.92
3.60
11.08
8832-R4-1
TCTGGAGTACCACCTGTTTTTCCCCCACT
35
6.56
2.25
4.55
2.21
2.7
9349-R3-1
GTGATGCAGAGGACTTCCTGCTCCAGGTCTC
36
2.10
3.02
1.5
1.9
2.80
9.84
9733-L3-1
AAGGCTGTCCCTCACCAGACTTCCCCACCCCT
37
2.50
1.5
2.23
4.46
4.20
4.09
miR-663
GCGGTCCCGCGGCGCCCCGCCT
38
2.59
3.09
4.55
3.99
6.49
miR-765
CATCACCTTCCTTCTCCTCCA
39
2.48
3.16
3.42
5.46
2.96
21.76
miR-92b*
CACTGCACCGCGTCCCGTCCCT
40
2.06
2.17
1.8
4.64
3.35
7.45
miR-936
CTGCGATTCCTCCCTCTACTGT
41
2.87
2.27
3.82
3.03
6.42


TABLE 2
pre-
Pre-
micro
micro-
RNA
RNA
SEQ
Candi-
chrom.
ID
date
Location
Pre-microRNA sequences
NO:
03371-L
18q21.33
CTCAAGTGTGGGGAGTCATGGGGTGTGGAGGGGAGGAAAGGAAAGGTATTTTGTTTCTTTGTCTATACATTTCCTAGA
42
TTTCTATGCAGTTGGG
12694-R
 1q22
GGGGACGTGGCCCCTCCCCCCCGGAGCGGGACTCCAAGAACTCCGGGGGGCGCTGGGGGCTGACTTTCC
43
04988-R
14q24.3
CTTTTTCTCTCTGCTGGGAAACCTTGCTTGACTTCATGTCCAGTGTTTGGTATCCAAAGACGGGGAGGAGGAG
44
06647-R
 1q23.3
CTCAGTATCTTCAGCTTGGGAAACTGACCTCGTTAATTTTAATGAGGGGAAAAATTCTCCAGCTGGGGCTGAG
45
09053-R
 Xq27.3
GGAAGGGCACTGTCTCTCTGATTCCCAGGGCCTGTCATTTCCCGAGGGCTGGTGGAGCCCGGGGATTGGAGGGCAAGA
46
AGCCCAGCC
06803-R
22q12.3
GCCACCTTTCATGGTGAGGATGCCTGCCACCTTCAGGATCACATCTTTGGGTGAGGTCCAACCAGAGAGGGAGC
47
09691-L
14g24.3
GCAAGGGGCCAAGAGGGAGATGCGGATGAAATGGATGATTTAATGGGTCATCTCTCCTGTAGTTAATTTCTCTAGATC
48
TCTTGT
miR-423-
17g11.22
ATAAAGGAAGTTAGGCTGAGGGGCAGAGAGCGAGACTTTTCTATTTTCCAAAAGCTCGGTCTGAGGCCCCTCAGTCTT
49
5p
TGCTCCTAACCCGCGC
06584-L
12q24.23
GCTTGGTGAGAGGAGGAGGAGGCAGGGCCGACCGCCACCCGCCTGTCTGCCATCTGGTCCCCTTCCCCTCCCTCCTCT
50
CATTGC
07421-R
12p13.31
TGAAGAATTTCTTCTGGATGACTGACCAAGAGGCTATTCAAGATCTCTGGCAGTGGAGGAAGTCTCTTTA
51
08016-L
12q21.1
AGAGGGGTGACTGCGGGGCTTGTTGCGCTGAAGATTTACAATGTACTTCTTGCAGGCGGCTCAGCAACCCCCTCT
52
08433-L
17q25.3
CGGTGGAGGGAAAGGGGAAAGGAGCCATTTTCTGCTGCACATCAGTCAGTGCCTGCGCCCTCCCTCCCTCCGCCG
53
04361-R
 Xp11.22
TGCTGGAGGTAAGGGTTTTCTGAAGCCTGGTGCCATGGCCACATGTGCACATGAGGGAGGGAGACGCTGAGGCTAGCA
54
12709-L
 7q32.1
AGGATGGACATATTTGCTGAAAGTAGCCTGTGCATTAATTGGTTATGGAAGTTTAAAAATGGTGTCCTCCT
55
12223-L
 4q27
TAGAGGGAGAAGAAACAACTCTGTCTGATGTCTTCTGGGATGGCCTTAATACAGATAGCATTGTCTCTTCCATTTCTG
56
04610-R
 8p12
GCCCAGTTAATTGGTCTCTCAACCTACATTAGCTGTTGCATTGCAGCCAATTAGGCAGGGGCCAGAGGGC
57
05192-L
 5q34
GTCTTTGCTGATATAGAGGAAGGAAGGGGAAAAATGAGCGCATTAGTTCTCTTTTATTAAAAGAGTTATTTCAGCATG
58
AC
05782-L
 5q35.1
GGGGGAAGGGGCTGGAATCATCGTGGGTTGGAACAGTTAAAGGAACCTCTGTTCAGCCCCAGCCCCAAGGCTCCC
59
05836-R
11q23.3
GCCATGGGCCTCCATAGTTTCCTGTAGCCCCCTTGGTTCCCAAGAATAGTTTTGGAATGGGGCGTGCTGTGATAATGG
60
GGGTTAATGGT
06183-R
12q21.33
GATTCATCTATTCTTTTTCTCCTTCTTCAAAGATAACTCTGTAAGCACTTAAGGAGGGGAAAGTCATTAAGAAAAGTG
61
GAATC
06287-L
 1p34.1
AGCAGCCAGGTGAGCCCCGAAAGGTGGGGCGGGGCAGGGGCGCTCCCAGCCCCACCCCGGGATCTGGTGACGCT
62
06522-L
 5q23.2
AATGACATCTATTACCACATTAGAGGCAACCCATAACAATCCCTTATAGAATGTTTGTCTCAATTTTGGTTATTTAAT
63
GTCATT
06752-R
 Xq13.1
CCCTCCCAGTTCCCATAGCAACTGGGCTGTAGCAGCCAGAACTTGATTGAGCCCAGCAGTGGCCCGACTGAGGTGGGG
64
AAAGGAGGG
06825-R
 9q31.1
CAAATTACATCTGTTTATGCTTCTATTTGTTAGACAATCTGGCACCGGGAACAGCTGAGCAGAAGGATTTG
65
06930-R
 9p21.3
TGTCATTTGTCCATTTTCTCTTCTGACCCAGTGGTATTCTGCAAGATCAGAGGGGAGAGAAGGATTAATGTCA
66
07352-R
 1q25.2
GCCTCTGTGCGCATGGATATAATCAGCTTTGATAGGCAGAGGCTGAGGCTGTTTTTCCAATTAGAGCTGTTAGAGGAT
67
TCTGGCAGGGGC
07356-L
 8q24.3
GGGGGCGAGGCTATGTCGCGGTGGCAGCCCGGATGGGCCGGCAGGGCCGGGAGTAACGGGACGTCGCCGCGGAGCTT
68
CTTCCCCC
07384-R
12g12
GGCATTTCTTCTTGTGTTTCCTCTTCTCCTCTTCTGGGGAGGGATGAAGGAGATCCTTTGCGAGAGGCATGTT
69
07764-R
 5q11.2
TGCTATCTCGCCTCACACATCAACACACGTGCCAGACAGATTCTGACTGCAAAGTCTGTTATTGGTGATGAGAGAGGC
70
AGAGAGGGCA
08075-L
10q22.1
CAGCTGGCCTGGTGCCCTGGTGCGTGGAGGTGTAGCTGGGCTCTGACCCAGCTCCTCAAACAGGTTCCATATGGCCCT
71
CCCGGCTG
08316-R
14g24.3
GTCAGGCTGCTGTATTCTCTTACACAGATGCCAGTAAGAACAAAGGCATCACGTGGGGAGAGGATACCCTGAT
72
00836-R
 3q26.2
AAATAAGCCATTCCAAACCATTCTCTGATTTGCTGTGAGTGGCAGAATCATTCACCGTGGTGAATCATAGCAGGGAGA
73
ACCATTTGGAATGATTATTT
12730-R
17q25.3
CCCGGCTCGGCCCCGCGTCTCTCCAGCTCCTCCGGCTCCTTTTAGTGCATAAATTAGTGATGGCATTTCCCGGAGA-
74
GCGGAGCACAACACAGGGCGCCGGGCTCGGG
08724-R
15q23
GGCCCAGAAGATGAAAAGCTGAAGTCCTTTCCCTTCCAGCTGAAGCCAGGTGTGATGCTGGCAGGGAGAGGTTCCAAG
75
CTTGGCC
08832-R
 9q33.2
TTCTGAGATATGATCTGTTGGATTCTCTACTACCAAAGTGGGGGAAAAACAGGTGGTACTCCAGAA
76
09349-R
21q22.11
GGACACTCTGAACCCCAAGTGGAATTCCAACTGCCAGTTCTTCATCCGAGACCTGGAGCAGGAAGTCCTCTGCATCAC
77
TGTGTTC
09733-L
15q23
AGGGGTGGGGAAGTCTGGTGAGGGACAGCCTTGAGTCAAAGGATGGTCACCGCTCCATGTGGCTGCCCCACCCCT
78
miR-663
20p11.1
CCTTCCGGCGTCCCAGGCGGGGCGCCGCGGGACCGCCCTCGTGTCTGTGGCGGTGGGATCCCGCGGCCGTGTTTTCC-
79
TGGTGGCCCGGCCATG
miR-765
 1q23.1
TTTAGGCGCTGATGAAAGTGGAGTTCAGTAGACAGCCCTTTTCAAGCCCTACGAGAAACTGGGGTTTCTGGAGG-
80
AGAAGGAAGGTGATGAAGGATCTGTTCTCGTGAGCCTGAA
miR-
CGGGCCCCGGGCGGGCGGGAGGGACGGGACGCGGTGCAGTGTTGTTTTTTCCCCCGCCAATATTGCACTCGTCCCGGC
81
92b*1
CTCCGGCCCCCCCGGCCC
miR-936
10q25.1
TCAAGGCCACTGGGACAGTAGAGGGAGGAATCGCAGAAATCACTCCAGGAGCAACTGAGAGACCTTGCTTCTACTTTA
82
CCAGGTCCTGCTGGCCCAGA


TABLE 3
SEQ ID
Mature microRNA Sequences
NO
microRNA
(5′ to 3′) sequence
91
miR-423-5p
UGAGGGGCAGAGAGCGAGACUUU
(miR-423)
92
miR-663
AGGCGGGGCGCCGCGGGACCGC
93
miR-765
UGGAGGAGAAGGAAGGUGAUG
94
miR-92b*
AGGGACGGGACGCGGUGCAGUG
95
miR-936
ACAGUAGAGGGAGGAAUCGCAG
389
miR-1246
AAUGGAUUUUUGGAGCAGG
390
miR-1290
UGGAUUUUUGGAUCAGGGA
391
miR-1308
GCAUGGGUGGUUCAGUGG
111
miR-142-3p
UGUAGUGUUUCCUACUUUAUGGA
392
miR-1826
AUUGAUCAUCGACACUUCGAACGCAAU
393
miR-195
UAGCAGCACAGAAAUAUUGGC
394
miR-200c
UAAUACUGCCGGGUAAUGAUGGA
395
miR-451
AAACCGUUACCAUUACUGAGUU
396
miR-483-5p
AAGACGGGAGGAAAGAAGGGAG
397
miR-491-3p
CUUAUGCAAGAUUCCCUUCUAC
398
miR-494
UGAAACAUACACGGGAAACCUC
399
miR-720
UCUCGCUGGGGCCUCCA
400
miR-98
UGAGGUAGUAAGUUGUAUUGUU
401
miR-143
UGAGAUGAAGCACUGUAGCUC
100
miR-145
GUCCAGUUUUCCCAGGAAUCCCU
402
miR-205
UCCUUCAUUCCACCGGAGUCUG
109
miR-21
UAGCUUAUCAGACUGAUGUUGA
403
miR-31
AGGCAAGAUGCUGGCAUAGCU
96
miR-9
UCUUUGGUUAUCUAGCUGUAUGA
97
miR-199a*
ACAGUAGUCUGCACAUUGGUUA
98
miR-199a
CCCAGUGUUCAGACUACCUGUUC
99
miR-199b
CCCAGUGUUUAGACUAUCUGUUC
101
miR-133a
UUUGGUCCCCUUCAACCAGCUG
102
miR-133b
UUUGGUCCCCUUCAACCAGCUA
103
miR-214
ACAGCAGGCACAGACAGGCAGU
104
miR-127
CUGAAGCUCAGAGGGCUCUGAU
105
miR-210
CUGUGCGUGUGACAGCGGCUGA
106
miR-182
UUUGGCAAUGGUAGAACUCACACU
107
miR-183
UAUGGCACUGGUAGAAUUCACU
404
miR-155
UUAAUGCUAAUCGUGAUAGGGGU
108
miR-146a
UGAGAACUGAAUUCCAUGGGUU
110
miR-301
CAGUGCAAUAGUAUUGUCAAAGC
112
miR-142-5p
CAUAAAGUAGAAAGCACUACU
113
miR-194
UGUAACAGCAACUCCAUGUGGA
114
miR-215
AUGACCUAUGAAUUGACAGAC
115
miR-32
UAUUGCACAUUACUAAGUUGCA
116
miR-374b
AUAUAAUACAACCUGCUAAGUG
117
miR-933
UGUGCGCAGGGAGACCUCUCCC
118
miR-769-3p
CUGGGAUCUCCGGGGUCUUGGUU
119
miR-671
AGGAAGCCCUGGAGGGGCUGGAG
120
miR-934
UGUCUACUACUGGAGACACUGG
121
miR-935
CCAGUUACCGCUUCCGCUACCGC
122
miR-937
AUCCGCGCUCUGACUCUCUGCC
123
miR-938
UGCCCUUAAAGGUGAACCCAGU
124
miR-939
UGGGGAGCUGAGGCUCUGGGGGUG
125
miR-940
AAGGCAGGGCCCCCGCUCCCC
126
miR-941
CACCCGGCUGUGUGCACAUGUGC
127
miR-942
UCUUCUCUGUUUUGGCCAUGUG
128
miR-943
CUGACUGUUGCCGUCCUCCAG
129
miR-944
AAAUUAUUGUACAUCGGAUGAG
130
miR-708
AAGGAGCUUACAAUCUAGCUGGG
131
miR-874-5p
CGGCCCCACGCACCAGGGUAAG
132
miR-874-3p
CUGCCCUGGCCCGAGGGACCGA

In Table 1, the expression levels of target RNAs measured for each of the identified sample cell lines are expressed as fold-changes in expression relative to expression levels measured in normal human cervix total RNA (see Example 1). The expression levels of the target RNAs detected by the probes in Table 11, expressed as fold-changes for each of the clinical cervix samples, are shown in Table 10 (Example 3).

In some embodiments, target RNAs can be measured in samples collected at one or more times from a patient to monitor the status or progress of cervical dysplasia in the patient.

In some embodiments, a sample to be tested is obtained using one or more techniques commonly used for preparing Pap smears, e.g., (i) endocervical swab, using a cotton applicator stick (or wire brush for endocervical specimens) advanced into the os of the cervix, with the stick gently rolled between the thumb and index finger; (ii) cervical scrape, in which the longer end of a cervical spatula is inserted into the os of the cervix and pressed gently, with turning and scraping. In some embodiments, the sample to be tested is a cervical biopsy, such as a punch biopsy or cone biopsy. In some embodiments, the sample to be tested is from a loop excision, or LEEP, procedure.

The clinical sample to be tested is, in some embodiments, freshly obtained. In other embodiments, the sample is a fresh frozen specimen. In some embodiments, the sample is a tissue sample, such as a formalin-fixed paraffin embedded sample. In some embodiments, the sample is a liquid cytology sample.

Exemplary liquid cytology preservative solutions include, but are not limited to, ThinPrep™ PreservCyt™ solution (Hologic, Bedford, Mass.) and SurePath™ preservative solution (BD Diagnostics, NJ). Additional exemplary preservative solutions include, but are not limited to, RNAlater® (Ambion), formalin (e.g., 10% aqueous formalin), Universal Viral Transport Media (BD Diagnostics, NJ), M4, M4RT, PVA (polyvinyl-alcohol), PolyCyte (American Mastertech Scientific), Spray-Cyte cytological fixative (Becton-Dickinson), formaldehyde (e.g., 10% in phosphate buffer), NuFix Complete Collection Solution (QC Sciences), CarboFix (StatLab Medical Products), Cyto Jar (Surgipath Medical Industries), SED Fix (Surgipath Medical Industries), SprayFix (Surgipath Medical Industries), cytology fixative 50% alcohol solution (U.S. Biotex), Cyto-Prep (Wakefield), Cyto-Fix (Wakefield), PVA with zinc or copper, merthiolate-iodine-formaldehyde (MIF), sodium acetate-acetic acid-formalin (SAF), mercuric chloride-based Schaudinn's, zinc-based Schaudinn's preservative (Meridian Diagnostics, Inc.), EcoFix® (Merdian Bioscience), Parasafe®, Unifix, Proto-Fix™, and STF.

In some embodiments, the clinical sample to be tested is obtained in conjunction with routine cytologic screening (e.g., by Pap smear), currently recommended for all women between the ages of 21 and 65, and women who are under 21 years old who have been sexually active for three years or more. In some embodiments, the sample to be tested is obtained from a woman who has a predisposition to develop cervical cancer, e.g., a woman who has tested positive for HPV infection, and especially positive for a high risk HPV type. In some embodiments, the clinical sample to be tested is obtained from women who have one or more of the following risk factors: multiparous, many sexual partners, first sexual intercourse at a young age, smoke cigarettes, use of oral contraceptives, and a weakened immune system. In some embodiments, the clinical sample is obtained from women who have diagnostic signs or clinical symptoms that may be associated with cervical cancer, such as abnormal Pap tests, abnormal bleeding or visible cervical lesions.

In some embodiments, the methods described herein are used for early detection of cervical dysplasia in a sample of cervical cells, such as those obtained by routine Pap smear. In some embodiments, methods described herein can be used for early detection of cervical dysplasia in a sample of cervical cells, and to determine a likelihood that the detected cervical dysplasia will progress to cervical cancer.

Thus, in some embodiments, methods of the present disclosure can be used for routine screening of healthy women with no risk factors. In some embodiments, methods herein are used to (1) screen women who have a history of abnormal Pap smears and/or of assays showing infection by one or more HPV strains associated with the development of cervical cancer, (2) screen women with one or more of the above-described risk factors, (3) confirm a diagnosis made by cytology, histology or HPV assay, and/or further characterize a diagnosis made by cytology or histology.

In some embodiments, the methods described herein can be used to assess the effectiveness of a treatment for cervical cancer in a patient. In some embodiments, the target RNA expression levels are determined at various times during the treatment, and are compared to target RNA expression levels from an archival sample taken from the patient, e.g., by Pap smear, before the manifestation of any signs of cervical dysplasia or cervical cancer or before beginning treatment. Ideally, target RNA expression levels in the normal Pap smear sample evidence no aberrant changes in target RNA expression levels. Thus, in such embodiments, the progress of treatment of an individual with cervical dysplasia or cervical cancer can be assessed by comparison to a sample of cervical cells from the same individual when she was healthy or prior to beginning treatment.

In some embodiments, a target RNA is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7 and 8. In some embodiments, a target RNA is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12. In some embodiments, a target RNA is selected from miR-1246, miR-1308, miR-491-3p, miR-1826, and miR-1290 (SEQ ID NOs: 208, 210, 205, 211, and 209), and target RNAs that are capable of specifically hybridizing to probes 13254-R5-1, 13252-L5-3, 13532-L5-2, 4440-L3-2, 6216-L1-1, and 6235-R5-2 (SEQ ID NOs: 194, 193, 172, 142, 151, and 153). In some embodiments, a target RNA is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1, 5, 7, and 32. In some embodiments, a target RNA is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1 to 41 set forth in Table 1 and SEQ ID NOs: 133 to 211 in Table 11. In some embodiments, a target RNA comprises at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. In some embodiments, a target RNA comprises a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211. In some embodiments, a target RNA, in its mature form, comprises fewer than 30 nucleotides. In some embodiments, a target RNA is a microRNA.

In embodiments in which the method comprises detecting expression of more than one target RNA, the expression levels of the plurality of target RNAs may be detected concurrently or simultaneously in the same assay reaction. In some embodiments, expression levels are detected concurrently or simultaneously in separate assay reactions. In some embodiments, expression levels are detected at different times, e.g., in serial assay reactions.

In some embodiments, a method comprises detecting the level of at least one target RNA in a sample from a subject, wherein detection of a level of at least one target RNA that is greater than a normal level of the at least one target RNA indicates the presence of cervical dysplasia in the sample and/or in the subject. In some embodiments, a method comprises detecting the level of at least one target RNA in a sample from a subject and comparing the level of the at least one target RNA in the sample to a normal level of the at least one target RNA, wherein a level of at least one target RNA in the sample that is greater than a normal level of the at least one target RNA indicates the presence of cervical dysplasia in the sample and/or in the subject.

In some embodiments, a method of facilitating diagnosis of cervical dysplasia in a subject is provided. Such methods comprise detecting the level of at least one target RNA in a sample from the subject. In some embodiments, information concerning the level of at least one target RNA in the sample from the subject is communicated to a medical practitioner. A “medical practitioner,” as used herein, refers to an individual or entity that diagnoses and/or treats patients, such as a hospital, a clinic, a physician's office, a physician, a nurse, or an agent of any of the aforementioned entities and individuals. In some embodiments, detecting the level of at least one target RNA is carried out at a laboratory that has received the subject's sample from the medical practitioner or agent of the medical practitioner. The laboratory carries out the detection by any method, including those described herein, and then communicates the results to the medical practitioner. A result is “communicated,” as used herein, when it is provided by any means to the medical practitioner. In some embodiments, such communication may be oral or written, may be by telephone, in person, by e-mail, by mail or other courier, or may be made by directly depositing the information into, e.g., a database accessible by the medical practitioner, including databases not controlled by the medical practitioner. In some embodiments, the information is maintained in electronic form. In some embodiments, the information can be stored in a memory or other computer readable medium, such as RAM, ROM, EEPROM, flash memory, computer chips, digital video discs (DVD), compact discs (CDs), hard disk drives (HDD), magnetic tape, etc.

In some embodiments, methods of detecting the presence cervical dysplasia are provided. In some embodiments, methods of diagnosing cervical dysplasia are provided. In some embodiments, the method comprises obtaining a sample from a subject and providing the sample to a laboratory for detection of at least one target RNA level in the sample. In some embodiments, the method further comprises receiving a communication from the laboratory that indicates the at least one target RNA level in the sample. In some embodiments, cervical dysplasia is present if the level of at least one target RNA in the sample is greater than a normal level of the at least one target RNA. A “laboratory,” as used herein, is any facility that detects the level of at least one target RNA in a sample by any method, including the methods described herein, and communicates the level to a medical practitioner. In some embodiments, a laboratory is under the control of a medical practitioner. In some embodiments, a laboratory is not under the control of the medical practitioner.

When a laboratory communicates the level of at least one target RNA to a medical practitioner, in some embodiments, the laboratory communicates a numerical value representing the level of at least one target RNA in the sample, with or without providing a numerical value for a normal level. In some embodiments, the laboratory communicates the level of at least one target RNA by providing a qualitative value, such as “high,”“elevated,” etc.

As used herein, when a method relates to detecting cervical dysplasia, determining the presence of cervical dysplasia, and/or diagnosing cervical dysplasia, the method includes activities in which the steps of the method are carried out, but the result is negative for the presence of cervical dysplasia. That is, detecting, determining, and diagnosing cervical dysplasia include instances of carrying out the methods that result in either positive or negative results (e.g., whether target RNA levels are normal or greater than normal).

As used herein, the term “subject” means a human. In some embodiments, the methods described herein may be used on samples from non-human animals.

The common, or coordinate, expression of target RNAs that are physically proximal to one another in the genome permits the informative use of such chromosome-proximal target RNAs in methods herein.

Table 2 identifies the chromosomal location of each of the 41 target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1 to 41 in Table 1. Table 12 identifies the chromosomal location of each of the target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 133 to 211 in Table 11. Thus, in some embodiments, the level of expression of one or more target RNAs located within about 1 kilobase (kb), within about 2 kb, within about 5 kb, within about 10 kb, within about 20 kb, within about 30 kb, within about 40 kb, and even within about 50 kb of the chromosomal locations in Table 2 and Table 12 is detected in lieu of, or in addition to, measurement of expression of the respective tabulated target RNA in the methods described herein. See Baskerville, S. and Bartel D. P. (2005) RNA 11:241-247.

In some embodiments, in combination with detecting one or more target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211 and/or detecting one or more target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 and/or detecting one or more target RNAs that comprise a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211, methods herein further comprise detecting the level(s) of expression of at least one microRNA selected from miR-21, miR-31, miR-182, miR-183, miR-155, miR-9, miR-199a*, miR-199a, miR-199b, miR-205, miR-145, miR-133a, miR-133b, miR-214, miR-127, miR-210, miR-146a, miR-301, miR-142-5p, miR-194, miR-215, miR-32, miR-374b, miR-933, miR-769-3p, miR-671, miR-934, miR-935, miR-937, miR-938, miR-939, miR-940, miR-941, miR-942, miR-943, miR-944, miR-708, miR-874-5p, and miR-874-3p. In some embodiments, an increase in expression of one or more of these microRNAs, in combination with an elevated level of one or more target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211 and/or an elevated level of one or more target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 and/or an elevated level of one or more target RNAs that comprise a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211, is indicative of the presence of cervical dysplasia in a sample of human cervical cells.

In some embodiments, in combination with detecting one or more target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211 and/or detecting one or more target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 and/or detecting one or more target RNAs that comprise a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211, methods herein further comprise detecting in a sample of human cervical cells the expression of at least one microRNA selected from miR-9, miR-199a*, miR-199a, miR-199b, miR-145, miR-133a, miR-133b, miR-214 and miR-127 where invasive squamous cell cervical carcinoma is implicated. In some embodiments, an increase in expression of one or more microRNAs selected from miR-9, miR-199a*, miR-199a, miR-199b, miR-145, miR-133a, miR-133b, miR-214 and miR-127, in combination with an elevated level of one or more target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211 and/or an elevated level of one or more target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 and/or an elevated level of one or more target RNAs that comprise a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211, is indicative of the presence of cervical carcinoma in a sample of human cervical cells.

In some embodiments, in combination with detecting one or more target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211 and/or detecting one or more target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 and/or detecting one or more target RNAs that comprise a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211, methods herein further comprise detecting in a sample of human cervical cells the expression of at least one microRNA selected from miR-210, miR-182 and miR-183 where human papilloma virus 16 (“HPV-16”) is implicated. In some embodiments, an increase in expression of one or more of miR-210, miR-182 and miR-183, in combination with an elevated level of one or more target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211 and/or an elevated level of one or more target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 and/or an elevated level of one or more target RNAs that comprise a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211, is indicative of HPV16 infection in a sample of cervical cells.

In some embodiments, in combination with detecting one or more target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NO.:1 to 41 and 133 to 211 and/or detecting one or more target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 and/or detecting one or more target RNAs that comprise a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211, methods herein further comprise detecting in a sample of human cervical cells the expression of miR-146a in order to distinguish cervical cancer from pre-neoplastic lesions, e.g., HPV-infected cervical cells.

In some embodiments, a target RNA, in its mature form, comprises fewer than 30 nucleotides. In some embodiments, a target RNA is a microRNA.

In some embodiments, the methods further comprise detecting in a sample of human cervical cells the expression of at least one target RNA gene located in close proximity to chromosomal features, such as cancer-associated genomic regions, fragile sites, and human papilloma virus integration sites.

In some embodiments, in combination with detecting one or more target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211 and/or detecting one or more target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 and/or detecting one or more target RNAs that comprise a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211, methods herein further comprise detecting in a sample of human cervical cells the expression of at least one mRNA species. In some embodiments, the at least one mRNA is selected from the mRNAs for the genes set forth in Table 4, below. In some embodiments, at least one mRNA is selected from mRNAs for CDKN2A, MKI67, TOP2A, and MCM5. In some embodiments, at least one mRNA is selected from mRNAs for CDKN2A, MKI67, TOP2A, MCM5, BIRC5, MMP9, and MCM2.


TABLE 4
gene
name
alias
BIRC5
survivin
survivin
IGF2BP3
insulin-like growth factor
L523S, IMP-3,
2 mRNA binding protein 3
KOC1
TERC
telomerase RNA component
hTR
CDKN2A
cyclin-dependent kinase inhibitor 2A
P16ink4
MCM5
minichromosome maintenance
complex component 5
TOP2A
topoisomerase II-α
MYBL2
v-myb myeloblastosis viral oncogene
B-myb
homolog (avian)-like 2
PIK3CA
phosphoinositide-3-kinase,
PI3K
catalytic, alpha polypeptide
DROSHA
class 2 RNase III enzyme that
Drosha, Rnasen
initiates processing of microRNA
MKI67
antigen identified by monoclonal
Ki-67
antibody Ki-67
MMP9
matrix metallopeptidase 9
gelatinase B, 92 kDa
gelatinase, 92 kDa
type IV collagenase
MCM2
minichromosome maintenance
complex component 2

In some embodiments, an increase in expression of one or more mRNAs listed in the table above is indicative of the presence of cervical dysplasia or cervical cancer in a sample of human cervical cells.

In some embodiments, more than one target RNA is detected simultaneously in a single reaction. In some embodiments, at least 2, at least 3, at least 5, or at least 10 target RNAs are detected simultaneously in a single reaction. In some embodiments, all target RNAs are detected simultaneously in a single reaction.

4.1.2. Exemplary Controls

In some embodiments, a normal level (a “control”) for each target RNA can be determined as an average level or range that is characteristic of normal cervical cells or other reference material, against which the level measured in the sample can be compared. The determined average or range of target RNA in normal subjects can be used as a benchmark for detecting above-normal levels of target RNA indicative of cervical dysplasia. In some embodiments, normal levels of target RNA can be determined using individual or pooled RNA-containing samples from one or more individuals, such as from patients undergoing hysterectomy for benign gynecologic disease.

In some embodiments, determining a normal level of expression of a target RNA comprises detecting a complex comprising a probe hybridized to a nucleic acid selected from a target RNA, a DNA amplicon of the target RNA, and a complement of the target RNA. That is, in some embodiments, a normal level of expression can be determined by detecting a DNA amplicon of the target RNA, or a complement of the target RNA rather than the target RNA itself. In some embodiments, a normal level of such a complex is determined and used as a control. The normal level of the complex, in some embodiments, correlates to the normal level of the target RNA. Thus, when a normal level of a target is discussed herein, that level can, in some embodiments, be determined by detecting such a complex.

In some embodiments, a control comprises RNA from cells of a single individual, e.g., a patient undergoing hysterectomy for benign gynecologic disease. In some embodiments, a control comprises RNA from a pool of cells from multiple individuals. In some embodiments, a control is drawn from anatomically and/or cytologically normal areas of the cervix of the individual from whom the test sample was obtained. In some embodiments, a control comprises commercially-available human RNA, such as, for example, human cervix total RNA (Ambion; AM6992). In some embodiments, a normal level or normal range has already been predetermined prior to testing a sample for an elevated level.

In some embodiments, the normal level of target RNA can be determined from one or more continuous cell lines, typically cell lines previously shown to have expression levels of the at least one target RNA that approximate the level of expression in normal cervical cells.

In some embodiments, a method comprises detecting the level of expression of at least one target RNA. In some embodiments, a method further comprises comparing the level of expression of at least one target RNA to a normal level of expression of the at least one target RNA. In some embodiments, a method further comprises comparing the level of expression of at least one target RNA to a control level of expression of the at least one target RNA. A control level of expression of the at least one target RNA is, in some embodiments, the level of expression of the at least one target RNA in a normal cell. In some such embodiments, a control level may be referred to as a normal level. In some embodiments, a greater level of expression of the at least one target RNA relative to the level of expression of the at least one target RNA in a normal cell indicates cervical dysplasia.

In some embodiments, the level of expression of the at least one target RNA is compared to a reference level of expression, e.g., from a confirmed cervical dysplasia. In some such embodiments, a similar level of expression of the at least one target RNA relative to the reference sample indicates cervical dysplasia.

In some embodiments, a level of expression of at least one target RNA that is at least about two-fold greater than a normal level of expression of the respective at least one target RNA indicates the presence of cervical dysplasia. In some embodiments, a level of expression of at least one target RNA that is at least about two-fold greater than the level of the respective at least one target RNA in a control sample comprised of normal cells indicates the presence of a cervical dysplasia. In various embodiments, a level of expression of at least one target RNA that is at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, or at least about 10-fold greater than the level of expression of the respective at least one target RNA in a control sample comprised of normal cells indicates the presence of cervical dysplasia. In various embodiments, a level of expression of at least one target RNA that is at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, or at least about 10-fold greater than a normal level of expression of the at least one target RNA indicates the presence of cervical dysplasia.

In some embodiments, an increase in expression of one or more target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1 to 41 in Table 1 and SEQ ID NOs: 133 to 211 in Table 11 is indicative of the presence of cervical dysplasia or cervical cancer in a sample of human cervical cells. In some embodiments, an increase in expression of one or more target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 is indicative of the presence of cervical dysplasia or cervical cancer in a sample of human cervical cells. In some embodiments, an increase in expression of one or more target RNAs comprising a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211 is indicative of the presence of cervical dysplasia or cervical cancer in a sample of human cervical cells.

In some embodiments, an increase in expression of one or more target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1 to 41 in Table 1 and SEQ ID NOs: 133 to 211 in Table 11 is indicative of the presence of cervical dysplasia in a sample of human cervical cells that is likely to proceed to cervical cancer. In some embodiments, an increase in expression of one or more target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 is indicative of the presence of cervical dysplasia in a sample of human cervical cells that is likely to proceed to cervical cancer. In some embodiments, an increase in expression of one or more target RNAs comprising a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211 is indicative of the presence of cervical dysplasia in a sample of human cervical cells that is likely to proceed to cervical cancer.

In some embodiments, a control level of expression of a target RNA is determined contemporaneously, such as in the same assay or batch of assays, as the level of expression of the target RNA in a sample. In some embodiments, a control level of expression of a target RNA is not determined contemporaneously as the level of expression of the target RNA in a sample. In some such embodiments, the control level of expression has been determined previously.

In some embodiments, the level of expression of a target RNA is not compared to a control level of expression, for example, when it is known that the target RNA is expressed at very low levels, or not at all, in normal cells. In such embodiments, detection of a high level of the target RNA in a sample is indicative of cervical dysplasia.

4.1.3. Exemplary Methods of Preparing RNAs

Target RNA can be prepared by any appropriate method. Total RNA can be isolated by any method, including, but not limited to, the protocols set forth in Wilkinson, M. (1988) Nucl. Acids Res. 16(22):10,933; and Wilkinson, M. (1988) Nucl. Acids Res. 16(22): 10934, or by using commercially-available kits or reagents, such as the TRIzol® reagent (Invitrogen™), Total RNA Extraction Kit (iNtRON Biotechnology), Total RNA Purification Kit (Norgen Biotek Corp.), RNAqueous™ (Ambion), MagMAX™ (Ambion), RecoverAll™ (Ambion), RNeasy (Qiagen), etc.

In some embodiments, small RNAs are isolated or enriched. In some embodiments “small RNA” refers to RNA molecules smaller than about 200 nucleotides (nt) in length. In some embodiments, “small RNA” refers to RNA molecules smaller than about 100 nt, smaller than about 90 nt, smaller than about 80 nt, smaller than about 70 nt, smaller than about 60 nt, smaller than about 50 nt, or smaller than about 40 nt.

Enrichment of small RNAs can be accomplished by method. Such methods include, but are not limited to, methods involving organic extraction followed by adsorption of nucleic acid molecules on a glass fiber filter using specialized binding and wash solutions, and methods using spin column purification. Enrichment of small RNAs may be accomplished using commercially-available kits, such as mirVana™ Isolation Kit (Applied Biosystems), mirPremier™ microRNA Isolation Kit (Sigma-Aldrich), PureLink™ miRNA Isolation Kit (Invitrogen), miRCURY™ RNA isolation kit (Exiqon), microRNA Purification Kit (Norgen Biotek Corp.), miRNeasy kit (Qiagen), etc. In some embodiments, purification can be accomplished by the TRIzol® (Invitrogen) method, which employs a phenol/isothiocyanate solution to which chloroform is added to separate the RNA-containing aqueous phase. Small RNAs are subsequently recovered from the aqueous by precipitation with isopropyl alcohol. In some embodiments, small RNAs can be purified using chromatographic methods, such as gel electrophoresis using the flashPAGE™ Fractionator available from Applied Biosystems.

In some embodiments, small RNA is isolated from other RNA molecules to enrich for target RNAs, such that the small RNA fraction (e.g., containing RNA molecules that are 200 nucleotides or less in length, such as less than 100 nucleotides in length, such as less than 50 nucleotides in length, such as from about 10 to about 40 nucleotides in length) is substantially pure, meaning it is at least about 80%, 85%, 90%, 95% pure or more, but less than 100% pure, with respect to larger RNA molecules. Alternatively, enrichment of small RNA can be expressed in terms of fold-enrichment. In some embodiments, small RNA is enriched by about, at least about, or at most about 5×, 10×, 20×, 30×, 40×, 50×, 60×, 70×, 80×, 90×, 100×, 110×, 120×, 130×, 140×, 150×, 160×, 170×, 180×, 190×, 200×, 210×, 220×, 230×, 240×, 250×, 260×, 270×, 280×, 290×, 300×, 310×, 320×, 330×, 340×, 350×, 360×, 370×, 380×, 390×, 400×, 410×, 420×, 430×, 440×, 450×, 460×, 470×, 480×, 490×, 500×, 600×, 700×, 800×, 900×, 1000×, 1100×, 1200×, 1300×, 1400×, 1500×, 1600×, 1700×, 1800×, 1900×, 2000×, 3000×, 4000×, 5000×, 6000×, 7000×, 8000×, 9000×, 10,000× or more, or any range derivable therein, with respect to the concentration of larger RNAs in an RNA isolate or total RNA in a sample.

In yet other embodiments, expression is measured in a sample in which RNA has not first been purified from the cells.

In some embodiments, RNA is modified before target RNAs are detected. In some embodiments, the modified RNA is total RNA. In other embodiments, the modified RNA is small RNA that has been purified from total RNA or from cell lysates, such as RNA less than 200 nucleotides in length, such as less than 100 nucleotides in length, such as less than 50 nucleotides in length, such as from about 10 to about 40 nucleotides in length. RNA modifications that can be utilized in the methods described herein include, but are not limited to, the addition of a poly-dA or a poly-dT tail, which can be accomplished chemically or enzymatically, and/or the addition of a small molecule, such as biotin.

In some embodiments, one or more target RNAs are reverse transcribed. In some embodiments, where present, RNA is modified when it is reverse transcribed, such as when a poly-dA or a poly-dT tail is added to the cDNA during reverse transcription. In other embodiments, RNA is modified before it is reverse transcribed. In some embodiments, total RNA is reverse transcribed. In other embodiments, small RNAs are isolated or enriched before the RNA is reverse transcribed.

When a target RNA is reverse transcribed, a complement of the target RNA is formed. In some embodiments, the complement of the target RNA is detected rather than the target RNA itself (or a DNA copy thereof). Thus, when the methods discussed herein indicate that a target RNA is detected, or the level of a target RNA is determined, such detection or determination may be carried out on a complement of the target RNA instead of, or in addition to, the target RNA itself. In some embodiments, when the complement of the target RNA is detected rather than the target RNA, a probe is used that is complementary to the complement of the target RNA. In such embodiments, the probe comprises at least a portion that is identical in sequence to the target RNA, although it may contain thymidine in place of uridine, and/or comprise other modified nucleotides.

In some embodiments, the method of detecting one or more target RNAs comprises amplifying cDNA complementary to said target RNA. Such amplification can be accomplished by any method. Exemplary methods include, but are not limited to, real time PCR, endpoint PCR, and amplification using T7 polymerase from a T7 promoter annealed to a cDNA, such as provided by the SenseAmp Plus™ Kit available at Implen, Germany.

When a target RNA or a cDNA complementary to a target RNA is amplified, in some embodiments, a DNA amplicon of a target RNA is formed. A DNA amplicon may be single stranded or double-stranded. In some embodiments, when a DNA amplicon is single-stranded, the sequence of the DNA amplicon is related to the target RNA in either the sense or antisense orientation. In some embodiments, the DNA amplicon of the target RNA is detected rather than the target RNA itself. Thus, when the methods discussed herein indicate that a target RNA is detected, or the level of a target RNA is determined, such detection or determination may be carried out on a DNA amplicon of the target RNA instead of, or in addition to, the target RNA itself. In some embodiments, when the DNA amplicon of the target RNA is detected rather than the target RNA, a probe is used that is complementary to the complement of the target RNA. In some embodiments, when the DNA amplicon of the target RNA is detected rather than the target RNA, a probe is used that is complementary to the target RNA. Further, I some embodiments, multiple probes may be used, and some probes may be complementary to the target RNA and some probes may be complementary to the complement of the target RNA.

In some embodiments, the method of detecting one or more target RNAs comprises RT-PCR, as described below. In some embodiments, detecting one or more target RNAs comprises real-time monitoring of an RT-PCR reaction, which can be accomplished by any method. Such methods include, but are not limited to, the use of TaqMan®, Molecular beacon, or Scorpion probes (i.e., FRET probes) and the use of intercalating dyes, such as SYBR green, EvaGreen, thiazole orange, YO-PRO, TO-PRO, etc.

4.1.4. Exemplary Analytical Methods

As described above, methods are presented for detecting cervical dysplasia, including cervical dysplasia likely to progress to carcinoma, in a sample of human cervical cells. In some embodiments, the method comprises detecting a level of expression of at least one target RNA capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1 to 41 set forth in Table 1 and SEQ ID NOs: 133 to 211 set forth in Table 11 that is greater in the sample than a normal level of expression of the at least one target RNA in a control sample, such as a sample derived from normal cervical cells. In some embodiments, a method comprises detecting a level of one or more target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 that is greater in the sample than a normal level of expression of the at least one target RNA in a control sample. In some embodiments, a method comprises detecting a level of one or more target RNAs that comprise a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211 that is greater in the sample than a normal level of expression of the at least one target RNA in a control sample. In some embodiments, a target RNA, in its mature form, comprises fewer than 30 nucleotides. In some embodiments, a target RNA is a microRNA.

In some embodiments, such as those described above, the method further comprises detecting a level of expression of at least one target RNA of the human miRNome that does not specifically hybridize to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1 to 41 set forth in Table 1 and SEQ ID NOs: 133 to 211 set forth in Table 11 that is greater in the sample than a normal level of expression of the at least one target RNA in a control sample. As used herein, the term “human miRNome” refers to all microRNA genes in a human cell and the mature microRNAs produced therefrom.

Any analytical procedure capable of permitting specific and quantifiable (or semi-quantifiable) detection of the desired at least one target RNA may be used in the methods herein presented. Such analytical procedures include, but are not limited to, the microarray methods set forth in Example 1 and the RT-PCR methods set forth in Example 6, and methods known to those skilled in the art.

In some embodiments, detection of a target RNA comprises forming a complex comprising a polynucleotide that is complementary to a target RNA or to a complement thereof, and a nucleic acid selected from the target RNA, a DNA amplicon of the target RNA, and a complement of the target RNA. Thus, in some embodiments, the polynucleotide forms a complex with a target RNA. In some embodiments, the polynucleotide forms a complex with a complement of the target RNA, such as a cDNA that has been reverse transcribed from the target RNA. In some embodiments, the polynucleotide forms a complex with a DNA amplicon of the target RNA. When a double-stranded DNA amplicon is part of a complex, as used herein, the complex may comprise one or both strands of the DNA amplicon. Thus, in some embodiments, a complex comprises only one strand of the DNA amplicon. In some embodiments, a complex is a triplex and comprises the polynucleotide and both strands of the DNA amplicon. In some embodiments, the complex is formed by hybridization between the polynucleotide and the target RNA, complement of the target RNA, or DNA amplicon of the target RNA. The polynucleotide, in some embodiments, is a primer or probe.

In some embodiments, a method comprises detecting the complex. In some embodiments, the complex does not have to be associated at the time of detection. That is, in some embodiments, a complex is formed, the complex is then dissociated or destroyed in some manner, and components from the complex are detected. An example of such a system is a TaqMan® assay. In some embodiments, when the polynucleotide is a primer, detection of the complex may comprise amplification of the target RNA, a complement of the target RNA, or a DNA amplicon of a target RNA.

In some embodiments the analytical method used for detecting at least one target RNA in the methods set forth herein includes real-time quantitative RT-PCR. See Chen, C. et al. (2005) Nucl. Acids Res. 33:e179 and PCT Publication No. WO 2007/117256, which are incorporated herein by reference in its entirety. In some embodiments, the analytical method used for detecting at least one target RNA includes the method described in U.S. Publication No. US2009/0123912 A1, which is incorporated herein by reference in its entirety. In an exemplary method described in that publication, an extension primer comprising a first portion and second portion, wherein the first portion selectively hybridizes to the 3′ end of a particular microRNA and the second portion comprises a sequence for universal primer, is used to reverse transcribe the microRNA to make a cDNA. A reverse primer that selectively hybridizes to the 5′ end of the microRNA and a universal primer are then used to amplify the cDNA in a quantitative PCR reaction.

In some embodiments, the analytical method used for detecting at least one target RNA includes the use of a TaqMan® probe. In some embodiments, the analytical method used for detecting at least one target RNA includes a TaqMan® assay, such as the TaqMan® MicroRNA Assays sold by Applied Biosystems, Inc. In an exemplary TaqMan® assay, total RNA is isolated from the sample. In some embodiments, the assay can be used to analyze about 10 ng of total RNA input sample, such as about 9 ng of input sample, such as about 8 ng of input sample, such as about 7 ng of input sample, such as about 6 ng of input sample, such as about 5 ng of input sample, such as about 4 ng of input sample, such as about 3 ng of input sample, such as about 2 ng of input sample, and even as little as about 1 ng of input sample containing microRNAs.

The TaqMan® assay utilizes a stem-loop primer that is specifically complementary to the 3′-end of a target RNA. In an exemplary TaqMan® assay, hybridizing the stem-loop primer to the target RNA is followed by reverse transcription of the target RNA template, resulting in extension of the 3′ end of the primer. The result of the reverse transcription is a chimeric (DNA) amplicon with the step-loop primer sequence at the 5′ end of the amplicon and the cDNA of the target RNA at the 3′ end. Quantitation of the target RNA is achieved by real time RT-PCR using a universal reverse primer having a sequence that is complementary to a sequence at the 5′ end of all stem-loop target RNA primers, a target RNA-specific forward primer, and a target RNA sequence-specific TaqMan® probe.

The assay uses fluorescence resonance energy transfer (“FRET”) to detect and quantitate the synthesized PCR product. Typically, the TaqMan® probe comprises a fluorescent dye molecule coupled to the 5′-end and a quencher molecule coupled to the 3′-end, such that the dye and the quencher are in close proximity, allowing the quencher to suppress the fluorescence signal of the dye via FRET. When the polymerase replicates the chimeric amplicon template to which the TaqMan® probe is bound, the 5′-nuclease of the polymerase cleaves the probe, decoupling the dye and the quencher so that FRET is abolished and a fluorescence signal is generated. Fluorescence increases with each RT-PCR cycle proportionally to the amount of probe that is cleaved.

Additional exemplary methods for RNA detection and/or quantification are described, e.g., in U.S. Publication No. US 2007/0077570 (Lao et al.), PCT Publication No. WO 2007/025281 (Tan et al.), U.S. Publication No. US2007/0054287 (Bloch), PCT Publication No. WO2006/0130761 (Bloch), and PCT Publication No. WO 2007/011903 (Lao et al.), which are incorporated by reference herein in their entireties for any purpose.

In some embodiments, quantitation of the results of real-time RT-PCR assays is done by constructing a standard curve from a nucleic acid of known concentration and then extrapolating quantitative information for target RNAs of unknown concentration. In some embodiments, the nucleic acid used for generating a standard curve is an RNA (e.g., microRNA) of known concentration. In some embodiments, the nucleic acid used for generating a standard curve is a purified double-stranded plasmid DNA or a single-stranded DNA generated in vitro.

In some embodiments, where the amplification efficiencies of the target nucleic acids and the endogenous reference are approximately equal, quantitation is accomplished by the comparative Ct (cycle threshold, e.g., the number of PCR cycles required for the fluorescence signal to rise above background) method. Ct values are inversely proportional to the amount of nucleic acid target in a sample. In some embodiments, Ct values of the target RNA of interest can be compared with a control or calibrator, such as RNA (e.g., microRNA) from normal tissue. In some embodiments, the Ct values of the calibrator and the target RNA samples of interest are normalized to an appropriate endogenous housekeeping gene.

In addition to the TaqMan® assays, other real-time RT-PCR chemistries useful for detecting and quantitating PCR products in the methods presented herein include, but are not limited to, Molecular Beacons, Scorpion probes and intercalating dyes, such as SYBR Green, EvaGreen, thiazole orange, YO-PRO, TO-PRO, etc., which are discussed below.

In some embodiments, real-time RT-PCR detection is performed specifically to detect and quantify the expression of a single target RNA. The target RNA, in some embodiments, is selected from a target RNA capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1 to 41 set forth in Table 1 and SEQ ID NOs: 133 to 211 set forth in Table 11. In some embodiments, the target RNA specifically hybridizes to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. In some embodiments, the target RNA specifically hybridizes to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12. In some embodiments, the target RNA specifically hybridizes to a nucleic acid comprising a sequence selected from SEQ ID NOs: 142, 151, 153, 193, 194, 205, 172, 208, 210, and 211. In some embodiments, the target RNA specifically hybridizes to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1, 5, 7, and 32. In some embodiments, the target RNA comprises at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. In some embodiments, the target RNA comprises a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211. In some embodiments, a target RNA, in its mature form, comprises fewer than 30 nucleotides. In some embodiments, a target RNA is a microRNA.

As described above, in some embodiments, in addition to detecting expression of one or more target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1 to 41 and SEQ ID NOs: 133 to 211, and/or detecting expression of at least one target RNA comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 and/or detecting expression of at least one target RNA comprising a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211, the methods comprise detection of expression of one or more microRNAs selected from miR-21, miR-31, miR-182, miR-183, miR-155, miR-9, miR-199a*, miR-199a, miR-199b, miR-145, miR-133a, miR-133b, miR-214, miR-127, miR-205, miR-210, miR-146a, miR-301, miR-142-5p, miR-194, miR-215, miR-32, miR-374b, miR-933, miR-769-3p, miR-671, miR-934, miR-935, miR-937, miR-938, miR-939, miR-940, miR-941, miR-942, miR-943, miR-944, miR-708, miR-874-5p, and miR-874-3p.

In various other embodiments, real-time RT-PCR detection is utilized to detect, in a single multiplex reaction, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 target RNAs. At least one target RNA, in some embodiments, is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211. In some embodiments, at least one target RNA comprises at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. In some embodiments, at least one target RNA comprises a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211. In some embodiments, a target RNA, in its mature form, comprises fewer than 30 nucleotides. In some embodiments, a target RNA is a microRNA.

In some embodiments, the method comprises detecting expression in a multiplex RT-PCR reaction of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 target RNAs, wherein each target RNA is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, and 8. In some embodiments, the method comprises detecting greater than normal expression, using a single multiplex RT-PCR reaction, of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 12 target RNAs, wherein each target RNA is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12. In some embodiments, the method comprises detecting greater than normal expression, using a single multiplex RT-PCR reaction, of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 12 target RNAs, wherein each target RNA is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 142, 151, 153, 193, 194, 205, 172, 208, 210, and 211. In some embodiments, the method comprises detecting expression in a multiplex RT-PCR reaction of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 target RNAs, wherein each target RNA is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1, 4, 5, 7, 12, 17, 25, 26, 32.

In some multiplex embodiments, a plurality of probes, such as TaqMan® probes, each specific for a different RNA target, is used. In some embodiments, each target RNA-specific probe is spectrally distinguishable from the other probes used in the same multiplex reaction.

In some embodiments, quantitation of real-time RT PCR products is accomplished using a dye that binds to double-stranded DNA products, such as SYBR Green, EvaGreen, thiazole orange, YO-PRO, TO-PRO, etc. In some embodiments, the assay is the QuantiTect SYBR Green PCR assay from Qiagen. In this assay, total RNA is first isolated from a sample. Total RNA is subsequently poly-adenylated at the 3′-end and reverse transcribed using a universal primer with poly-dT at the 5′-end. In some embodiments, a single reverse transcription reaction is sufficient to assay multiple target RNAs. Real-time RT-PCR is then accomplished using target RNA-specific primers and an miScript Universal Primer, which comprises a poly-dT sequence at the 5′-end. SYBR Green dye binds non-specifically to double-stranded DNA and upon excitation, emits light. In some embodiments, buffer conditions that promote highly-specific annealing of primers to the PCR template (e.g., available in the QuantiTect SYBR Green PCR Kit from Qiagen) can be used to avoid the formation of non-specific DNA duplexes and primer dimers that will bind SYBR Green and negatively affect quantitation. Thus, as PCR product accumulates, the signal from SYBR Green increases, allowing quantitation of specific products.

Real-time RT-PCR is performed using any RT-PCR instrumentation available in the art. Typically, instrumentation used in real-time RT-PCR data collection and analysis comprises a thermal cycler, optics for fluorescence excitation and emission collection, and optionally a computer and data acquisition and analysis software.

In some embodiments, the analytical method used in the methods described herein is a DASL® (cDNA-mediated Annealing, Selection, Extension, and Ligation) Assay, such as the MicroRNA Expression Profiling Assay available from Illumina, Inc. (See http://www.illumina.com/downloads/MicroRNAAssayWorkflow.pdf). In some embodiments, total RNA is isolated from a sample to be analyzed by any method. Additionally, in some embodiments, small RNAs are isolated from a sample to be analyzed by any method. Total RNA or isolated small RNAs may then be polyadenylated (>18 A residues are added to the 3′-ends of the RNAs in the reaction mixture). The RNA is reverse transcribed using a biotin-labeled DNA primer that comprises from the 5′ to the 3′ end, a sequence that includes a PCR primer site and a poly-dT region that binds to the poly-dA tail of the sample RNA. The resulting biotinylated cDNA transcripts are then hybridized to a solid support via a biotin-streptavidin interaction and contacted with one or more target RNA-specific polynucleotides. The target RNA-specific polynucleotides comprise, from the 5′-end to the 3′-end, a region comprising a PCR primer site, region comprising an address sequence, and a target RNA-specific sequence.

In some DASL® embodiments, the target RNA-specific sequence comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides having a sequence identically present in one of SEQ ID NOs: 1 to 41 and 133 to 211. In some embodiments, the target RNA-specific sequence comprises a probe sequence that is complementary to at least a portion of a microRNA of the human miRNome, such as miR-21, miR-31, miR-182, miR-183, miR-155, miR-9, miR-199a*, miR-199a, miR-199b, miR-145, miR-133a, miR-133b, miR-205, miR-214, miR-127, miR-210, miR-146a, miR-301, miR-142-5p, miR-194, miR-215, miR-32, miR-374b, miR-933, miR-769-3p, miR-671, miR-934, miR-935, miR-937, miR-938, miR-939, miR-940, miR-941, miR-942, miR-943, miR-944, miR-708, miR-874-5p, and miR-874-3p.

After hybridization, the target RNA-specific polynucleotide is extended, and the extended products are then eluted from the immobilized cDNA array. A second PCR reaction using a fluorescently-labeled universal primer generates a fluorescently-labeled DNA comprising the target RNA-specific sequence. The labeled PCR products are then hybridized to a microbead array for detection and quantitation.

In some embodiments, the analytical method used for detecting and quantifying the expression of the at least one target RNA in the methods described herein is a bead-based flow cytometric assay. See Lu J. et al. (2005) Nature 435:834-838, which is incorporated herein by reference in its entirety. An example of a bead-based flow cytometric assay is the xMAP® technology of Luminex, Inc. (See http://www.luminexcorp.com/technology/index.html). In some embodiments, total RNA is isolated from a sample and is then labeled with biotin. The labeled RNA is then hybridized to target RNA-specific capture probes (e.g., FlexmiR™ products sold by Luminex, Inc. at http://www.luminexcorp.com/products/assays/index.html) that are covalently bound to microbeads, each of which is labeled with 2 dyes having different fluorescence intensities. A streptavidin-bound reporter molecule (e.g., streptavidin-phycoerythrin, also known as “SAPE”) is attached to the captured target RNA and the unique signal of each bead is read using flow cytometry. In some embodiments, the RNA sample (total RNA or enriched small RNAs) is first polyadenylated, and is subsequently labeled with a biotinylated 3DNA™ dendrimer (i.e., a multiple-arm DNA with numerous biotin molecules bound thereto), such as those sold by Marligen Biosciences as the Vantage™ microRNA Labeling Kit, using a bridging polynucleotide that is complementary to the 3′-end of the poly-dA tail of the sample RNA and to the 5′-end of the polynucleotide attached to the biotinylated dendrimer. The streptavidin-bound reporter molecule is then attached to the biotinylated dendrimer before analysis by flow cytometry. See http://www.marligen.com/vantage-microrna-labeling-kit.html. In some embodiments, biotin-labeled RNA is first exposed to SAPE, and the RNA/SAPE complex is subsequently exposed to an anti-phycoerythrin antibody attached to a DNA dendrimer, which can be bound to as many as 900 biotin molecules. This allows multiple SAPE molecules to bind to the biotinylated dendrimer through the biotin-streptavidin interaction, thus increasing the signal from the assay.

In some embodiments, the analytical method used for detecting and quantifying the expression of the at least one target RNA in the methods described herein is by gel electrophoresis and detection with labeled probes (e.g., probes labeled with a radioactive or chemiluminescent label), such as by Northern blotting. In some embodiments, total RNA is isolated from the sample, and then is size-separated by SDS polyacrylamide gel electrophoresis. The separated RNA is then blotted onto a membrane and hybridized to radiolabeled complementary probes. In some embodiments, exemplary probes contain one or more affinity-enhancing nucleotide analogs as discussed below, such as locked nucleic acid (“LNA”) analogs, which contain a bicyclic sugar moiety instead of deoxyribose or ribose sugars. See, e.g., Varallyay, E. et al. (2008) Nature Protocols 3(2):190-196, which is incorporated herein by reference in its entirety. In some embodiments, the total RNA sample can be further purified to enrich for small RNAs. In some embodiments, target RNAs can be amplified by, e.g., rolling circle amplification using a long probe that is complementary to both ends of a target RNA (“padlocked probes”), ligation to circularize the probe followed by rolling circle replication using the target RNA hybridized to the circularized probe as a primer. See, e.g., Jonstrup, S. P. et al. (2006) RNA 12:1-6, which is incorporated herein by reference in its entirety. The amplified product can then be detected and quantified using, e.g., gel electrophoresis and Northern blotting.

In alternative embodiments, labeled probes are hybridized to isolated total RNA in solution, after which the RNA is subjected to rapid ribonuclease digestion of single-stranded RNA, e.g., unhybridized portions of the probes or unhybridized target RNAs. In these embodiments, the ribonuclease treated sample is then analyzed by SDS-PAGE and detection of the radiolabeled probes by, e.g., Northern blotting. See mirVana™ miRNA Detection Kit sold by Applied Biosystems, Inc. product literature at http://www.ambion.com/catalog/CatNum.php?1552.

In some embodiments, the analytical method used for detecting and quantifying the at least one target RNA in the methods described herein is by hybridization to a microarray. See, e.g., Liu, C. G. et al. (2004) Proc. Nat'l Acad. Sci. USA 101:9740-9744; Lim, L. P. et al. (2005) Nature 433:769-773, each of which is incorporated herein by reference in its entirety, and Example 1.

In some embodiments, detection and quantification of a target RNA using a microarray is accomplished by surface plasmon resonance. See, e.g., Nanotech News (2006), available at http://nano.cancer.gov/news_center/nanotech_news_2006-10-30b.asp. In these embodiments, total RNA is isolated from a sample being tested. Optionally, the RNA sample is further purified to enrich the population of small RNAs. After purification, the RNA sample is bound to an addressable microarray containing probes at defined locations on the microarray. Nonlimiting exemplary probes include probes comprising sequences set forth in SEQ ID NOs: 1 to 41 and 133 to 211. Exemplary probes also include, but are not limited to, probes comprising a region that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. Exemplary probes also include, but are not limited to, probes comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211. In some embodiments, the probes contain one or more affinity-enhancing nucleotide analogs as discussed below, such as locked nucleic acid (“LNA”) nucleotide analogs. After hybridization to the microarray, the RNA that is hybridized to the array is first polyadenylated, and the array is then exposed to gold particles having poly-dT bound to them. The amount of bound target RNA is quantitated using surface plasmon resonance.

In some embodiments, microarrays are utilized in a RNA-primed, Array-based Klenow Enzyme (“RAKE”) assay. See Nelson, P. T. et al. (2004) Nature Methods 1(2):1-7; Nelson, P. T. et al. (2006) RNA 12(2):1-5, each of which is incorporated herein by reference in its entirety. In some embodiments, total RNA is isolated from a sample. In some embodiments, small RNAs are isolated from a sample. The RNA sample is then hybridized to DNA probes immobilized at the 5′-end on an addressable array. The DNA probes comprise, in some embodiments, from the 5′-end to the 3′-end, a first region comprising a “spacer” sequence which is the same for all probes, a second region comprising three thymidine-containing nucleosides, and a third region comprising a sequence that is complementary to a target RNA of interest.

Exemplary target RNAs of interest include, but are not limited to, target RNAs capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211, and target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388, and target RNAs comprising a region that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211. Target RNAs also include target RNAs in the miRNome that do not specifically hybridize to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211. In some embodiments, a target RNA, in its mature form, comprises fewer than 30 nucleotides. In some embodiments, a target RNA is a microRNA.

After the sample is hybridized to the array, it is exposed to exonuclease I to digest any unhybridized probes. The Klenow fragment of DNA polymerase I is then applied along with biotinylated dATP, allowing the hybridized target RNAs to act as primers for the enzyme with the DNA probe as template. The slide is then washed and a streptavidin-conjugated fluorophore is applied to detect and quantitate the spots on the array containing hybridized and Klenow-extended target RNAs from the sample.

In some embodiments, the RNA sample is reverse transcribed. In some embodiments, the RNA sample is reverse transcribed using a biotin/poly-dA random octamer primer. When than primer is used, the RNA template is digested and the biotin-containing cDNA is hybridized to an addressable microarray with bound probes that permit specific detection of target RNAs. In typical embodiments, the microarray includes at least one probe comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides identically present in, or complementary to a region of, a sequence selected from SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388. After hybridization of the cDNA to the microarray, the microarray is exposed to a streptavidin-bound detectable marker, such as a fluorescent dye, and the bound cDNA is detected. See Liu C. G. et al. (2008) Methods 44:22-30, which is incorporated herein by reference in its entirety.

In some embodiments, target RNAs are detected and quantified in an ELISA-like assay using probes bound in the wells of microtiter plates. See Mora J. R. and Getts R. C. (2006) BioTechniques 41:420-424 and supplementary material in BioTechniques 41(4):1-5; U.S. Patent Publication No. 2006/0094025 to Getts et al., each of which is incorporated by reference herein in its entirety. In these embodiments, a sample of RNA that is enriched in small RNAs is either polyadenylated, or is reverse transcribed and the cDNA is polyadenylated. The RNA or cDNA is hybridized to probes immobilized in the wells of a microtiter plates, wherein each of the probes comprises a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211, or 345 to 388, or a sequence such as one or more sequences of target RNAs (or the reverse complement thereof) of the human miRNome, depending on whether RNA or cDNA is hybridized to the array. In some embodiments, the hybridized RNAs are labeled using a capture sequence, such as a DNA dendrimer (such as those available from Genisphere, Inc., http://www.genisphere.comiabout3dna.html) that is labeled with a plurality of biotin molecules or with a plurality of horseradish peroxidase molecules, and a bridging polynucleotide that contains a poly-dT sequence at the 5′-end that binds to the poly-dA tail of the captured nucleic acid, and a sequence at the 3′-end that is complementary to a region of the capture sequence. If the capture sequence is biotinylated, the microarray is then exposed to streptavidin-bound horseradish peroxidase. Hybridization of target RNAs is detected by the addition of a horseradish peroxidase substrate such as tetramethylbenzidine (TMB) and measurement of the absorbance of the solution at 450 nM.

In still other embodiments, an addressable microarray is used to detect a target RNA using quantum dots. See Liang, R. Q. et al. (2005) Nucl. Acids Res. 33(2):e17, available at http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=548377, which is incorporated herein by reference in its entirety. In some embodiments, total RNA is isolated from a sample. In some embodiments, small RNAs are isolated from the sample. The 3′-ends of the target RNAs are biotinylated using biotin-X-hydrazide. The biotinylated target RNAs are captured on a microarray comprising immobilized probes comprising sequences that are identically present in, or complementary to a region of, one or more of SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388 and/or probes comprising sequences other than those that are complementary to one or more microRNAs of the human miRNome. The hybridized target RNAs are then labeled with quantum dots via a biotin-streptavidin binding. A confocal laser causes the quantum dots to fluoresce and the signal can be quantified. In alternative embodiments, small RNAs can be detected using a colorimetric assay. In these embodiments, small RNAs are labeled with streptavidin-conjugated gold followed by silver enhancement. The gold nanoparticules bound to the hybridized target RNAs catalyze the reduction of silver ions to metallic silver, which can then be detected colorimetrically with a CCD camera

In some embodiments, detection and quantification of one or more target RNAs is accomplished using microfluidic devices and single-molecule detection. In some embodiments, target RNAs in a sample of isolated total RNA are hybridized to two probes, one which is complementary to nucleic acids at the 5′-end of the target RNA and the second which is complementary to the 3′-end of the target RNA. Each probe comprises, in some embodiments, one or more affinity-enhancing nucleotide analogs, such as LNA nucleotide analogs and each is labeled with a different fluorescent dye having different fluorescence emission spectra. The sample is then flowed through a microfluidic capillary in which multiple lasers excite the fluorescent probes, such that a unique coincident burst of photons identifies a particular target RNA, and the number of particular unique coincident bursts of photons can be counted to quantify the amount of the target RNA in the sample. See U.S. Patent Publication No. 2006/0292616 to Neely et al., which is hereby incorporated by reference in its entirety. In some alternative embodiments, a target RNA-specific probe can be labeled with 3 or more distinct labels selected from, e.g., fluorophores, electron spin labels, etc., and then hybridized to an RNA sample, such as total RNA, or a sample that is enriched in small RNAs. Nonlimiting exemplary target RNA-specific probes include probes comprising sequences selected from of SEQ ID NOs: 1 to 41 and 133 to 211. Nonlimiting exemplary target RNA-specific probes include probes comprising sequences that are complementary to sequences selected from of SEQ ID NOs: 1 to 41 and 133 to 211. Nonlimiting exemplary target RNA-specific probes also include probes comprising at least 15 contiguous nucleotides of, or the complement of at least 15 contiguous nucleotides of, a sequence selected from SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388.

Optionally, the sample RNA is modified before hybridization. The target RNA/probe duplex is then passed through channels in a microfluidic device and that comprise detectors that record the unique signal of the 3 labels. In this way, individual molecules are detected by their unique signal and counted. See U.S. Pat. Nos. 7,402,422 and 7,351,538 to Fuchs et al., U.S. Genomics, Inc., each of which is incorporated herein by reference in its entirety.

In some embodiments, the detection and quantification of one or more target RNAs is accomplished by a solution-based assay, such as a modified Invader assay. See Allawi H. T. et al. (2004) RNA 10:1153-1161, which is incorporated herein by reference in its entirety. In some embodiments, the modified invader assay can be performed on unfractionated detergent lysates of cervical cells. In other embodiments, the modified invader assay can be performed on total RNA isolated from cells or on a sample enriched in small RNAs. The target RNAs in a sample are annealed to two probes which form hairpin structures. A first probe has a hairpin structure at the 5′ end and a region at the 3′-end that has a sequence that is complementary to the sequence of a region at the 5′-end of a target RNA. The 3′-end of the first probe is the “invasive polynucleotide”. A second probe has, from the 5′ end to the 3′-end a first “flap” region that is not complementary to the target RNA, a second region that has a sequence that is complementary to the 3′-end of the target RNA, and a third region that forms a hairpin structure. When the two probes are bound to a target RNA target, they create an overlapping configuration of the probes on the target RNA template, which is recognized by the Cleavase enzyme, which releases the flap of the second probe into solution. The flap region then binds to a complementary region at the 3′-end of a secondary reaction template (“SRT”). A FRET polynucleotide (having a fluorescent dye bound to the 5′-end and a quencher that quenches the dye bound closer to the 3′ end) binds to a complementary region at the 5′-end of the SRT, with the result that an overlapping configuration of the 3′-end of the flap and the 5′-end of the FRET polynucleotide is created. Cleavase recognizes the overlapping configuration and cleaves the 5′-end of the FRET polynucleotide, generates a fluorescent signal when the dye is released into solution.

4.1.5. Exemplary Polynucleotides

In some embodiments, polynucleotides are provided. In some embodiments, synthetic polynucleotides are provided. Synthetic polynucleotides, as used herein, refer to polynucleotides that have been synthesized in vitro either chemically or enzymatically. Chemical synthesis of polynucleotides includes, but is not limited to, synthesis using polynucleotide synthesizers, such as OligoPilot (GE Healthcare), ABI 3900 DNA Synthesizer (Applied Biosystems), and the like. Enzymatic synthesis includes, but is not limited, to producing polynucleotides by enzymatic amplification, e.g., PCR.

In some embodiments, a polynucleotide is provided that comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388, and sequences complementary to SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388. In some embodiments, the polynucleotide further comprises a region having a sequence that is not found in, or complementary to, any of SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388. In some embodiments, a polynucleotide is provided that comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 7, 9 to 37, 133 to 201, and 345 to 388, and sequences complementary to SEQ ID NOs: 1 to 7, 9 to 37, 133 to 201, and 345 to 388. In some embodiments, the polynucleotide further comprises a region having a sequence that is not found in, or complementary to, any of SEQ ID NOs: 1 to 7, 9 to 37, 133 to 201, and 345 to 388.

In various embodiments, a polynucleotide comprises fewer than 500, fewer than 300, fewer than 200, fewer than 150, fewer than 100, fewer than 75, fewer than 50, fewer than 40, or fewer than 30 nucleotides. In various embodiments, a polynucleotide is between 8 and 200, between 8 and 150, between 8 and 100, between 8 and 75, between 8 and 50, between 8 and 40, or between 8 and 30 nucleotides long.

In some embodiments, the polynucleotide is a primer. In some embodiments, the primer is labeled with a detectable moiety. In some embodiments, a primer is not labeled. A primer, as used herein, is a polynucleotide that is capable of specifically hybridizing to a target RNA or to a cDNA reverse transcribed from the target RNA or to an amplicon that has been amplified from a target RNA or a cDNA (collectively referred to as “template”), and, in the presence of the template, a polymerase and suitable buffers and reagents, can be extended to form a primer extension product.

In some embodiments, the polynucleotide is a probe. In some embodiments, the probe is labeled with a detectable moiety. A detectable moiety, as used herein, includes both directly detectable moieties, such as fluorescent dyes, and indirectly detectable moieties, such as members of binding pairs. When the detectable moiety is a member of a binding pair, in some embodiments, the probe can be detectable by incubating the probe with a detectable label bound to the second member of the binding pair. In some embodiments, a probe is not extendable, e.g., by a polymerase. In other embodiments, a probe is extendable.

In some embodiments, the polynucleotide is a FRET probe that in some embodiments is labeled at the 5′-end with a fluorescent dye (donor) and at the 3′-end with a quencher (acceptor), a chemical group that absorbs (i.e., suppresses) fluorescence emission from the dye when the groups are in close proximity (i.e., attached to the same probe). In other embodiments, the donor and acceptor are not at the ends of the FRET probe. Thus, in some embodiments, the emission spectrum of the donor moiety should overlap considerably with the absorption spectrum of the acceptor moiety.

4.1.5.1. Exemplary Polynucleotide Modifications

In some embodiments, the methods of detecting at least one target RNA described herein employ one or more polynucleotides that have been modified, such as polynucleotides comprising one or more affinity-enhancing nucleotide analogs. Modified polynucleotides useful in the methods described herein include primers for reverse transcription, PCR amplification primers, and probes. In some embodiments, the incorporation of affinity-enhancing nucleotides increases the binding affinity and specificity of a polynucleotide for its target nucleic acid as compared to polynucleotides that contain only deoxyribonucleotides, and allows for the use of shorter polynucleotides or for shorter regions of complementarity between the polynucleotide and the target nucleic acid.

In some embodiments, affinity-enhancing nucleotide analogs include nucleotides comprising one or more base modifications, sugar modifications and/or backbone modifications.

In some embodiments, modified bases for use in affinity-enhancing nucleotide analogs include 5-methylcytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, 2-chloro-6-aminopurine, xanthine and hypoxanthine.

In some embodiments, affinity-enhancing nucleotide analogs include nucleotides having modified sugars such as 2′-substituted sugars, such as 2′-O-alkyl-ribose sugars, 2′-amino-deoxyribose sugars, 2′-fluoro-deoxyribose sugars, 2′-fluoro-arabinose sugars, and 2′-O-methoxyethyl-ribose (2′MOE) sugars. In some embodiments, modified sugars are arabinose sugars, or d-arabino-hexitol sugars.

In some embodiments, affinity-enhancing nucleotide analogs include backbone modifications such as the use of peptide nucleic acids (PNA; e.g., an oligomer including nucleobases linked together by an amino acid backbone). Other backbone modifications include phosphorothioate linkages, phosphodiester modified nucleic acids, combinations of phosphodiester and phosphorothioate nucleic acid, methylphosphonate, alkylphosphonates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, carbonates, phosphate triesters, acetamidates, carboxymethyl esters, methylphosphorothioate, phosphorodithioate, p-ethoxy, and combinations thereof.

In some embodiments, a polynucleotide includes at least one affinity-enhancing nucleotide analog that has a modified base, at least nucleotide (which may be the same nucleotide) that has a modified sugar, and/or at least one internucleotide linkage that is non-naturally occurring.

In some embodiments, an affinity-enhancing nucleotide analog contains a locked nucleic acid (“LNA”) sugar, which is a bicyclic sugar. In some embodiments, a polynucleotide for use in the methods described herein comprises one or more nucleotides having an LNA sugar. In some embodiments, a polynucleotide contains one or more regions consisting of nucleotides with LNA sugars. In other embodiments, a polynucleotide contains nucleotides with LNA sugars interspersed with deoxyribonucleotides. See, e.g., Frieden, M. et al. (2008) Curr. Pharm. Des. 14(11):1138-1142.

4.1.5.2. Exemplary Primers

In some embodiments, a primer is provided. In some embodiments, a primer is identical or complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of a target RNA. In some embodiments, a primer may also comprise portions or regions that are not identical or complementary to the target RNA. In some embodiments, a region of a primer that is identical or complementary to a target RNA is contiguous, such that any region of a primer that is not identical or complementary to the target RNA does not disrupt the identical or complementary region.

In some embodiments, a primer comprises a portion that is identically present in a target RNA. In some such embodiments, a primer that comprises a region that is identically present in the target RNA is capable of selectively hybridizing to a cDNA that has been reverse transcribed from the RNA, or to an amplicon that has been produced by amplification of the target RNA or cDNA. In some embodiments, the primer is complementary to a sufficient portion of the cDNA or amplicon such that it selectively hybridizes to the cDNA or amplicon under the conditions of the particular assay being used.

As used herein, “selectively hybridize” means that a polynucleotide, such as a primer or probe, will hybridize to a particular nucleic acid in a sample with at least 5-fold greater affinity than it will hybridize to another nucleic acid present in the same sample that has a different nucleotide sequence in the hybridizing region. Exemplary hybridization conditions are discussed in Example 1. In some embodiments, a polynucleotide will hybridize to a particular nucleic acid in a sample with at least 10-fold greater affinity than it will hybridize to another nucleic acid present in the same sample that has a different nucleotide sequence in the hybridizing region.

Nonlimiting exemplary primers include primers comprising sequences that are identically present in, or complementary to a region of, sequences selected from SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388. Exemplary primers also include, but are not limited to, primers comprising regions that are identical or complementary to at least 15 contiguous nucleotides of sequences selected from SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388.

In some embodiments, a primer is used to reverse transcribe a target RNA, for example, as discussed herein. In some embodiments, a primer is used to amplify a target RNA or a cDNA reverse transcribed therefrom. Such amplification, in some embodiments, is quantitative PCR, for example, as discussed herein. In some embodiments, a primer comprises a detectable moiety.

4.1.5.3. Exemplary Probes

In various embodiments, methods of detecting the presence of a cervical dysplasia comprise hybridizing nucleic acids of a human cervical sample with a probe. In some embodiments, the probe comprises a portion that is complementary to a target RNA. In some embodiments, the probe comprises a portion that is identically present in the target RNA. In some such embodiments, a probe that is complementary to a target RNA is complementary to a sufficient portion of the target RNA such that it selectively hybridizes to the target RNA under the conditions of the particular assay being used. In some embodiments, a probe that is complementary to a target RNA is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of the target RNA. In some embodiments, a probe that is complementary to a target RNA comprises a region that is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of the target RNA. That is, a probe that is complementary to a target RNA may also comprise portions or regions that are not complementary to the target RNA. In some embodiments, a region of a probe that is complementary to a target RNA is contiguous, such that any region of a probe that is not complementary to the target RNA does not disrupt the complementary region.

In some embodiments, the probe comprises a portion that is identically present in the target RNA. In some such embodiments, a probe that comprises a region that is identically present in the target RNA is capable of selectively hybridizing to a cDNA that has been reverse transcribed from the RNA, or to an amplicon that has been produced by amplification of the target RNA or cDNA. In some embodiments, the probe is complementary to a sufficient portion of the cDNA or amplicon such that it selectively hybridizes to the cDNA or amplicon under the conditions of the particular assay being used. In some embodiments, a probe that is complementary to a cDNA or amplicon is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of the cDNA or amplicon. In some embodiments, a probe that is complementary to a target RNA comprises a region that is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of the cDNA or amplicon. That is, a probe that is complementary to a cDNA or amplicon may also comprise portions or regions that are not complementary to the cDNA or amplicon. In some embodiments, a region of a probe that is complementary to a cDNA or amplicon is contiguous, such that any region of a probe that is not complementary to the cDNA or amplicon does not disrupt the complementary region.

Nonlimiting exemplary probes include probes comprising sequences set forth in SEQ ID NOs: 1 to 41 and 133 to 211. Nonlimiting exemplary probes include probes comprising sequences that are identically present in, or complementary to a region of, sequences selected from SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388. Exemplary probes also include, but are not limited to, probes comprising regions that are identical or complementary to at least 15 contiguous nucleotides of sequences selected from SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388.

In some embodiments, the method of detectably quantifying one or more target RNAs comprises: (a) isolating total RNA; (b) reverse transcribing a target RNA to produce a cDNA that is complementary to the target RNA; (c) amplifying the cDNA from (b); and (d) detecting the amount of a target RNA using real time RT-PCR and a detection probe.

As described above, in some embodiments, the real time RT-PCR detection is performed using a FRET probe, which includes, but is not limited to, a TaqMan® probe, a Molecular beacon probe and a Scorpion probe. In some embodiments, the real time RT-PCR detection and quantification is performed with a TaqMan® probe, i.e., a linear probe that typically has a fluorescent dye covalently bound at one end of the DNA and a quencher molecule covalently bound at the other end of the DNA. The FRET probe comprises a sequence that is complementary to a region of the cDNA such that, when the FRET probe is hybridized to the cDNA, the dye fluorescence is quenched, and when the probe is digested during amplification of the cDNA, the dye is released from the probe and produces a fluorescence signal. In such embodiments, the amount of target RNA in the sample is proportional to the amount of fluorescence measured during cDNA amplification.

The TaqMan® probe typically comprises a region of contiguous nucleotides having a sequence that is complementary to a region of a target RNA or its complementary cDNA that is reverse transcribed from the target RNA template (i.e., the sequence of the probe region is complementary to or identically present in the target RNA to be detected) such that the probe is specifically hybridizable to the resulting PCR amplicon. In some embodiments, the probe comprises a region of at least 6 contiguous nucleotides having a sequence that is fully complementary to or identically present in a region of a cDNA that has been reverse transcribed from a target RNA template, such as comprising a region of at least 8 contiguous nucleotides, at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, or at least 16 contiguous nucleotides having a sequence that is complementary to or identically present in a region of a cDNA reverse transcribed from a target RNA to be detected.

In some embodiments, the region of the cDNA that has a sequence that is complementary to the TaqMan® probe sequence is at or near the center of the cDNA molecule. In some embodiments, there are independently at least 2 nucleotides, such as at least 3 nucleotides, such as at least 4 nucleotides, such as at least 5 nucleotides of the cDNA at the 5′-end and at the 3′-end of the region of complementarity.

In some embodiments, Molecular Beacons can be used to detect and quantitate PCR products. Like TaqMan® probes, Molecular Beacons use FRET to detect and quantitate a PCR product via a probe having a fluorescent dye and a quencher attached at the ends of the probe. Unlike TaqMan® probes, Molecular Beacons remain intact during the PCR cycles. Molecular Beacon probes form a stem-loop structure when free in solution, thereby allowing the dye and quencher to be in close enough proximity to cause fluorescence quenching. When the Molecular Beacon hybridizes to a target, the stem-loop structure is abolished so that the dye and the quencher become separated in space and the dye fluoresces. Molecular Beacons are available, e.g., from Gene Link™ (see http://www.genelink.com/newsite/products/mbintro.asp).

In some embodiments, Scorpion probes can be used as both sequence-specific primers and for PCR product detection and quantitation. Like Molecular Beacons, Scorpion probes form a stem-loop structure when not hybridized to a target nucleic acid. However, unlike Molecular Beacons, a Scorpion probe achieves both sequence-specific priming and PCR product detection. A fluorescent dye molecule is attached to the 5′-end of the Scorpion probe, and a quencher is attached to the 3′-end. The 3′ portion of the probe is complementary to the extension product of the PCR primer, and this complementary portion is linked to the 5′-end of the probe by a non-amplifiable moiety. After the Scorpion primer is extended, the target-specific sequence of the probe binds to its complement within the extended amplicon, thus opening up the stem-loop structure and allowing the dye on the 5′-end to fluoresce and generate a signal. Scorpion probes are available from, e.g, Premier Biosoft International (see http://www.premierbiosoft.com/tech_notes/Scorpion.html).

In some embodiments, labels that can be used on the FRET probes include colorimetric and fluorescent labels such as Alexa Fluor dyes, BODIPY dyes, such as BODIPY FL; Cascade Blue; Cascade Yellow; coumarin and its derivatives, such as 7-amino-4-methylcoumarin, aminocoumarin and hydroxycoumarin; cyanine dyes, such as Cy3 and Cy5; eosins and erythrosins; fluorescein and its derivatives, such as fluorescein isothiocyanate; macrocyclic chelates of lanthanide ions, such as Quantum Dye™; Marina Blue; Oregon Green; rhodamine dyes, such as rhodamine red, tetramethylrhodamine and rhodamine 6G; Texas Red; fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer; and, TOTAB.

Specific examples of dyes include, but are not limited to, those identified above and the following: Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500. Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, and, Alexa Fluor 750; amine-reactive BODIPY dyes, such as BODIPY 493/503, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/655, BODIPY FL, BODIPY R6G, BODIPY TMR, and, BODIPY-TR; Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, 2′,4′,5′,7′-Tetrabromosulfonefluorescein, and TET.

Specific examples of fluorescently labeled ribonucleotides useful in the preparation of RT-PCR probes for use in some embodiments of the methods described herein are available from Molecular Probes (Invitrogen), and these include, Alexa Fluor 488-5-UTP, Fluorescein-12-UTP, BODIPY FL-14-UTP, BODIPY TMR-14-UTP, Tetramethylrhodamine-6-UTP, Alexa Fluor 546-14-UTP, Texas Red-5-UTP, and BODIPY TR-14-UTP. Other fluorescent ribonucleotides are available from Amersham Biosciences (GE Healthcare), such as Cy3-UTP and Cy5-UTP.

Examples of fluorescently labeled deoxyribonucleotides useful in the preparation of RT-PCR probes for use in the methods described herein include Dinitrophenyl (DNP)-1′-dUTP, Cascade Blue-7-dUTP, Alexa Fluor 488-5-dUTP, Fluorescein-12-dUTP, Oregon Green 488-5-dUTP, BODIPY FL-14-dUTP, Rhodamine Green-5-dUTP, Alexa Fluor 532-5-dUTP, BODIPY TMR-14-dUTP, Tetramethylrhodamine-6-dUTP, Alexa Fluor 546-14-dUTP, Alexa Fluor 568-5-dUTP, Texas Red-12-dUTP, Texas Red-5-dUTP, BODIPY TR-14-dUTP, Alexa Fluor 594-5-dUTP, BODIPY 630/650-14-dUTP, BODIPY 650/665-14-dUTP; Alexa Fluor 488-7-OBEA-dCTP, Alexa Fluor 546-16-OBEA-dCTP, Alexa Fluor 594-7-OBEA-dCTP, Alexa Fluor 647-12-OBEA-dCTP. Fluorescently labeled nucleotides are commercially available and can be purchased from, e.g., Invitrogen.

In some embodiments, dyes and other moieties, such as quenchers, are introduced into polynucleotide used in the methods described herein, such as FRET probes, via modified nucleotides. A “modified nucleotide” refers to a nucleotide that has been chemically modified, but still functions as a nucleotide. In some embodiments, the modified nucleotide has a chemical moiety, such as a dye or quencher, covalently attached, and can be introduced into a polynucleotide, for example, by way of solid phase synthesis of the polynucleotide. In other embodiments, the modified nucleotide includes one or more reactive groups that can react with a dye or quencher before, during, or after incorporation of the modified nucleotide into the nucleic acid. In specific embodiments, the modified nucleotide is an amine-modified nucleotide, i.e., a nucleotide that has been modified to have a reactive amine group. In some embodiments, the modified nucleotide comprises a modified base moiety, such as uridine, adenosine, guanosine, and/or cytosine. In specific embodiments, the amine-modified nucleotide is selected from 5-(3-aminoallyl)-UTP; 8-[(4-amino)butyl]-amino-ATP and 8-[(6-amino)butyl]-amino-ATP; N6-(4-amino)butyl-ATP, N6-(6-amino)butyl-ATP, N4-[2,2-oxy-bis-(ethylamine)]-CTP; N6-(6-Amino)hexyl-ATP; 8-[(6-Amino)hexyl]-amino-ATP; 5-propargylamino-CTP, 5-propargylamino-UTP. In some embodiments, nucleotides with different nucleobase moieties are similarly modified, for example, 5-(3-aminoallyl)-GTP instead of 5-(3-aminoallyl)-UTP. Many amine modified nucleotides are commercially available from, e.g., Applied Biosystems, Sigma, Jena Bioscience and TriLink.

Exemplary detectable moieties also include, but are not limited to, members of binding pairs. In some such embodiments, a first member of a binding pair is linked to a polynucleotide. The second member of the binding pair is linked to a detectable label, such as a fluorescent label. When the polynucleotide linked to the first member of the binding pair is incubated with the second member of the binding pair linked to the detectable label, the first and second members of the binding pair associate and the polynucleotide can be detected. Exemplary binding pairs include, but are not limited to, biotin and streptavidin, antibodies and antigens, etc.

In some embodiments, multiple target RNAs are detected in a single multiplex reaction. In some such embodiments, each probe that is targeted to a unique cDNA is spectrally distinguishable when released from the probe. Thus, each target RNA is detected by a unique fluorescence signal.

One skilled in the art can select a suitable detection method for a selected assay, e.g., a real-time RT-PCR assay. The selected detection method need not be a method described above, and may be any method.

4.2. Exemplary Compositions and Kits

In another aspect, compositions are provided. In some embodiments, compositions are provided for use in the methods described herein.

In some embodiments, a composition comprises at least one polynucleotide. In some embodiments, a composition comprises at least one primer. In some embodiments, a composition comprises at least one probe. In some embodiments, a composition comprises at least one primer and at least one probe.

In some embodiments, compositions are provided that comprise at least one target RNA-specific primer. The term “target RNA-specific primer” encompasses primers that have a region of contiguous nucleotides having a sequence that is (i) identically present in one of SEQ ID NOs: 1 to 41 or 133 to 211, (ii) complementary to the sequence of a region of contiguous nucleotides found in one of SEQ ID NOs: 1 to 41 or 133 to 211; (iii) complementary to the sequence of a region of contiguous nucleotides found in one of SEQ ID NOs: 345 to 388; or (iv) identically present in one of SEQ ID NOs: 345 to 388.

In some embodiments, compositions are provided that comprise at least one target RNA-specific probe. The term “target RNA-specific probe” encompasses probes that have a region of contiguous nucleotides having a sequence that is (i) identically present in one of SEQ ID NOs: 1 to 41 or 133 to 211, (ii) complementary to the sequence of a region of contiguous nucleotides found in one of SEQ ID NOs: 1 to 41 or 133 to 211; (iii) complementary to the sequence of a region of contiguous nucleotides found in one of SEQ ID NOs: 345 to 388; or (iv) identically present in one of SEQ ID NOs: 345 to 388.

In some embodiments, target RNA-specific primers and probes comprise deoxyribonucleotides. In other embodiments, target RNA-specific primers and probes comprise at least one nucleotide analog. Nonlimiting exemplary nucleotide analogs include, but are not limited to, analogs described herein, including LNA analogs and peptide nucleic acid (PNA) analogs. In some embodiments, target RNA-specific primers and probes comprise at least one nucleotide analog which increases the hybridization binding energy (e.g., an affinity-enhancing nucleotide analog, discussed above). In some embodiments, a target RNA-specific primer or probe in the compositions described herein binds to one target RNA in the sample. In some embodiments, a single primer or probe binds to multiple target RNAs, such as multiple isomirs.

In some embodiments, more than one primer or probe specific for a single target RNA is present in the compositions, the primers or probes capable of binding to overlapping or spatially separated regions of the target RNA.

It will be understood, even if not explicitly stated hereinafter, that in some embodiments in which the compositions described herein are designed to hybridize to cDNAs reverse transcribed from target RNAs, the composition comprises at least one target RNA-specific primer or probe (or region thereof) having a sequence that is identically present in a target RNA (or region thereof).

In some embodiments, a target RNA is capable of specifically hybridizing to at least one probe comprising a sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7 and 8. In some embodiments, a target RNA is capable of specifically hybridizing to at least one nucleic acid probe comprising a sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12. In some embodiments, a target RNA is capable of specifically hybridizing to at least one nucleic acid probe comprising a sequence selected from SEQ ID NOs: 142, 151, 153, 193, 194, 205, 172, 208, 210, and 211. In some embodiments, a target RNA is capable of specifically hybridizing to at least one nucleic acid probe comprising a sequence selected from SEQ ID NOs: 1, 5, 7, and 32. In some embodiments, a target RNA is capable of specifically hybridizing to at least one probe comprising a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211. In some embodiments, a target RNA comprises at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. In some embodiments, a target RNA comprises a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211. In some embodiments, a target RNA, in its mature form, comprises fewer than 30 nucleotides. In some embodiments, a target RNA is a microRNA.

In some embodiments, the composition comprises a plurality of target RNA-specific primers and/or probes for each of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 target RNAs, the target RNAs comprising a region of contiguous nucleotides having a sequence that is identically present in one of SEQ ID NOs: 42, 43, 44, 45, 46, 47, 48, or 49. In some embodiments, the plurality includes a target RNA-specific primer and/or probe specific for each of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 target RNAs, the target RNAs comprising a region of contiguous nucleotides having a sequence that is identically present in one of SEQ ID NOs: 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, and 53. In some embodiments, the plurality includes a target RNA-specific primer and/or probe specific for each of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 75, or at least 100 target RNAs comprising a region of contiguous nucleotides having a sequence that is identically present in one of SEQ ID NOs: 42 to 82 or 226 to 317. It will be understood that, in some embodiments, target RNAs described herein comprise a sequence identically present in a sequence set forth in Table 2 or Table 12, except that thymine (T) bases in the sequences shown in Table 2 or Table 12 are replaced by uracil (U) bases in the target RNAs.

In some embodiments, a composition is an aqueous composition. In some embodiments, the aqueous composition comprises a buffering component, such as phosphate, tris, HEPES, etc., and/or additional components, as discussed below. In some embodiments, a composition is dry, for example, lyophilized, and suitable for reconstitution by addition of fluid. A dry composition may include a buffering component and/or additional components.

In some embodiments, a composition comprises one or more additional components. Additional components include, but are not limited to, salts, such as NaCl, KCl, and MgCl2; polymerases, including thermostable polymerases; dNTPs; RNase inhibitors; bovine serum albumin (BSA) and the like; reducing agents, such as β-mercaptoethanol; EDTA and the like; etc. One skilled in the art can select suitable composition components depending on the intended use of the composition.

In some embodiments, an addressable microarray component is provided that comprises target RNA-specific probes attached to a substrate.

Microarrays for use in the methods described herein comprise a solid substrate onto which the probes are covalently or non-covalently attached. In some embodiments, probes capable of hybridizing to one or more target RNAs or cDNAs are attached to the substrate at a defined location (“addressable array”). Probes can be attached to the substrate in a wide variety of ways, as will be appreciated by those in the art. In some embodiments, the probes are synthesized first and subsequently attached to the substrate. In other embodiments, the probes are synthesized on the substrate. In some embodiments, probes are synthesized on the substrate surface using techniques such as photopolymerization and photolithography.

In some embodiments, the solid substrate is a material that is modified to contain discrete individual sites appropriate for the attachment or association of the probes and is amenable to at least one detection method. Representative examples of substrates include glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, TeflonJ, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses and plastics. In some embodiments, the substrates allow optical detection without appreciably fluorescing.

In some embodiments, the substrate is planar. In other embodiments, probes are placed on the inside surface of a tube, such as for flow-through sample analysis to minimize sample volume. In other embodiments, probes can be in the wells of multi-well plates. In still other embodiments, probes can be attached to an addressable microbead array. In yet other embodiments, the probes can be attached to a flexible substrate, such as a flexible foam, including closed cell foams made of particular plastics.

The substrate and the probe can each be derivatized with functional groups for subsequent attachment of the two. For example, in some embodiments, the substrate is derivatized with one or more chemical functional groups including, but not limited to, amino groups, carboxyl groups, oxo groups and thiol groups. In some embodiments, probes are attached directly to the substrate through one or more functional groups. In some embodiments, probes are attached to the substrate indirectly through a linker (i.e., a region of contiguous nucleotides that space the probe regions involved in hybridization and detection away from the substrate surface). In some embodiments, probes are attached to the solid support through the 5′ terminus. In other embodiments, probes are attached through the 3′ terminus. In still other embodiments, probes are attached to the substrate through an internal nucleotide. In some embodiments the probe is attached to the solid support non-covalently, e.g., via a biotin-streptavidin interaction, wherein the probe biotinylated and the substrate surface is covalently coated with streptavidin.

In some embodiments, the compositions comprise a microarray having probes attached to a substrate, wherein at least one of the probes (or a region thereof) comprises a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211, or SEQ ID NOs: 345 to 388. In some embodiments, at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, or at least 100 of the probes comprise a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211, or 345 to 388. In some embodiments, the microarray comprises at least one target RNA-specific probe comprising a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211, or 345 to 388 and at least one target RNA-specific probe comprising a sequence that is identically present in, or complementary to a region of, a target RNA set forth in Table 3. In some embodiments, the microarray comprises each target RNA-specific probe at only one location on the microarray. In some embodiments, the microarray comprises at least one target RNA-specific probe at multiple locations on the microarray.

As used herein, the terms “complementary” or “partially complementary” to a target RNA (or target region thereof), and the percentage of “complementarity” of the probe sequence to that of the target RNA sequence is the percentage “identity” to the reverse complement of the sequence of the target RNA. In determining the degree of “complementarity” between probes used in the compositions described herein (or regions thereof) and a target RNA, such as those disclosed herein, the degree of “complementarity” is expressed as the percentage identity between the sequence of the probe (or region thereof) and the reverse complement of the sequence of the target RNA that best aligns therewith. The percentage is calculated by counting the number of aligned bases that are identical as between the 2 sequences, dividing by the total number of contiguous nucleotides in the probe, and multiplying by 100.

In some embodiments, the microarray comprises at least one probe having a region with a sequence that is fully complementary to a target region of a target RNA. In other embodiments, the microarray comprises at least one probe having a region with a sequence that comprises one or more base mismatches when compared to the sequence of the best-aligned target region of a target RNA.

In some embodiments, the microarray comprises at least one probe having a region of at least 10, at least 11, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41 or 133 to 211. In some embodiments, the microarray comprises at least one probe having a region of at least 10, at least 11, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41 or 133 to 211, and at least one probe comprising a region of at least 10, at least 11, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides having a sequence that is identically present in, or complementary to a region of, a target RNA set forth in Table 3.

In some embodiments, the microarray comprises at least one probe having a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. In some embodiments, the microarray comprises at least one, at least two, at least three, at least five, or eight probes that each comprise a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7 or 8. In some embodiments, the microarray further comprises additional probes that do not have a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7 and 8.

In some embodiments, the microarray comprises at least one probe having a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12. In some embodiments, the microarray comprises at least one, at least two, at least three, at least five, at least eight, at least 10, or at least 12 probes that each comprise a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12. In some embodiments, the microarray further comprises additional probes that do not have a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12.

In some embodiments, the microarray comprises at least one probe having a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 142, 151, 153, 193, 194, 205, 172, 208, 210, and 211. In some embodiments, the microarray comprises at least one, at least two, at least three, at least five, at least eight, or at least 10 probes that each comprise a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 142, 151, 153, 193, 194, 205, 172, 208, 210, and 211. In some embodiments, the microarray further comprises additional probes that do not have a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 142, 151, 153, 193, 194, 205, 172, 208, 210, and 211.

In some embodiments, the microarray comprises at least one probe having a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 5, 7, or 32. In some embodiments, the microarray comprises at least one, at least two, at least three, or at least four probes that each comprise a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 5, 7, or 32. In some embodiments, the microarray further comprises additional probes that do not have a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 5, 7, or 32.

In some embodiments, the microarrays comprise probes having a region with a sequence that is complementary to target RNAs that comprise a substantial portion of the human miRNome (i.e., the publicly known microRNAs that have been accessioned by others into miRBase (http://microrna.sanger.ac.uk/ at the time the microarray is fabricated), such as at least about 60%, at least about 70%, at least about 80%, at least about 90%, even at least about 95% of the human miRNome. In some embodiments, the microarrays comprise probes that have a region with a sequence that is identically present in target RNAs that comprise a substantial portion of the human miRNome, such as at least about 60%, at least about 70%, at least about 80%, at least about 90%, even at least about 95% of the human miRNome.

In some embodiments, components are provided that comprise probes attached to microbeads, such as those sold by Luminex, each of which is internally dyed with red and infrared fluorophores at different intensities to create a unique signal for each bead. In some embodiments, the compositions useful for carrying out the methods described herein include a plurality of microbeads, each with a unique spectral signature. Each uniquely labeled microbead is attached to a unique target RNA-specific probe such that the unique spectral signature from the dyes in the bead is associated with a particular probe sequence. Nonlimiting exemplary probe sequences include SEQ ID NOs: 1 to 41 and 133 to 211. Nonlimiting exemplary probe sequences also include probes comprising a region that is identically present in, or complementary to, a sequence selected from SEQ ID NOs: 1 to 41, 133 to 211, and SEQ ID NOs: 345 to 388. In some embodiments, a probe sequence comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides that are identically present in, or complementary to a region of, SEQ ID NOs: 1 to 41, 133 to 211, and SEQ ID NOs: 345 to 388.

In some embodiments, a uniquely labeled microbead has attached thereto a probe having a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211, or 345 to 388. In other embodiments, the uniquely labeled microbead has attached thereto a probe having a region with a sequence that comprises one or more base mismatches when compared to the most similar sequence selected from SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388, and sequences complementary to SEQ ID NOs: 1 to 41, 133 to 211.

In some embodiments, a composition is provided that comprises a plurality of uniquely labeled microbeads, wherein at least one microbead has attached thereto a probe having a region of at least 10, at least 11, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211 or 345 to 388. In some embodiments, a composition comprises a plurality of uniquely labeled microbeads, wherein at least one of the microbeads has attached thereto a probe having a region of at least 10, at least 11, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211, or 345 to 388, and at least a second microbead having attached thereto a probe comprising a region of at least 10, at least 11, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides having a sequence that is identically present in, or complementary to a region of, a target RNA set forth in Table 3.

In some embodiments, the compositions comprise a plurality of uniquely labeled microbeads, at least one of which has attached thereto a target RNA-specific probe having a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. In some embodiments, the compositions comprise at least two, at least three, at least five, or at least 8 uniquely labeled microbeads that each have attached thereto a unique target RNA-specific probe having a region with a sequence that is identically present in, or complementary to a region of, a different one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7 or 8. In some embodiments, the composition comprises at least one uniquely labeled microbead having attached thereto a target RNA-specific probe having a region with a sequence that is not present in, or complementary to a region of, any of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.

In some embodiments, the compositions comprise plurality of uniquely labeled microbeads, wherein at least one microbead has attached thereto a probe having a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12. In some embodiments, the compositions comprise at least two, at least three, at least five, at least eight, at least 10, or at least 12 uniquely labeled microbeads that each have attached thereto a unique target RNA-specific probe having a region with a sequence that is identically present in, or complementary to a region of, a different one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12. In some embodiments, the composition comprises at least one uniquely labeled microbead having attached thereto a target RNA-specific probe having a region with a sequence that is not present in, or complementary to a region of, any of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12.

In some embodiments, the compositions comprise plurality of uniquely labeled microbeads, wherein at least one microbead has attached thereto a probe having a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 142, 151, 153, 193, 194, 205, 172, 208, 210, and 211. In some embodiments, the compositions comprise at least two, at least three, at least five, at least eight, or at least 10 uniquely labeled microbeads that each have attached thereto a unique target RNA-specific probe having a region with a sequence that is identically present in, or complementary to a region of, a different one of SEQ ID NOs: 142, 151, 153, 193, 194, 205, 172, 208, 210, and 211. In some embodiments, the composition comprises at least one uniquely labeled microbead having attached thereto a target RNA-specific probe having a region with a sequence that is not present in, or complementary to a region of, any of SEQ ID NOs: 142, 151, 153, 193, 194, 205, 172, 208, 210, and 211.

In some embodiments, the compositions comprise plurality of uniquely labeled microbeads, wherein at least one microbead has attached thereto a probe having a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 5, 7, or 32. In some embodiments, the compositions comprise at least two, at least three, or at least four uniquely labeled microbeads that each have attached thereto a unique target RNA-specific probe having a region with a sequence that is identically present in, or complementary to a region of, a different one of SEQ ID NOs: 1, 5, 7, or 32. In some embodiments, the composition comprises at least one uniquely labeled microbead having attached thereto a target RNA-specific probe having a region with a sequence that is not present in, or complementary to a region of, any of SEQ ID NOs: 1, 5, 7, or 32.

In some embodiments, the compositions comprise a plurality of uniquely labeled microbeads, wherein the plurality comprises at least one microbead having attached thereto a probe having a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211, or SEQ ID NOs: 345 to 388. In some embodiments, the plurality comprises at least two, at least five, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 75, or at least 100 microbeads each of which having attached thereto a probe having a region with a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211, or 345 to 388. In some embodiments, a composition comprises at least one uniquely labeled microbead having attached thereto a target RNA-specific probe having a region with a sequence that is not present in, or complementary to a region of, any of SEQ ID NOs: 1 to 41 or 133 to 211.

In some embodiments, the compositions comprise a plurality of uniquely labeled microbeads, at least one of which has attached thereto a probe having a region with a sequence that identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211, or 345 to 388, and at least a second bead that has attached thereto a probe having a region with a sequence that is identically present in, or complementary to a region of, a target RNA set forth in Table 3.

In some embodiments, the compositions comprise a plurality of uniquely labeled microbeads, each of which has attached thereto a unique probe having a region that is complementary to target RNAs that comprise a substantial portion of the human miRNome, such as at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% of the human miRNome. In some embodiments, the compositions comprise a plurality of uniquely labeled microbeads having attached thereto a unique probe having a region with a sequence that is identically present in target RNAs that comprise a substantial portion of the human miRNome, such as at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% of the human miRNome.

In some embodiments, compositions are provided that comprise at least one polynucleotide for detecting at least one target RNA. In some embodiments, the polynucleotide is used as a primer for a reverse transcriptase reaction. In some embodiments, the polynucleotide is used as a primer for amplification. In some embodiments, the polynucleotide is used as a primer for RT-PCR. In some embodiments, the polynucleotide is used as a probe for detecting at least one target RNA. In some embodiments, the polynucleotide is detectably labeled. In some embodiments, the polynucleotide is a FRET probe. In some embodiments, the polynucleotide is a TaqMan® probe, a Molecular Beacon, or a Scorpion probe.

In some embodiments, a composition comprises at least one FRET probe having a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211, or 345 to 388. In some embodiments, a composition comprises at least two, at least five, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 75, or at least 100 FRET probes, each of which has a sequence that is identically present in, or complementary to a region of, a different one of SEQ ID NOs: 1 to 41, 133 to 211, or 345 to 388. In some embodiments, a FRET probe is labeled with a donor/acceptor pair such that when the probe is digested during the PCR reaction, it produces a unique fluorescence emission that is associated with a specific target RNA. In some embodiments, when a composition comprises multiple FRET probes, each probe is labeled with a different donor/acceptor pair such that when the probe is digested during the PCR reaction, each one produces a unique fluorescence emission that is associated with a specific probe sequence and/or target RNA. In some embodiments, the sequence of the FRET probe is complementary to a target region of a target RNA. In other embodiments, the FRET probe has a sequence that comprises one or more base mismatches when compared to the sequence of the best-aligned target region of a target RNA.

In some embodiments, a composition comprises a FRET probe consisting of at least 8, at least 9, at least 10, at least 11, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides, wherein at least a portion of the sequence is identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388. In some embodiments, at least 8, at least 9, at least 10, at least 11, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides of the FRET probe are identically present in, or complementary to a region of, one of SEQ ID NOs: 1 to 41, 133 to 211, and 345 to 388. In some embodiments, the FRET probe has a sequence with one, two or three base mismatches when compared to the sequence or complement of one of SEQ ID NOs: 1 to 41 or 133 to 211.

In some embodiments, the compositions further comprise a FRET probe consisting of at least 10, at least 11, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides, wherein the FRET probe comprises a sequence that is identically present in, or complementary to a region of, a region of a target RNA set forth in Table 3. In some embodiments, the FRET probe is identically present in, or complementary to a region of, at least at least 10, at least 11, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of a target RNA set forth in Table 3.

In some embodiments, the compositions comprise at least one target RNA-specific FRET probe comprising a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. In some embodiments, the compositions comprise at least two, at least three, at least five, or at least 8 uniquely labeled target RNA-specific FRET probes, each comprising a sequence that is identically present in, or complementary to a region of, a different one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7 and 8.

In some embodiments, the compositions comprise at least one target RNA-specific FRET probe comprising a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12. In some embodiments, the compositions comprise at least two, at least three, at least five, at least eight, at least 10, or at least 12 uniquely labeled target RNA-specific FRET probes, each of which comprises a sequence that is identically present in, or complementary to a region of, a different one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12.

In some embodiments, the compositions comprise at least one target RNA-specific FRET probe comprising a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 142, 151, 153, 193, 194, 205, 172, 208, 210, and 211. In some embodiments, the compositions comprise at least two, at least three, at least five, at least eight, at least nine, or at least 10 uniquely labeled target RNA-specific FRET probes, each of which comprises a sequence that is identically present in, or complementary to a region of, a different one of SEQ ID NOs: 142, 151, 153, 193, 194, 205, 172, 208, 210, and 211.

In some embodiments, the compositions comprise at least one target RNA-specific FRET probe comprising a sequence that is identically present in, or complementary to a region of, one of SEQ ID NOs: 1, 5, 7, or 32. In some embodiments, the compositions comprise at least two, at least three, or at least four uniquely labeled target RNA-specific FRET probes, each of which comprises a sequence that is identically present in, or complementary to a region of, a different one of SEQ ID NOs: 1, 5, 7, or 32.

In some embodiments, a kit comprises a polynucleotide discussed above. In some embodiments, a kit comprises at least one primer and/or probe discussed above. In some embodiments, a kit comprises at least one polymerase, such as a thermostable polymerase. In some embodiments, a kit comprises dNTPs. In some embodiments, kits for use in the real time RT-PCR methods described herein comprise one or more target RNA-specific FRET probes and/or one or more primers for reverse transcription of target RNAs and/or one or more primers for amplification of target RNAs or cDNAs reverse transcribed therefrom.

In some embodiments, one or more of the primers and/or probes is “linear”. A “linear” primer refers to a polynucleotide that is a single stranded molecule, and typically does not comprise a short region of, for example, at least 3, 4 or 5 contiguous nucleotides, which are complementary to another region within the same polynucleotide such that the primer forms an internal duplex. In some embodiments, the primers for use in reverse transcription comprise a region of at least 4, such as at least 5, such as at least 6, such as at least 7 or more contiguous nucleotides at the 3′-end that has a sequence that is complementary to region of at least 4, such as at least 5, such as at least 6, such as at least 7 or more contiguous nucleotides at the 5′-end of a target RNA.

In some embodiments, a kit comprises one or more pairs of linear primers (a “forward primer” and a “reverse primer”) for amplification of a cDNA reverse transcribed from a target RNA. Accordingly, in some embodiments, a first primer comprises a region of at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 contiguous nucleotides having a sequence that is identical to the sequence of a region of at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 contiguous nucleotides at the 5′-end of a target RNA. Furthermore, in some embodiments, a second primer comprises a region of at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 contiguous nucleotides having a sequence that is complementary to the sequence of a region of at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 contiguous nucleotides at the 3′-end of a target RNA. In some embodiments, the kit comprises at least a first set of primers for amplification of a cDNA that is reverse transcribed from a target RNA capable of specifically hybridizing to a nucleic acid comprising a sequence identically present in one of SEQ ID NOs: 1 to 41 and 133 to 211 and/or a cDNA that is reverse transcribed from a target RNA that comprises at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. In some embodiments, the kit further comprises at least a second set of primers for amplification of a cDNA that is reverse transcribed from a target RNA set forth in Table 3.

In some embodiments, the kit comprises at least two, at least five, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 75, or at least 100 sets of primers, each of which is for amplification of a cDNA that is reverse transcribed from a different target RNA capable of specifically hybridizing to a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211 and/or a cDNA that is reverse transcribed from a target RNA that comprises at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. In some embodiments, the kit comprises at least one set of primers that is capable of amplifying more than one cDNA reverse transcribed from a target RNA in a sample.

In some embodiments, probes and/or primers for use in the compositions described herein comprise deoxyribonucleotides. In some embodiments, probes and/or primers for use in the compositions described herein comprise deoxyribonucleotides and one or more nucleotide analogs, such as LNA analogs or other duplex-stabilizing nucleotide analogs described above. In some embodiments, probes and/or primers for use in the compositions described herein comprise all nucleotide analogs. In some embodiments, the probes and/or primers comprise one or more duplex-stabilizing nucleotide analogs, such as LNA analogs, in the region of complementarity.

In some embodiments, the compositions described herein also comprise probes, and in the case of RT-PCR, primers, that are specific to one or more housekeeping genes for use in normalizing the quantities of target RNAs. Such probes (and primers) include those that are specific for one or more products of housekeeping genes selected from U6 snRNA, ACTB, B2M, GAPDH, GUSB, HPRT1, PPIA, RPLP, RRN18S, TBP, TUBB, UBC, YWHA (TATAA), PGK1, and RPL4.

In some embodiments, the kits for use in real time RT-PCR methods described herein further comprise reagents for use in the reverse transcription and amplification reactions. In some embodiments, the kits comprise enzymes such as reverse transcriptase, and a heat stable DNA polymerase, such as Taq polymerase. In some embodiments, the kits further comprise deoxyribonucleotide triphosphates (dNTP) for use in reverse transcription and amplification. In further embodiments, the kits comprise buffers optimized for specific hybridization of the probes and primers.

4.2.1. Exemplary Normalization of RNA Levels

In some embodiments, quantitation of target RNA expression levels requires assumptions to be made about the total RNA per cell and the extent of sample loss during sample preparation. In order to correct for differences between different samples or between samples that are prepared under different conditions, the quantities of target RNAs in some embodiments are normalized to the expression of at least one endogenous housekeeping gene.

Appropriate genes for use as reference genes in the methods described herein include those as to which the quantity of the product does not vary between normal and dysplastic or cancerous cervical cells, or between different cell lines or under different growth and sample preparation conditions. In some embodiments, endogenous housekeeping genes useful as normalization controls in the methods described herein include, but are not limited to, U6 snRNA, RNU44, RNU 48, and U47. In typical embodiments, the at least one endogenous housekeeping gene for use in normalizing the measured quantity of microRNAs is selected from U6 snRNA, U6 snRNA, RNU44, RNU 48, and U47. In some embodiments, one housekeeping gene is used for normalization. In some embodiments, more than one housekeeping gene is used for normalization.

4.2.2. Exemplary Qualitative Methods

In some embodiments, methods comprise detecting a qualitative change in a target RNA profile generated from a clinical sample of human cervical cells as compared to a normal target RNA profile (in some exemplary embodiments, a target RNA profile of a control sample). Some qualitative changes in the expression profile are indicative of the presence of cervical dysplasia in a sample of human cervical cells. Various qualitative changes in the expression profile are indicative of the propensity to proceed to cervical cancer. The term “target RNA profile” refers to a set of data regarding the concurrent expression of a plurality of target RNAs in the same sample.

In some embodiments, at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight of the target RNAs of the plurality of target RNAs are capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7 and 8. In some embodiments, at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least 10, at least 11, or at least 12 of the target RNAs of the plurality of target RNAs is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12. In some embodiments, at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least 10 of the target RNAs of the plurality of target RNAs is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 142, 151, 153, 193, 194, 205, 172, 208, 210, and 211. In some embodiments, at least one, at least two, at least three, or at least four of the target RNAs of the plurality of target RNAs is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1, 5, 7, and 32.

In some embodiments, at least one, at least two, at least five, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 75, or at least 100 of the plurality of target RNAs is capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211. In some embodiments, at least one, at least two, at least five, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40 of the plurality of target RNAs comprises at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388. In some embodiments, at least one, at least two, at least five, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 75, or at least 100 of the plurality of target RNAs comprises a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1 to 41 and 133 to 211. In some embodiments, a target RNA, in its mature form, comprises fewer than 30 nucleotides. In some embodiments, a target RNA is a microRNA.

Qualitative expression data for use in preparing target RNA expression profiles is obtained using any suitable analytical method, including the analytical methods presented herein.

In some embodiments, for example, concurrent expression data are obtained using, e.g., a microarray, as described above. Thus, in addition to use for quantitative expression level assays of specific target RNAs as described above, a microarray comprising probes having sequences that are complementary to a substantial portion of the miRNome may be employed to carry out target RNA gene expression profiling, for analysis of target RNA expression patterns.

In some embodiments, distinct target RNA signatures are associated with established markers for cervical dysplasia, or directly with the presence of cervical dysplasia. In some embodiments, distinct target RNA signatures are associated with established markers for CIN-1, CIN-2 or CIN-3 cervical dysplasia, or directly with the level of severity of cervical dysplasia. In some embodiments, distinct target RNA signatures are associated with established markers for cervical dysplasia likely to progress to carcinoma, or directly with cervical dysplasia that is likely to progress to carcinoma. In some embodiments, distinct target RNA signatures are associated with HPV infection and/or integration into the genome of the host cell. In some embodiments, distinct target RNA signatures are associated with established markers for cervical cancer, or directly with the presence of cervical cancer.

According to the expression profiling method, in some embodiments, total RNA from a sample from a subject suspected of having cervical dysplasia is quantitatively reverse transcribed to provide a set of labeled polynucleotides complementary to the RNA in the sample. The polynucleotides are then hybridized to a microarray comprising target RNA-specific probes to provide a hybridization profile for the sample. The result is a hybridization profile for the sample representing the expression pattern of target RNAs in the sample. The hybridization profile comprises the signal from the binding of the polynucleotides reverse transcribed from the sample to the target RNA-specific probes in the microarray. In some embodiments, the profile is recorded as the presence or absence of binding (signal vs. zero signal). In some embodiments, the profile recorded includes the intensity of the signal from each hybridization. The profile is compared to the hybridization profile generated from a normal, i.e., noncancerous, or in some embodiments, a control sample. An alteration in the signal is indicative of the presence of cervical dysplasia or cervical cancer in the subject.

4.3. Exemplary Additional Target RNAs

In some embodiments, in combination with detecting one or more target RNAs that are capable of specifically hybridizing to a nucleic acid comprising a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211 and/or detecting one or more target RNAs comprising at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs: 345 to 388 and/or detecting one or more target RNAs that comprise a sequence that is complementary to at least 15 contiguous nucleotides of a sequence selected from SEQ ID NOs:1 to 41 and 133 to 211, methods herein further comprise detecting the level(s) of expression of at least one other marker associated with cervical dysplasia or HPV integration.

Accordingly, in some embodiments, the methods described herein further comprise detecting increased expression of any one or more of miR-21, miR-31, miR-182, miR-183, miR-146a, miR-155, and miR-205. In some embodiments, the methods described herein further comprise detecting increased expression of any one or more of miR-663, miR-765, miR-92b*, miR-936, miR-9, miR-199a*, miR-199a, miR-199b, miR-145, miR-133a, miR-133b, miR-214, miR-127, miR-210, miR-301, miR-142-3p, miR-142-5p, miR-194, miR-215 and miR-32.

In some embodiments, the methods described herein further comprise detecting altered expression of target RNAs associated with HPV integration sites. As used herein, the term “associated with” a given HPV integration site means that the target RNA gene is located in close proximity to the HPV integration site; i.e., when the target RNA is located within the same chromosomal band or within 3 megabases (3 Mb), preferably within 2.5 Mb, of the HPV integration site. Thus, in some embodiments, the methods further comprise detecting increased expression of target RNAs associated with HPV integration sites, such as fragile sites which are preferential targets for HPV16 associated with cervical tumors. Such target RNAs include: miR-186, miR-101 (associated with FRA1A on chromosome 1p36 and FRA1C on chromosome 1p31); miR-194 and miR-215 (associated with FRA1F on chromosome 1q21 and FRA1H on chromosome 1q42.1); miR-106b, miR-25 and miR93 (associated with FRAXF on chromosome 7q22); miR-29b, miR-29a, miR-96, miR-182-5p, miR-182-3p, miR-183, and miR-129-1 (associated with FRA7G on chromosome 7q31.2 and FRA7H on chromosome 7q32.3); let7-1a, let7-d, let-7f-1, miR-23b, miR-24-1, and miR-27b (associated with FRA9D on chromosome 9q22.1); miR-32 (associated with FRA9E on chromosome 9q32-33.1); miR159-1 and miR-192 (associated with FRA11A on chromosome 11q13.3); miR-125b-1, let-7a-2, and miR-100 (associated with FRA11B on chromosome 11q23.3); miR-196-2 and miR-148b (associated with FRA12A on chromosome 12q13.1); miR-190 (associated with FRA15A on chromosome 15q22); miR-21, miR-301, miR-142-5p, and miR-142-3p (associated with FRA17B on chromosome 17q23.1); and miR-105-1 and miR-175 (associated with FRAXF on chromosome Xq28).

In other embodiments, the methods described herein further comprise detecting altered expression of cervical cancer-associated small RNAs with non-canonical hairpins.

In other embodiments, the methods described herein further comprise detecting increased expression of the mRNA of one or more of the following genes: BIRC5, IGF2BP3, TERC, CDKN2A, MCM5, TOP2A, MYBL2, PIK3CA, DROSHA, MKI67, MMP9, and MCM2. In some embodiments, the methods described herein further comprise detecting increased expression of the mRNA of one or more of the following genes: CDKN2A, MKI67, TOP2A, and MCM5. In some embodiments, the methods described herein further comprise detecting increased expression of the mRNA of one or more of the following genes: CDKN2A, MKI67, TOP2A, MCM5, BIRC5, MMP9, and MCM2. Appropriate genes for use as reference genes when detecting mRNA expression include those as to which the quantity of the product does not vary between normal and cancerous cervical cells, or between different cell lines or under different growth and sample preparation conditions. In some embodiments, endogenous housekeeping genes useful as normalization controls in the methods described herein include, but are not limited to, ACTB, B2M, GAPDH, GUSB, HPRT1, PPIA, RPLP, TBP, TUBB, UBC, PGK1 and RPL4. In typical embodiments, the at least one endogenous housekeeping gene for use in normalizing the measured quantity of mRNAs is selected from GAPDH, TBP and ACTB. In some embodiments, one housekeeping gene is used for normalization. In some embodiments, more than one housekeeping gene is used for normalization.

In alternative embodiments, the methods described herein further comprise detecting chromosomal codefendants, i.e., target RNAs clustered near each other in the human genome which tend to be regulated together. Accordingly, in further embodiments, the methods comprise detecting the expression of one or more target microRNAs, each situated within the chromosome no more than 50,000 bp from the chromosomal location of the pre-microRNA sequences in Table 2.

The following examples are for illustration purposes only, and are not meant to be limiting in any way.

5. EXAMPLES

5.1 Example 1: MicroRNAs from Cervical Cancer Cell Lines

Using microarray analysis, 41 distinct microRNAs were demonstrated to be overexpressed in cervical cell lines.

Cell Lines

Total RNA was prepared from eight different cell lines of cervical origin that are commonly used in studies of cervical dysplasia and/or carcinoma. The RNA was used for both microRNA array profiling, further described below, and mRNA expression studies.

As set forth in Table 5 below, cell lines were selected for diversity, deriving from various squamous cervical cancers (SCC) and adenocarcinomas (AC) and, in most cases, chronically infected with HPV. Cell line C-33A appears to be HPV negative, but likely originally contained HPV. In order to identify early molecular markers that indicate a high progression rate from cervical dysplasia to cancer, seven of the eight cell lines chosen were derived from primary lesions. One cell line, ME-180, was derived from a metastatic source. All cell lines were purchased from LGC Promochem (ATCC) and cultured according to ATCC's guidelines.


TABLE 5
ATCC
Cell line
accession no.
Cancer type
HPV-type
C4-I
CRL-1594
carcinoma
HPV18
C4-II
CRL-1595
carcinoma
HPV18
HELA S3
CCL-2.2
adenocarcinoma
HPV18
Ca Ski
CRL-1550
epidermoid carcinoma
HPV16
SIHA
HTB-35
squamous cell carcinoma
HPV16
SW756
CRL-10302
squamous cell carcinoma
HPV18
C-33A
HTB-31
carcinoma
HPV negative
ME-180
HTB-33
epidermoid carcinoma
HPV 68
metastatic site: omentum

All cell lines except for HeLa S3 grew normally. Growth of HeLa S3 was very slow in the beginning of culturing, taking about two weeks before the first passage was done.

Total RNA Preparation and Analysis

Cells from two confluent 75 cm2 flasks were harvested (totaling approximately 107 cells). Total RNA was prepared using TRIzol® (Invitrogen™) according to the manufacturer's protocol. All RNA samples were diluted in RNase-free water and stored in −80° C. (−112° F.). OD260/280 was measured on a spectrophotometer.

The quantity of RNA obtained is set forth in Table 6, below.


TABLE 6
Volume
Total
Ratio
[μg/ml]
μl
μg
28S/18S
CaSki (CRL-1550)
1000
300
300
1.8
sw756 (CRL-10302)
2716
150
407.4
1.5
C33A (HTB-31)
2236
150
335.4
1.6
ME-180 (HTB-33)
1628
150
244.2
1.6
SiHa (HTB-35)
1508
150
226.2
1.4
C4-I (CRL-1594)
1452
150
217.8
1.7
C4-II (CRL-1595)
1656
150
248.4
1.4
HeLa S3 (CCL-2.2)
3954
150
593.1
1.6

RNA quality was assessed by calculating OD 260/280 ratios, and by electrophoresis on agarose gels under denaturing conditions. The quality of all RNA samples was high as assessed using an Agilent Bioanalyser 2100, as exemplified by the electropherogram shown in FIG. 1 obtained for total RNA from cell line CaSki. FIG. 2 shows denaturing gel electrophoresis of total RNA from the cell lines. The quantity was sufficient for microRNA array profiling and quantitative RT-PCR of both microRNA and mRNA.

Total RNA from normal cervix was purchased for use as a control from Ambion (Applied Biosystems).

MicroRNA Enrichment

MicroRNA enrichment was performed using a Flash PAGE Fractionator (Ambion). The gel purification protocol enriches for small RNAs less than about 40 nucleotides (nt) long, including microRNAs. Briefly, a total RNA sample (prepared as above) was loaded onto a pre-cast gel using the Flash PAGE Fractionator. The total RNA fraction smaller than 40 nt (the “microRNA fraction”) was recovered after gel migration and resuspended into nuclease free water.

Microarray Analysis

Probe Design and Spotting

The polynucleotide probes used for microarray preparation had the configuration 5′-NH2—(C)6-(spacer)-(oligomer probe sequence)-3′. The 5′-amino group allowed chemical bonding onto the array support. Each also included an identical spacer sequence of 15 nt, as shown below, to prevent non-specific interactions of the polynucleotide probes with the array support:


(SEQ ID NO: 90)
5′AminoC6-TTGTAATACGACTCA - Oligo probe sequence.

Probe sequences given in Table 1 omit the linker.

The probes were synthesized according to standard protocols by Eurofins MWG Operon (Ebersberg, Germany). Nexterion (Schott) microarray glass slides were used as the solid support for the microarray.

The polynucleotide probe concentration used for the spotting was 25 μmol. The probes were spotted in duplicate using the Nexterion spotting buffer provided with the array glass support by Schott with 1% SDS (sodium dodecyl sulfate) added to allow larger spot sizes (e.g., 100-150 microns compared to 70-100 microns without SDS). The spotter used was the QArray mini (Genetix) equipped with Stealth SMP3 pins (Telechem). After deposition of one series of spots, the spotting needle was washed 5 times with 60 mM NaOH before spotting the next series of probes. Each slide is designed with 32 blocks of spotted probes, with each block being a 20×20 square of spotted probes. Each probe was spotted in duplicate. Spotted glass slides were stored at 4° C. until use.

MicroRNA Labelling

The labelling of the microRNA fraction was adapted from a published protocol developed at EMBL (Heidelberg, Germany) by the European Molecular Biology Group (Castoldi et al., “A sensitive array for microRNA expression profiling (miChip) based on locked nucleic acids (LNA),” RNA 2006 May; 12(5):913-20. Epub 2006 Mar. 15, incorporated herein by reference in its entirety). Briefly, the microRNA fraction was incubated for 6 hours at 4° C. with a mixture containing 10 μM of dye-labelled tetra-nucleotide (5′-rUrUrUrU-Cy5-3′) (or alternatively, 5′-rUrUrUrU-Cy3-3′) (Biospring, Germany) in Ambion buffer diluted to 1× with RNase free water, 8% polyethylene glycol (PEG), 2 mM adenosine triphosphate (ATP), and T4 RNA ligase (0.7 U/μl). The labelling reaction was run by heating the mixture for 15 minutes at 65° C. This procedure ligated the poly-U dye-labelled tail to the 3′ end of all the microRNAs. Labelled samples were stored at 4° C. before hybridization.

Array Hybridization

The labelled microRNA fraction was hybridized to the spotted arrays using a Discovery hybridization station (Ventana, Tucson, Ariz.). Briefly, 2 mL of a mixture of 1% BSA, 2×SSC, and 0.2% SDS was incubated with the chips for 30 min at 42° C. Then the chips were washed once using EZ Prep buffer (Ventana) and then three more times with Ribowash (Ventana). Next, 20 μl of the labelled microRNA mixture and 180 μl of ChipHybe Reagent (Ventana) were added to the array. The arrays were heated for 6 minutes at 37° C., then were incubated at 42° C. for 8 hours, after which the heating was stopped. The chips were washed once with Ribowash (Ventana) and then heated for 2 minutes at 37° C. The chips were washed again with Ribowash (Ventana) with one drop of CheapClean (Ventana) added, and incubated for 2 minutes at 37° C. The chips were washed two more times using Ribowash (Ventana). The chips were then stored dry at room temperature overnight. On the following day, the final washes were done according to Ventana's instructions for the Discovery hybridization station. The slides were washed twice with 2×SSC+0.2×SDS buffer and then one more time with 0.1×SSC. All the slides were dried using a speed centrifuge from Arrayit (TeleChem International, Sunnyvale, Calif.) at room temperature and kept in the dark before scanning.

As an alternative to the ChipHybe Reagent solution (solution 1), the following solution may be used for array hybridization (solution 2) to form probe:target RNA hybrids by mixing 2 parts of 1.5×TMAC Hybridization Solution to 1 part (v:v) sample, so that the final component concentrations are 3M TMAC, 0.10% Sarkosyl, 50 mM Tris, and 4 mM EDTA, and incubating on the array at 42° C. for 8 h:


1.5X TMAC Hybridization Solution
Amount/
Reagent
Catalog Number
Final Conc
250 mL
5M TMAC*
Sigma T3411
4.5M
 225 mL
20% Sarkosyl
0.15%
1.88 mL
1M Tris-HCl, pH 8.0
Sigma T3038
75 mM
18.75 mL 
0.5M EDTA, pH 8.0
Invitrogen
 6 mM
 3.0 mL
15575-020
H2O
1.37 mL
*TMAC is tetramethyl ammonium chloride

Array Image Acquisition

The arrays were scanned using an Axon™ scanner (Molecular Devices, Sunnyvale, Calif.) and their Genepix™ software. The image was formatted in tif format, defined by an image color depth of 16 bits/pixel (1600*1600). At such setting, pixels can assume intensity values ranging from 0 to 65,535. Pixels exhibiting the maximum intensity value are “saturated” and were assigned the value of 65,535. The resolution of the array scan was set at 10 μm/pixel. For hybridization experiments using different fluorescent dyes (e.g., Cy5 and Cy3) the photomultiplier tube (PMT) was adjusted to the higher intensity spot (Cy3 is scanned at lower PMT settings than Cy5).

Array Image Analysis

The PMT of the laser scanner digitized the captured fluorescence intensity for each given “point” of a slide and stored the numerical value as a pixel corresponding to that point. A picture composed of such pixels was then analyzed.

The first task for image analysis was to detect the spot position, using a process called segmentation. Spots were segmented by circles of adaptable or fixed radius. To be reliably segmented and quantified, the spot diameter was required to be more than 5-6 pixels. Before segmentation an indexing grid was provided giving the approximate positions of the spots. The segmentation itself detected the limits of spots near the grid circles. Briefly, the Genepix software assigns a circle to each spot on the array (segmentation). The segmentation had to be conducted in a somewhat flexible way due to spotting imperfections and/or support deformation, as the spots were almost never on a perfectly rectangular grid.

After segmentation by the software, the circles were modified manually and adjusted onto the spots until all the spots on the array were clearly identified. At this stage, if the array presented high background noise preventing real spots from being distinguished from the background, the array was rejected for further analysis.

The second task of image analysis was to quantify spots and export the data into a result file. This was a relatively easy and well-defined task once the spots were located on the image. The statistical approach used most frequently to quantify spot intensity was the mean or median of pixels belonging to a spot. The median approach was more robust than the mean value in the presence of outlier pixels. In practice, however, there was little difference in the results obtained using mean or median.

Array Data Analysis

All the array data were analysed using the R bioconductor package (“Bioconductor: open software development for computational biology and bioinformatics,”Genome Biol. 2004; 5(10):R80. Epub 2004 Sep. 15, which is incorporated herein by reference in its entirety).

Array data were first tested for quality by comparing the spot intensities for the internal controls. One internal control (SEQ ID NO: 83; Table 7) was used as a labelling control (this synthetic RNA is added to the purified microRNA fraction before labelling), and 7 other internal controls (SEQ ID NOs: 84-89 and 405; Table 7) were used for the normalization of the data (these synthetic RNA controls are added to the total RNA fraction before hybridization at 520 fmol each/array). The probe sequences that bind to the synthetic RNAs, and certain mutant probe sequences, are also shown in Table 7 (SEQ ID NOs: 406 to 409 and 212 to 217).


TABLE 7
Control Sequences used in microarray experiments
Sequence (5′-3′)
Sequence identification number
CGCGCGUCGCUUUAUCUACUGU
SEQ ID NO: 83; CTL30_COMP
UUAUCGUUCGAUAAGUCGCGUU
SEQ ID NO: 84; CTL11_COMP
GAAGUUACUAUGUAGGCAACCU
SEQ ID NO: 85; CTL23_COMP
CGCGGGACUAAUUGUUACCGGG
SEQ ID NO: 86; CTL26_COMP
UCGCGUCGAACUCCGCAACCGA
SEQ ID NO: 87; CTL29_COMP
ACCGAACGCCGUACCCAUCGGG
SEQ ID NO: 88; CTL31_COMP
CGAGGGUAACGACUCUCGUGUC
SEQ ID NO: 89; CTL36_COMP
GCGUACCGACGCGUAGACGGAC
SEQ ID NO: 405; CTL13_COMP
TTGTAATACGACTCAACAGTAGATAAAGCGACGCGCG
SEQ ID NO: 406; CTL30
TTGTAATACGACTCAAACGCGACTTATCGAACGATAA
SEQ ID NO: 407; CTL11
TTGTAATACGACTCAAGGTTGCCTACATAGTAACTTC
SEQ ID NO: 408; CTL23
TTGTAATACGACTCACCCGGTAACAATTAGTCCCGCG
SEQ ID NO: 409; CTL26
TTGTAATACGACTCATCGGTTGCGGAGTTCGACGCGA
SEQ ID NO: 212; CTL29
TTGTAATACGACTCACCCGATGGGTACGGCGTTCGGT
SEQ ID NO: 213; CTL31
TTGTAATACGACTCAGACACGAGAGTCGTTACCCTCG
SEQ ID NO: 214; CTL36
TTGTAATACGACTCAGTCCGTCTACGCGTCGGTACGC
SEQ ID NO: 215; CTL13
TTGTAATACGACTCAGGCCGTCTACGCGTCGGTACGC
SEQ ID NO: 216; CTL13_MUT
TTGTAATACGACTCACCCGGTAACAATTAGACCCGCG
SEQ ID NO: 217; CTL26_MUT

All sequences for which the intensity of the spot was higher than the mean local background intensity plus 1.5 times its standard deviation were categorized as expressed microRNAs. The following criteria were required to be met:

    • 1. Specificity of the hybridization controls had to be within acceptance criteria (e.g. CTL26) vs. its corresponding single base mutant, CTL26_MUT, or CTL13 vs. its corresponding single base mutant, CTL13_mut).
    • 2. Approximate equality of the signal intensity of the replicates of the positive controls
    • 3. Approximate equality between median block signal intensities based on the positive controls for each block
    • 4. Approximate equality between median array signals based on all sequences detected
    • 5. Signal intensity for the purification and labelling control (CTL30).

Statistical normalization of the data was done by computing the Log 2ratio where the Log 2ratio equals average intensity signal of the duplicated spots/median intensity of all positives controls for the block. The normalization was done per block to avoid non-homogenous labelling of all blocks of the array. This block-by-block normalization has been shown to be more efficient then using overall normalization of the slide. The obtained values are Log 2 values.

The intensities of the spots for each polynucleotide probe were compared in the sample from the cervical cancer cell line versus normal cervical tissue, resulting in an evaluation of the relative expression for each microRNA.

The expression fold-change corresponds to 2(Log 2ratio). The Log 2ratio is the ratio between the two conditions compared, or log 2(Xcell-line/Xnormal), which is the same as (log 2Xcell-line−log 2Xnormal), where X is the measured intensity value. In cases where there was no signal from the “normal” condition, the lowest measured intensity value in the experiment was used as the baseline from which a fold-change expression value was calculated. A fold-change value of less than zero corresponds to a down-regulation of (1/fold-change) times.

Data are tabulated in Table 1, and include all microRNAs overexpressed in more than 50% of tested cell lines. Expression in HeLa was not used to qualify microRNAs for inclusion in Table 1, because of an observed odd expression and signal pattern.

5.2 Example 2: Analysis of microRNA on Luminex Platform

The Luminex technology (Luminex Corp., Austin, Tex.) is based on liquid phase hybridization to probe-labelled beads, followed by flow cytometry detection of beads with differing ratios of fluorescent dyes. Beads with up to 100 different dye ratios are available, making it possible to interrogate a single sample for up to 100 analytes simultaneously.

Coupling of Probes to Luminex Beads

Aliquots of each 5′-amino-modified probe having sequences as set forth in Example 1 and Table 1 are prepared at a concentration of 0.1 nmol/μL in molecular biology grade water. The probes are coupled to the beads using carbodiimide chemistry according to the manufacturer's protocol (Luminex bead coupling protocol). The probe-coupled beads are stored at 4° C.

Total RNA Preparation for Luminex Analysis

Fifty fmoles of each of 7 internal controls (the same synthetic RNAs used for the array controls) are added to the total RNA fraction isolated from the biological samples. Prior to hybridization with Luminex beads, the total RNA preparation is treated to avoid the formation of dendrimers, which result from the circularization of a single RNA molecule, or concatenation to another RNA molecule. To avoid the formation of dendrimers, the RNA is pre-treated with calf intestinal phosphatase (CIP) to remove the 5′-phosphate groups. The CIP reagent can be obtained from Invitrogen (Carlsbad, Calif.) and the CIP reaction is run according to the manufacturer's protocol.

Bead Labelling and Hybridization

After CIP treatment, the total RNA fraction is then labelled with biotin using the Vantage microRNA Labelling Kit (Marligen). The labelled fraction is hybridized to the Luminex beads using the Marligen protocol. Briefly, the polynucleotide beads are mixed with the Marligen hybridization solution (1.5×TMAC) and the labelled total RNA. The hybridization is performed at 60° C. for an hour in the dark. After hybridization, the beads are washed using the Luminex standard 6×SSPET wash buffer (sodium phosphate, sodium chloride, EDTA, Triton X-100, pH 7.4).

Detection of Bead Hybridization

The detection of the Luminex beads is done using streptavidin phycoerythrin (SAPE) (Europa Bioproducts, Cambridge, UK). The SAPE is added to the washed beads according to the Luminex protocol. The beads are then read using the Luminex IS-200 instrument using the high gain setting for better resolution.

Data Acquisition and Analysis

The Luminex IS-200 reads at least 25 beads of each dye-ratio in the reaction mix. Each dye-ratio bead corresponds to a particular probe sequence, and the intensity value is returned as an average value of all read beads. The mean fluorescence intensity (MFI) data is normalized using synthetic RNA controls, and fold changes between normal and diseased samples are computed using the Bioplex software (Bio-Rad, Hercules, Calif.) and the R bioconductor package (Bioconductor: open software development for computational biology and bioinformatics, Genome Biol. 2004; 5(10):R80. Epub 2004 Sep. 15).

5.3 Example 3: MicroRNAs from Clinical Cervix Samples

Tissue Samples

Archived formalin-fixed, paraffin-embedded (FFPE) blocks from cervical tumors were cut into 10 to 20 μm sections. Three to four sections per sample were extracted using RecoverAll™ Total Nucleic Acid Isolation Kit (Applied Biosystems, Inc.; Foster City, Calif.) according to the manufacturer's protocol. RNA samples were diluted in RNase-free water and stored in −80° C. (−112° F.).

Archived or freshly snap-frozen specimens from cervical tumors were also used. Tissue samples were homogenized by mortar and pestle in TRIzol® Reagent (Invitrogen; Carlsbad, Calif.) and RNA was extracted according to manufacturer's protocol. RNA samples were diluted in RNase-free water and stored in −80° C. (−112° F.).

The cervical samples used in this experiment are shown in Table 8:


TABLE 8
Clinical samples
Sample
Sample
name
type
Description
ASCC-1a
FFPE
AdenoSquamous Cervical
Carcinoma (ASCC)
SCC-1a
FFPE
Squamous Cervical
Carcinoma (SCC)
SCC-2
FFPE
SCC
ADC-1a
FFPE
AdenoCarcinoma (ADC)
SCC-3a
FFPE
SCC
SCC-1b
FFPE
SCC
SCC-3b
Frozen
SCC
ADC-1b
Frozen
ADC
SCC-5
Frozen
SCC
ASCC-1b
Frozen
ASCC
SCC-7
Frozen
SCC
SCC-8
Frozen
SCC
cx-normal-4
Frozen
cx-normal-7
Frozen
cx-normal-11
Frozen

MicroRNA Preparation:

All samples were enriched for the microRNA fraction using a Flash PAGE Fractionator (Ambion). Briefly, a total RNA sample was loaded onto a pre-cast gel using the Flash PAGE Fractionator. The total RNA fraction smaller than 40 nt (the “microRNA fraction”) was recovered after gel migration and resuspended into nuclease free water.

Microarray Analysis

Probe Design and Spotting

The polynucleotide probes used for microarray preparation had the configuration 5′-NH2—(C)6-(spacer)-(oligomer probe sequence)-3′. The 5′-amino group allowed chemical bonding onto the array support. Each also included an identical spacer sequence of 15 nt, as shown below, to prevent non-specific interactions of the polynucleotide probes with the array support:


(SEQ ID NO: 90)
5′AminoC6-TTGTAATACGACTCA - Oligo probe sequence.

Probe sequences given in Table 11 omit the linker.

The probes were synthesized according to standard protocols by Eurofins MWG Operon (Ebersberg, Germany). Nexterion (Schott) microarray glass slides were used as the solid support for the microarray.

The polynucleotide probe concentration used for the spotting was 25 μmol. The probes were spotted in duplicate using the Nexterion spotting buffer provided with the array glass support by Schott with 1% SDS (sodium dodecyl sulfate) added to allow larger spot sizes (e.g., 100-150 microns compared to 70-100 microns without SDS). The spotter used was the QArray mini (Genetix) equipped with Stealth SMP3 pins (Telechem). After deposition of one series of spots, the spotting needle was washed 5 times with 60 mM NaOH before spotting the next series of probes. Each slide is designed with 48 blocks of spotted probes, with each block being a 20×18 square of spotted probes. Each probe was spotted in duplicate. Spotted glass slides were stored at 4° C. until use.

MicroRNA Labelling

The labelling of the microRNA fraction was adapted from a published protocol developed at EMBL (Heidelberg, Germany) by the European Molecular Biology Group (Castoldi et al., “A sensitive array for microRNA expression profiling (miChip) based on locked nucleic acids (LNA),” RNA 2006 May; 12(5):913-20. Epub 2006 Mar. 15, incorporated herein by reference in its entirety). Briefly, the microRNA fraction was incubated for 6 hours at 4° C. with a mixture containing 10 μM of dye-labelled tetra-nucleotide (5′-rUrUrUrU-Cy5-3′) (or alternatively, 5′-rUrUrUrU-Cy3-3′) (Biospring, Germany) in Ambion buffer diluted to 1× with RNase free water, 8% polyethylene glycol (PEG), 2 mM adenosine triphosphate (ATP), and T4 RNA ligase (0.7 U/μl). The labelling reaction was run by heating the mixture for 15 minutes at 65° C. This procedure ligated the poly-U dye-labelled tail to the 3′ end of all the microRNAs. Labelled samples were stored at 4° C. before hybridization.

Array Hybridization

The labelled microRNA fraction was hybridized to the spotted arrays using a Discovery hybridization station (Ventana, Tucson, Ariz.). Briefly, 2 mL of a mixture of 1% BSA, 2×SSC, and 0.2% SDS was incubated with the chips for 30 min at 42° C. Then the chips were washed once using EZ Prep buffer (Ventana) and then three more times with Ribowash (Ventana). Next, 20 μl of the labelled microRNA mixture and 180 μl of ChipHybe Reagent (Ventana) were added to the array. The arrays were heated for 6 minutes at 37° C., then were incubated at 42° C. for 8 hours, after which the heating was stopped. The chips were washed once with Ribowash (Ventana) and then heated for 2 minutes at 37° C. The chips were washed again with Ribowash (Ventana) with one drop of CheapClean (Ventana) added, and incubated for 2 minutes at 37° C. The chips were washed two more times using Ribowash (Ventana). On the following day, the final washes were done according to Ventana's instructions for the Discovery hybridization station. The slides were washed twice with 2×SSC+0.2×SDS buffer and then one more time with 0.1×SSC. All the slides were dried using a speed centrifuge from Arrayit (TeleChem International, Sunnyvale, Calif.) at room temperature and kept in the dark before scanning.

Array Image Acquisition

The arrays were scanned using an Axon™ scanner (Molecular Devices, Sunnyvale, Calif.) and their Genepix™ software. The image was formatted in tif format, defined by an image color depth of 16 bits/pixel (1600*1600). At such setting, pixels can assume intensity values ranging from 0 to 65,535. Pixels exhibiting the maximum intensity value are “saturated” and were assigned the value of 65,535. The resolution of the array scan was set at 10 μm/pixel. For hybridization experiments using different fluorescent dyes (e.g., Cy5 and Cy3) the photomultiplier tube (PMT) was adjusted to the higher intensity spot (Cy3 is scanned at lower PMT settings than Cy5).

Array Image Analysis

The PMT of the laser scanner digitized the captured fluorescence intensity for each given “point” of a slide and stored the numerical value as a pixel corresponding to that point. A picture composed of such pixels was then analyzed. The first task for image analysis was to detect the spot position, using a process called segmentation. Spots were segmented by circles of adaptable or fixed radius. To be reliably segmented and quantified, the spot diameter was required to be more than 5-6 pixels. Before segmentation an indexing grid was provided giving the approximate positions of the spots. The segmentation itself detected the limits of spots near the grid circles. Briefly, the Genepix software assigns a circle to each spot on the array (segmentation). The segmentation had to be conducted in a somewhat flexible way due to spotting imperfections and/or support deformation, as the spots were almost never on a perfectly rectangular grid.

After segmentation by the software, the circles were modified manually and adjusted onto the spots until all the spots on the array were clearly identified. At this stage, if the array presented high background noise preventing real spots from being distinguished from the background, the array was rejected for further analysis.

The second task of image analysis was to quantify spots and export the data into a result file. This was a relatively easy and well-defined task once the spots were located on the image. The statistical approach used most frequently to quantify spot intensity was the mean or median of pixels belonging to a spot. The median approach was more robust than the mean value in the presence of outlier pixels. In practice, however, there was little difference in the results obtained using mean or median.

Array Data Analysis

All the array data were analysed using the R bioconductor package (“Bioconductor: open software development for computational biology and bioinformatics,”Genome Biol. 2004; 5(10):R80. Epub 2004 Sep. 15, which is incorporated herein by reference in its entirety).

Array data were first tested for quality by comparing the spot intensities for the internal controls. One internal control (SEQ ID NO: 83; Table 9) was used as a labelling control (this synthetic RNA is added to the purified microRNA fraction before labelling), and 6 other internal controls (SEQ ID NOs: 84-89; Table 9) were used for the normalization of the data (these synthetic RNA controls are added to the total RNA fraction before hybridization at 520 fmol each/array). The probe sequences that bind to the synthetic RNAs, and a mutant probe sequence, are also shown in Table 9 (SEQ ID NOs: 406 to 409, 212 to 214, and 217).


TABLE 9
Control Sequences used in microarray experiments
Sequence (5′-3′)
Sequence identification number
CGCGCGUCGCUUUAUCUACUGU
SEQ ID NO: 83; CTL30_COMP
UUAUCGUUCGAUAAGUCGCGUU
SEQ ID NO: 84; CTL11_COMP
GAAGUUACUAUGUAGGCAACCU
SEQ ID NO: 85; CTL23_COMP
CGCGGGACUAAUUGUUACCGGG
SEQ ID NO: 86; CTL26_COMP
UCGCGUCGAACUCCGCAACCGA
SEQ ID NO: 87; CTL29_COMP
ACCGAACGCCGUACCCAUCGGG
SEQ ID NO: 88; CTL31_COMP
CGAGGGUAACGACUCUCGUGUC
SEQ ID NO: 89; CTL36_COMP
TTGTAATACGACTCAACAGTAGATAAAGCGACGCGCG
SEQ ID NO: 406; CTL30
TTGTAATACGACTCAAACGCGACTTATCGAACGATAA
SEQ ID NO: 407; CTL11
TTGTAATACGACTCAAGGTTGCCTACATAGTAACTTC
SEQ ID NO: 408; CTL23
TTGTAATACGACTCACCCGGTAACAATTAGTCCCGCG
SEQ ID NO: 409; CTL26
TTGTAATACGACTCATCGGTTGCGGAGTTCGACGCGA
SEQ ID NO: 212; CTL29
TTGTAATACGACTCACCCGATGGGTACGGCGTTCGGT
SEQ ID NO: 213; CTL31
TTGTAATACGACTCAGACACGAGAGTCGTTACCCTCG
SEQ ID NO: 214; CTL36
TTGTAATACGACTCACCCGGTAACAATTAGACCCGCG
SEQ ID NO: 217; CTL26_MUT

All sequences for which the intensity of the spot was higher than the mean local background intensity plus 1.5 times its standard deviation were categorized as expressed microRNAs. The following criteria were required to be met in order consider the array intensity data valid for further analysis:

    • 1. Specificity of the hybridization controls had to be within acceptance criteria (e.g. CTL26 vs. its corresponding single base mutant, CTL26_MUT).
    • 2. Approximate equality of the signal intensity of the replicates of the positive controls
    • 3. Approximate equality between median block signal intensities based on the positive controls for each block
    • 4. Approximate equality between median array signals based on all sequences detected
    • 5. Signal intensity for the purification and labelling control (CTL30).

Statistical normalization of the data was done by computing the Log 2ratio where the Log 2ratio equals average intensity signal of the duplicated spots/median intensity of all positives controls for the block. The normalization was done per block to avoid non-homogenous labelling of all blocks of the array. This block-by-block normalization has been shown to be more efficient then using overall normalization of the slide. The obtained values are Log 2 values.

The intensities of the spots for each polynucleotide probe were compared in the sample from the cervical cancer cell line versus normal cervical tissue, resulting in an evaluation of the relative expression for each microRNA.

The expression fold-change corresponds to 2(Log 2ratio). The Log 2ratio is the ratio between the two conditions compared, or log 2(Xcell-line/Xnormal), which is the same as (log 2Xcell-line−log 2Xnormal), where X is the measured intensity value. In cases where there was no signal from the “normal” condition, the lowest measured intensity value in the experiment was used as the baseline from which a fold-change expression value was calculated. A fold-change value of less than zero corresponds to a down-regulation of (1/fold-change) times.

Results

All of the samples generated low signals, possibly due to degradation of the samples. For three of the normal samples (normal−4, −7, and −11), a reliable number of sequences were detected, so those samples were used as controls for the analysis.

In this experiment, miR-21 was up-regulated in all of the tumors tested compared to the normal samples. In certain tumor samples (for example, ADC-1a, ADC-1b, ASCC-1b, SCC-4a, and SCC-7), a particularly high or low number of sequences was detected. Two microRNAs, miR-145 and miR-143, which have previously been reported to be down-regulated in certain cancer tissues (Wang et al., PLoS One (2008) 3: e2557), were also found to be downregulated in this experiment. Table 10 shows a list of the microRNAs that were found to be upregulated in at least one of the tumor samples tested. Table 11 shows the probe sequences that were used to detect the microRNAs listed in Table 10. Table 12 shows the microRNA precursor sequences and their chromosomal location.


TABLE 10
Fold-change in expression relative to normal controls
Sequence
SCC1a
SCC1b
SCC2
SCC3a
SCC3b
SCC5
SCC7
SCC8
ADC1a
ADC1b
ASCC1a
ASCC1b
10030-R5-1
0.48
0.62996
0.42
0.68
0.45
5.13
1.09
0.83
0.48
6.55
0.34
7.08
10435-R4-1
0.55
0.62996
0.42
0.68
0.45
4.01
0.59
0.83
0.48
NA
0.37
4.24
12730-R5-2
0.30
0.56850
0.38
0.89
0.40
0.69
0.76
0.75
0.43
NA
0.30
3.09
12917-R5-1
0.29
0.54270
0.36
0.58
0.38
0.47
2.93
0.72
0.41
NA
0.29
0.51
12917-R5-2
0.29
0.53431
0.35
0.57
0.38
0.47
2.79
0.71
0.40
NA
0.29
0.50
13075-L5-1
0.34
0.62996
0.42
1.17
0.45
0.55
1.71
0.83
0.48
NA
0.34
0.94
13108-L5-2
1.23
1.34983
0.87
0.68
0.60
10.57
0.81
0.83
0.48
11.37
0.34
16.00
13111-L5-3
1.50
1.52386
0.79
1.69
0.99
1.30
3.85
0.85
0.58
NA
0.55
1.26
13122-L5-1
1.79
1.68168
0.69
0.68
0.54
2.80
1.68
0.83
0.48
4.43
0.34
3.47
13124-L5-2
0.48
0.43358
0.40
0.82
0.23
0.62
1.22
0.43
0.25
NA
0.18
6.48
13129-L5-3
0.80
0.72991
0.77
0.82
0.40
1.14
4.07
0.25
0.34
NA
0.10
42.27
13168-L5-1
0.92
2.67482
1.46
1.65
1.02
2.21
0.59
0.83
0.48
NA
6.61
0.59
13181-L5-2
0.61
0.50095
0.33
0.54
0.35
1.04
1.13
0.66
0.38
NA
0.27
48.83
13195-L5-1
0.40
1.75224
0.42
0.68
0.45
0.55
0.59
0.83
0.48
5.52
0.52
0.59
13207-R5-4
1.50
1.36744
1.01
0.68
0.45
2.13
2.09
0.83
0.48
NA
0.34
2.06
13209-L5-2
0.47
0.39869
0.38
0.26
0.17
1.77
1.59
1.08
0.26
NA
0.41
3.61
13219-L5-1
1.01
0.85828
0.64
0.68
0.45
1.79
1.42
0.83
0.48
NA
0.34
2.00
13227-L5-2
0.78
0.73130
0.47
0.78
0.47
1.30
3.21
1.02
0.31
NA
0.22
2.28
13229-R5-3
0.68
0.81104
0.57
2.52
1.40
1.07
0.70
1.14
0.31
NA
0.69
1.55
13231-L5-3
0.19
0.35780
0.24
0.38
0.25
0.31
1.08
0.47
0.27
NA
0.19
5.11
13247-L5-3
0.48
0.51572
0.20
0.92
0.62
0.83
5.13
1.41
0.27
NA
0.41
2.28
13252-L5-3
1.77
2.03164
0.42
0.68
0.45
3.37
0.59
0.83
0.48
17.08
0.34
75.31
13254-R5-1
3.95
3.51150
0.94
0.55
0.69
16.00
0.48
1.86
0.39
26.31
0.28
9.67
13260-L5-2
0.31
0.49907
0.33
0.53
0.35
0.43
0.47
0.66
0.38
NA
0.27
0.47
13267-L5-1
0.66
0.51565
0.56
1.62
0.55
0.83
2.21
1.01
0.19
NA
0.14
31.04
13274-L5-3
0.90
1.05855
0.54
0.67
0.55
1.71
3.59
0.93
0.33
NA
0.38
2.23
13283-L5-3
0.75
0.84669
0.39
0.58
0.38
5.35
1.84
0.72
0.41
6.57
0.29
9.44
13291-L5-1
0.49
0.58218
0.31
0.50
0.33
0.64
2.38
0.83
0.35
NA
0.25
1.82
13296-L5-3
0.60
0.50124
0.33
0.54
0.35
1.04
1.14
0.66
0.38
NA
0.27
11.21
13312-L5-1
0.29
0.24998
0.26
0.92
0.30
0.36
1.29
0.23
0.13
NA
1.25
4.81
13325-R5-2
0.56
0.70384
0.63
1.81
0.99
1.22
5.31
0.67
0.38
NA
0.56
0.47
13335-L5-2
0.49
0.43467
0.34
0.32
0.21
0.97
1.51
0.39
0.22
NA
0.16
3.91
13335-L5-3
0.43
0.39498
0.30
0.59
0.44
1.00
2.18
0.89
0.17
NA
0.24
2.14
13339-L5-1
0.68
0.62012
0.43
0.46
0.32
1.17
2.49
1.05
0.26
NA
0.28
3.69
13504-R5-3
1.55
1.49604
1.52
0.68
0.45
1.57
0.83
0.83
0.48
NA
0.65
0.59
13532-L5-2
1.98
2.37574
0.73
0.64
0.42
5.40
0.56
0.88
0.46
12.41
0.32
2.08
227-L5-1
0.64
0.74093
0.56
0.81
0.51
0.96
2.97
0.95
0.32
NA
0.54
1.31
25-R5-2
0.90
1.05584
0.29
0.47
0.31
1.62
0.78
0.58
0.33
10.98
0.23
1.40
2819-L5-2
0.34
0.62996
7.35
0.68
0.45
0.55
0.59
0.83
0.48
NA
0.34
0.59
2819-R5-4
0.47
0.38389
0.32
0.57
0.40
0.67
1.32
0.64
0.23
0.87
0.32
1.86
3371-L4-1
0.21
0.38626
0.25
1.04
0.45
0.52
1.00
0.51
0.29
NA
0.21
0.91
3744-R5-1
1.33
1.09513
0.78
0.67
0.54
1.93
2.78
1.04
0.25
NA
0.18
3.05
3911-R5-1
0.34
0.62996
0.42
2.28
0.90
0.55
0.59
0.83
0.48
NA
0.34
1.79
4417-R5-2
1.29
2.32318
0.96
0.68
0.45
3.07
0.59
0.83
0.48
NA
1.14
1.56
4440-L3-2
4.04
7.35978
3.34
8.03
6.55
3.01
2.06
0.53
1.66
3.29
2.85
1.51
4440-R3-2
0.50
0.50446
0.38
0.67
0.39
3.32
1.03
0.36
0.16
2.82
0.28
4.80
4498-L3-2
0.84
0.78263
0.50
0.68
0.45
5.48
0.91
0.83
0.48
5.05
0.46
8.39
4719-R5-1
2.00
2.68058
0.84
0.68
0.45
3.15
0.59
0.83
0.48
8.15
0.34
0.59
4765-L5-1
0.54
0.62996
0.42
3.01
1.55
1.22
0.59
0.83
0.48
NA
0.34
2.20
4829-R2-1
0.53
0.61657
0.43
1.12
0.62
1.73
5.34
0.87
0.25
NA
0.56
2.07
4855-R5-1
1.84
2.01422
1.31
1.88
1.00
1.82
2.61
0.33
0.65
3.60
3.08
0.24
4988-R5-2
0.57
0.58473
0.57
0.85
0.46
0.32
1.47
0.48
0.28
NA
2.25
0.34
6216-L1-1
3.25
5.58042
2.97
8.16
5.47
2.04
2.31
0.67
1.39
NA
2.38
1.62
6216-R5-2
0.57
0.55598
0.45
0.80
0.46
4.04
1.04
0.33
0.20
3.13
0.30
5.54
6235-R5-2
4.37
4.36450
1.88
0.68
1.20
6.64
2.24
0.83
0.48
7.33
0.34
8.03
6803-R5-2
0.57
0.53791
0.39
2.83
1.52
1.31
1.27
0.57
0.33
NA
0.33
3.89
7067-L5-1
0.44
0.62996
0.42
0.68
0.45
2.73
0.59
0.83
0.48
NA
0.34
4.27
7126-L3-1
0.56
0.49062
0.37
0.74
0.50
0.64
2.54
1.08
0.23
NA
0.39
1.37
7182-L5-1
0.48
0.50155
0.43
0.82
0.51
0.78
4.34
0.82
0.18
NA
0.32
1.29
7292-R3-2
0.37
0.63424
0.35
0.57
0.38
1.26
0.50
0.71
0.41
18.66
0.29
3.23
7578-L3-1
4.60
0.54709
1.08
0.59
0.85
0.48
0.51
1.78
0.85
39.02
0.57
7.03
7781-R5-2
0.43
0.51223
0.34
0.55
0.36
0.84
1.58
0.68
0.39
NA
0.27
2.40
7887-L5-3
0.47
0.48451
0.32
0.52
0.34
1.27
0.45
0.64
0.37
NA
0.26
3.37
8004-R3-2
1.02
0.91481
0.42
0.68
0.45
1.94
1.27
0.83
0.48
NA
0.34
1.95
8298-R5-1
0.38
0.38316
0.34
0.50
0.34
0.63
2.32
1.05
0.29
NA
0.30
1.85
8339-R5-1
0.70
1.10768
0.91
0.68
0.45
4.60
0.59
0.83
0.48
NA
0.57
3.15
836-R4-1
1.33
1.43068
0.42
0.68
0.45
1.85
1.53
0.83
0.48
NA
0.34
0.59
9053-R3-1
0.68
0.80482
0.64
0.87
0.48
3.04
1.01
0.89
0.33
NA
0.23
4.22
9164-R5-1
0.34
0.62996
0.42
2.42
1.14
1.06
0.72
0.83
0.48
NA
0.34
1.09
9485-R5-1
2.15
2.24932
2.77
0.68
0.82
1.32
0.59
0.83
1.14
NA
0.34
0.59
9691-L4-1
0.58
0.70634
0.38
0.62
0.41
0.98
2.22
0.76
0.44
NA
0.31
1.55
9816-R5-1
0.46
0.58377
0.39
0.63
0.41
0.51
1.55
0.82
0.44
NA
0.31
1.76
999996-L4-1
0.25
0.46163
0.30
0.49
0.33
0.40
0.43
0.61
0.35
5.53
3.56
0.43
miR-1246
3.51
4.24691
1.92
0.68
1.16
5.40
2.72
0.96
0.55
5.82
0.55
7.41
miR-1290
1.46
1.29141
0.77
0.68
0.45
1.94
1.74
0.83
0.48
NA
0.34
1.84
miR-1308
5.41
5.16798
1.26
0.50
0.97
18.09
0.50
2.59
1.12
39.12
0.79
15.99
miR-142-3p
0.79
0.68772
1.20
0.68
1.44
4.46
0.59
1.37
0.48
NA
0.55
0.97
miR-143
0.21
0.39339
0.26
0.42
0.28
0.42
0.37
0.52
0.30
5.20
0.60
0.37
miR-145
0.31
0.40117
0.43
0.43
0.28
0.48
0.37
0.53
0.65
5.99
0.81
0.60
miR-1826
2.93
4.04445
2.24
0.57
1.23
4.97
1.14
1.44
1.02
11.52
1.00
5.45
miR-195
0.37
0.41556
0.27
0.45
0.55
1.21
0.39
0.55
0.31
5.64
0.53
1.19
miR-200c
1.00
1.22187
0.95
0.68
0.99
1.34
0.59
0.83
0.48
NA
1.11
2.05
miR-205
6.23
5.69362
2.07
0.61
1.47
4.24
0.53
1.13
0.43
NA
1.45
2.54
miR-21
3.01
3.70795
10.92
0.56
7.46
24.36
1.01
7.32
3.70
21.96
11.87
24.14
miR-31
0.34
0.62996
0.42
0.68
0.45
0.55
0.59
0.83
0.48
NA
0.58
0.92
miR-451
0.65
0.52572
0.33
0.47
0.65
0.38
5.85
0.58
0.33
NA
0.70
0.41
miR-483-5p
0.54
0.37151
0.25
1.24
0.26
0.32
1.72
0.49
0.28
NA
0.20
0.35
miR-491-3p
0.50
0.62996
0.42
0.68
0.81
12.59
0.59
0.83
0.48
58.76
0.34
18.82
miR-494
0.63
0.81477
0.54
0.68
0.45
1.56
0.59
0.83
0.48
NA
0.49
2.70
miR-720
1.15
1.54266
1.73
1.02
0.92
1.78
0.59
0.83
0.85
NA
1.27
1.45
miR-765
0.28
0.42837
0.28
0.84
0.46
0.51
1.56
0.55
0.32
NA
0.28
0.84
miR-98
1.11
0.57757
0.61
0.41
1.01
1.00
0.36
0.51
0.59
7.06
1.04
2.14


TABLE 11
Probe sequences
SEQ
probe
probe sequence 5′ -> 3′
ID
   25-R5-2
TTCTGCTTTCCCAGAGCCTCACCCCCTCTTTT
133
  227-L5-1
ACACCTGTCTCTCCCCAGTGCTTCCGCCCCTCA
134
  836-R4-1
AAATAATCATTCCAAATGGTTCTCCCTGCTATGATTCAC
32
 2819-L5-2
CCACACTTCTAATTGGACAAAGTGCCTTTCAAACT
136
 2819-R5-4
CAGCCTGCCACCGCCGCTTTTGAAAGAAGCACTTCA
137
 3371-L4-1
TTTCCTTTCCTCCCCTCCACACCCCATGACTCCCCACACTTGAG
1
 3744-R5-1
CTTCTCCTTCCTCCCTGCTCCCCTCCCACTAATGCCAAAT
138
 3911-R5-1
GGCTCCCTAGTGAAAAAATGCAAAATTTGTATAAT
139
 4417-R5-2
ACTCGGCGCTCATCAAAAAGTTCCCTGTCCG
141
 4440-L3-2
TTTGACATTCAGAGCACTGGGCAGAAATCACA
142
 4440-R3-2
GTCATAGTTACTCCCGCCGTTTACCCGCATTTC
143
 4498-L3-2
GAGATCCAGACGGCCGTGCGCCTGCTGCTGCCT
144
 4719-R5-1
ACAGCATCACATGGATTCTGTGTCCAGTGGCCTTAGCA
145
 4765-L5-1
ACATGCTCCTGACACTTTCTCTTAGTTTCTCGGGCTCC
146
 4829-R2-1
TCCCTTTGTGCTGCCCGAGTGCCTTCCCCCTG
147
 4855-R5-1
CGGGTCTCCCGCTTCCCCCTCCTGCTCCAAGG
148
 4988-R5-2
CTCCTCCTCCCCGTCTTTGGATACCAAACAC
149
 6216-L1-1
GACATTCAGAGCACTGGGCAGAAATCACATG
151
 6216-R5-2
CATAGTTACTCCCGCCGTTTACCCGTGCTTC
152
 6235-R5-2
TCTGCTCCAAAAATCCATTTAATATATTGT
153
 6803-R5-2
GCTCCCTCTCTGGTTGGACCTCACCCAAA
154
 7067-L5-1
GGAGATCCAGACGGCCGAGCGCCTGCTGCTGCCC
155
 7126-L3-1
GCACACCCGCTCTCCGGCCCGCGCCCCTG
156
 7182-L5-1
AACTAGCCGTTTCCGTCACCTTCCCCTGCCCCC
157
 7292-R3-2
ACAATATTTATCCAGGGATGGGAGTCAGATGCA
158
 7578-L3-1
CGCAGTGCACACCCTGAGCTACAGCCCCTC
159
 7781-R5-2
AGCCTGTGCCTGCCGCTGTCTAGTACTGGT
160
 7887-L5-3
CAAGAGCCAGCCTGCACTACCAGTCCCATGCCA
161
 8004-R3-2
GGAACTGCTTCTCCTTGCTCCAGTCATTGAAG
162
 8298-R5-1
GATGCTGGCGTCCGCCGCAGCCTCTCGCCCCATCCCGG
163
 8339-R5-1
AAAAGCCAATACATTTTCACTGTACCGGCCAC
164
 9053-R3-1
TTCTTGCCCTCCAATCCCCGGGCTCCACCAGCC
5
 9164-R5-1
TGCTTCCATCCCGCCAGTTTGGTTTCATTGTACTGACAACC
166
 9485-R5-1
CTGGGTGAGGTCCCACCGTGGTGCGCTTGGCTGTGCCAGC
167
 9691-L4-1
AATCATCCATTTCATCCGCATCTCCCTCTTGGCCCCTTGC
7
 9816-R5-1
CCCTTTAAGAGCCTCTCCGCGCGCTGCCG
169
10030-R5-1
CCGTGGATGTCAACTCAGCTGCCTTCCGCC
170
10435-R4-1
GCATGCTAATTGTGCCCTGTTGTCTTTCTTAAACT
171
999996-L4-1
GGGAGGAGTCAGGTGTGTGCTGTGGGTTGGGGGAAGAC
173
12730-R5-2
GCGCCCTGTGTTGTGCTCCGCTCTCCGGGAAATGC
174
12917-R5-1
GGGCCCTTCCCTTCCCCCAACATTGAGCCTTG
175
12917-R5-2
GGACCTATGGGCCCTTCCCTTCCCCCAACATTG
176
13075-L5-1
TGAAAGCTGAAGTCCAGCCCAGCCCTCT
177
13108-L5-2
CTGCTGCCTTCCTTGGTTGAGGGGCCTGAGCACG
178
13111-L5-3
TCTCCGCCGGGCCTTCACCCTGCCCTGCTCTTCT
179
13122-L5-1
TTAGGAAATTCCATCTCACCTGCTCCAGTCC
180
13124-L5-2
GCTCCATGTCTCCTCCCCTCCGCGAAAGCCTAAAC
181
13129-L5-3
AGCCTTCCTGTCCCCTGGCCCCCGACCTGCTCCA
182
13168-L5-1
CGCTTCCTTAACCATTTTTTTTTTTTTTAACCAC
183
13181-L5-2
TGGACGTCTGAACAGTCACTGCCTGCCCCAACCT
184
13195-L5-1
ATGACCATTTGTATTAGTATCTTTTTTTTTTTT
185
13207-R5-4
CTGCGGCAAGTGCTTCTACATCCCTGCTCCAACAA
186
13209-L5-2
TAACTCGCCTGCTGCCCCGGCGGCCTGCCCGCCG
187
13219-L5-1
CTCTGACTCCCTCACTCAGTCTCTCTGCTCCAGC
188
13227-L5-2
GGGCCCAGTCCTCCTCGTCCCCCTTCCCACCTCGG
189
13229-R5-3
GCAGCTCCGCCAGTCTCTGTGGGCAGGGAGAAG
190
13231-L5-3
GGCCCACCCGGGGGCCGCTCCCCAGCACCGACGCC
191
13247-L5-3
TCCTGAGCCGCCTTCCCCTCCCGACCTCAGAGCCCT
192
13252-L5-3
ACGTGCCTTCCTGACTGTGAGCTCCTTGAGAGC
193
13254-R5-1
CAATGAACCACTGAACCACTCATGCACTGAACC
194
13260-L5-2
CTGTAGACCCCACACTCAGTCTCTATAGCTA
195
13267-L5-1
CACTCCCTGCTGGCCCCCACCTCACCTATGGTG
196
13274-L5-3
CCTTCTCTTCTCCCGTGCTCCCACCCTCCCTCAGGG
197
13283-L5-3
GGACCCCTGCCTTCCTTGCTGCCACCCTTTGCACA
198
13291-L5-1
CCCAAGCGCCCCTTCCTCCCTCCTTCCCTCCCG
199
13296-L5-3
CAGTCACCTCAGATTCCTGTGCCCTCTGCCCTGG
200
13312-L5-1
CCACCCCTCCCCCACAGCCCAGCCCCACTCAC
201
13325-R5-2
TCCAACACTGCCTGGCGCTGGGCTCTTCCCCA
134
13335-L5-2
CCACTGCCCTCCTGCCGCATCCTATGCTCCTCT
140
13335-L5-3
ACCTCAGCCTCCACTGCCCTCCTGCCGCATCCTAT
168
13339-L5-1
GACTGAGGGTTTAAAGAAGATGGTGTCCGCCGC
150
13504-R5-3
AGACTGCTGTAAATGCGGACAAAGCGTCCCTGC
165
13532-L5-2
TGCTCTACCGGCTATGACATTAGGTGTGACCG
172
miR-1246
CCTGCTCCAAAAATCCATT
208
miR-1290
TCCCTGATCCAAAAATCCA
209
miR-1308
CCACTGAACCACCCATGC
210
miR-1826
ATTGCGTTCGAAGTGTCGATGATCAAT
211
miR-200c
TCCATCATTACCCGGCAGTATTA
203
miR-451
AACTCAGTAATGGTAACGGTTT
204
miR-483-5p
CTCCCTTCTTTCCTCCCGTCTT
202
miR-491-3p
GTAGAAGGGAATCTTGCATAAG
205
miR-494
GAGGTTTCCCGTGTATGTTTCA
206
miR-720
TGGAGGCCCCAGCGAGA
207
miR-765
CATCACCTTCCTTCTCCTCCA
39
miR-143
GAGCTACAGTGCTTCATCTCA
218
miR-145
AGGGATTCCTGGGAAAACTGGAC
219
miR-205
CAGACTCCGGTGGAATGAAGGA
220
miR-21
TCAACATCAGTCTGATAAGCTA
221
miR-31
AGCTATGCCAGCATCTTGCCT
222
miR-142-3p
TCCATAAAGTAGGAAACACTACA
223
miR-195
GCCAATATTTCTGTGCTGCTA
224
miR-98
AACAATACAACTTACTACCTCA
225


TABLE 12
microRNA precursor sequences and chromosomal locations
probe
microRNA precursor sequence 5′ -> 3′
SEQ ID
chr
start
end
strand
    25-R5-2
TCCCGCAGCCGGTGACTGGAGCCCACCTCTGCAGAGACAAAGGTTAGAAAAAG
226
2
176709550
176709636
−1
AGGGGGTGAGGCTCTGGGAAAGCAGAATGCGGGG
   227-L5-1
TGAGGGGCGGAAGCACTGGGGAGAGACAGGTGTGAGCTTCCCACGTGGTGATC
227
3
187350863
187350957
1
AGCTCACACCTGTCTTGTGTTCTTGGTATTCACAGACTCTCA
   836-R4-1
AAATAAGCCATTCCAAACCATTCTCTGATTTGCTGTGAGTGGCAGAATCATTC
73
3
170758581
170758678
−1
ACCGTGGTGAATCATAGCAGGGAGAACCATTTGGAATGATTATTT
  2819-L5-2
AATGCCAGTGAGTTTGAAAGGCACTTTGTCCAATTAGAAGTGTGGAGAAATAT
228
15
59266509
59266618
1
TCATCCTGTCCATGACAAAGATGAAGTGCTTCTTTCAAAAGCGGCGGTGGCAG
GCTG
  2819-R5-4
AATGCCAGTGAGTTTGAAAGGCACTTTGTCCAATTAGAAGTGTGGAGAAATAT
229
15
59266509
59266618
1
TCATCCTGTCCATGACAAAGATGAAGTGCTTCTTTCAAAAGCGGCGGTGGCAG
GCTG
  3371-L4-1
CTCAAGTGTGGGGAGTCATGGGGTGTGGAGGGGAGGAAAGGAAAGGTATTTTG
42
18
58394821
58394914
1
TTTCTTTGTCTATACATTTCCTAGATTTCTATGCAGTTGGG
  3744-R5-1
CTTCTCTTATTCTCCCTGTTTTCATCCTACTTTTAAGTAATAAATTTGGCATT
230
19
14176021
14176103
1
AGTGGGAGGGGAGCAGGGAGGAAGGAGAAG
  3911-R5-1
GGCCCTTAGGAAATTAGAGTGTGTTTGAATTTCACAAGTATAATTTTAATTAT
231
17
52705568
52705650
1
ACAAATTTTGCATTTTTTCACTAGGGAGCC
  3995-L2-1
TGGCCTGACGTGAGGAGGAGGGACTTTTCGAAGTTTTATAGGAAAGTTTCCGC
232
7
19123856
19123933
1
TTTCCAGTCCCCCTCCCCCGTCCCA
  4417-R5-2
GCTGGGGTTCATCGGAGAAACTCCCTGCGATGAGCCACTAGGGTCACGGACAG
233
14
34943859
34943935
1
GGAACTTTTTGATGAGCGCCGAGT
  4440-L3-2
GTGATGTGATTTCTGCCCAGTGCTCTGAATGTCAAACTGAAGAAATTCAGTGA
234
7
68165348
68165431
1
AATGCGGGTAAACGGCGGGAGTAACTATGAC
  4440-R3-2
GTGATGTGATTTCTGCCCAGTGCTCTGAATGTCAAACTGAAGAAATTCAGTGA
235
7
68165348
68165431
1
AATGCGGGTAAACGGCGGGAGTAACTATGAC
  4498-L3-2
TTCCCCAGGCAGCAGCAGGCGCACGGCCGTCTGGATCTCCCTGGAGGTGATGG
236
6
25840053
25840136
1
TCGAGCGCTTGTCATAATGCGCCAGGCGGGA
  4719-R5-1
ACAGCGGCATGGTTCATGCCAAATTCCGAAGCAATCTTCCTGCTAAGGCCACT
237
13
71318356
71318433
1
GGACACAGAATCCATGTGATGCTGT
  4765-L5-1
GGAGCCCGAGAAACTAAGAGAAAGTGTCAGGAGCATGTTAATCAGACTCGTTA
238
13
99346548
99346632
1
CACTGTAACAATAACGTCTCTCTCGGGTCTCC
  4829-R2-1
GGTGTGTCTGCCTCTCTTTCTGCCCCCCTATACCCCTTGACCCCAGGGGGAAG
239
1
149949355
149949439
1
GCACTCGGGCAGCACAAAGGGAGCAGATGCCC
  4855-R5-1
GGGTCCGGGTCTCTACCGCGCCCTCATGCAGGAGGCCCTTGGAGCAGGAGGGG
240
12
46684439
46684513
1
GAAGCGGGAGACCCGGCAGCCC
  4988-R5-2
CTTTTTCTCTCTGCTGGGAAACCTTGCTTGACTTCATGTCCAGTGTTTGGTAT
241
14
77814294
77814366
1
CCAAAGACGGGGAGGAGGAG
  5192-L3-2
GTCTTTGCTGATATAGAGGAAGGAAGGGGAAAAATGAGCGCATTAGTTCTCTT
58
5
168281079
168281158
1
TTATTAAAAGAGTTATTTCAGCATGAC
  4440-L3-2
CATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAG
242
11
77275152
77275231
1
CACGGGTAAACGGCGGGAGTAACTATG
  6216-L1-1
CATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAG
243
11
77275152
77275231
1
CACGGGTAAACGGCGGGAGTAACTATG
  6216-R5-2
CATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAG
244
11
77275152
77275231
1
CACGGGTAAACGGCGGGAGTAACTATG
  6235-R5-2
TCTGTTTTTATCAGTTTAATATATGATACATCTTCTATCCAAGGACAATATAT
245
15
94090075
94090148
1
TAAATGGATTTTTGGAGCAGA
  6803-R5-2
GCCACCTTTCATGGTGAGGATGCCTGCCACCTTCAGGATCACATCTTTGGGTG
246
22
33316496
33316569
1
AGGTCCAACCAGAGAGGGAGC
  7067-L5-1
GGGCAGCAGCAGGCGCTCGGCCGTCTGGATCTCCCTGGAGGTGATGGTCGAGC
247
3
115304855
115304924
1
GCTTGTTGTAATGCGCC
  7126-L3-1
CAGGGGCGCGGGCCGGAGAGCGGGTGTGCAAAGTGGGCGCAGGGCCCTGGGGC
248
5
134391424
134391507
1
CGCGCCCCTTGCTCTGCCGGCTCGACTCTTG
  7182-L5-1
GGGGGCAGGGGAAGGTGACGGAAACGGCTAGTTACCCAGAATTCTCTGGGGGA
249
12
55013754
55013837
1
ACCAGAAAAATCGGTTATCTAGAATTCTCCC
  7292-R3-2
GCAATTAGAATGCAGGGAGGTTCAGAAGCTATTTAACTGGGTGACCCCTGAGG
250
1
44534497
44534586
1
TCGCTGCATCTGACTCCCATCCCTGGATAAATATTGT
  7352-R3-2
GCCTCTGTGCGCATGGATATAATCAGCTTTGATAGGCAGAGGCTGAGGCTGTT
67
1
178017933
178018022
1
TTTCCAATTAGAGCTGTTAGAGGATTCTGGCAGGGGC
  7578-L3-1
GAGGGGCTGTAGCTCAGGGTGTGCACTGCGAGGCTGGACCTGTTGAGTCTGCA
251
2
104755260
104755340
1
GTGGACATCCATTTAGCTTCAGGTTGTC
  7781-R5-2
AGCCTGTTCCGTGCTCGCTAACTATAAACTATCTGATTTATATTCATTAACCA
252
17
32249690
32249768
1
GTACTAGACAGCGGCAGGCACAGGCT
  7887-L5-3
ACAGTAGGTATAGCTGGCATGGGACTGGTAGTGCAGGCTGGCTCTTGGAAAGG
253
11
24870096
24870178
1
AGTATGTATTCCAGGCTGGTTGGCTGCTGT
  8004-R3-2
GGGGCTGCCATCCTGCTGTCCGTCATCTGTGTGGTGCTGGTCACGGCCTTCAA
254
X
152460383
152460461
1
TGACTGGAGCAAGGAGAAGCAGTTCC
  8298-R5-1
GATGCCGGGCGCCCGCCGCAGCCGCTGCCGCCGGAGCCCGGGATGGGGCGAGA
255
22
38183356
38183430
1
GGCTGCGGCGGACGCCAGCATC
  8339-R5-1
AAGAGCACAAACCTTTCATTTTGCCGTTTATTTGTCTTGTGGCCGGTACAGTG
256
8
37597525
37597594
1
AAAATGTATTGGCTTTT
  8433-L3-1
CGGTGGAGGGAAAGGGGAAAGGAGCCATTTTCTGCTGCACATCAGTCAGTGCC
53
17
75427043
75427117
1
TGCGCCCTCCCTCCCTCCGCCG
  7887-L5-3
ACAGTAGGTATAGCTGGCATGGGACTGGTAGTGCAGGCTGGCTCTTGGAAAGG
257
3
29199527
29199609
−1
AGTATGTATTCCAGGCTGGTTGGCTGCTGT
  9053-R3-1
GGAAGGGCACTGTCTCTCTGATTCCCAGGGCCTGTCATTTCCCGAGGGCTGGT
46
X
144618949
144619035
1
GGAGCCCGGGGATTGGAGGGCAAGAAGCCCAGCC
  9164-R5-1
TGTTTTCATCTTGCTTCTTCATGGTCCATGATGCCAGCTGAGGTTGTCAGTAC
258
1
218383957
218384038
1
AATGAAACCAAACTGGCGGGATGGAAGCA
  9485-R5-1
CTGGGAACAATGGGGCCATTGTGGGAGGATGGAGTGCAGCAGACTGCTGGCAC
259
11
118290213
118290297
1
AGCCAAGCGCACCACGGTGGGACCTCACCCAG
  9691-L4-1
GCAAGGGGCCAAGAGGGAGATGCGGATGAAATGGATGATTTAATGGGTCATCT
48
14
77897549
77897632
1
CTCCTGTAGTTAATTTCTCTAGATCTCTTGT
  9774-R2-1
GCTTGTCCTAAAAGATCTTCCTTCTGTTTCCCTGGGTTTATCCACTTGGTTGG
260
13
35312134
35312220
1
CCTGATGGGAGCAGGAGGCGGTGAGGGGGCGGGC
  9816-R5-1
CTGGCCCATTTTCATTCTGCATAAAATTTTAATGGTCTCTCTGGCTGATCCGG
261
17
35028328
35028415
1
GACGGCAGCGCGCGGAGAGGCTCTTAAAGGGCCAG
 10030-R5-1
GGATGCAACCGTGGAAGCCGGTGCCGTTGAGGATCTGCCACAGGCGGAAGGCA
262
10
98752662
98752739
1
GCTGAGTTGACATCCACGGGCATCC
 10435-R4-1
GAGGCTGCTTAATGAGGTGCCCTTTTCAAAATGTCATCTTAATCTTTTATTAG
263
5
168043163
168043253
−1
TTTAAGAAAGACAACAGGGCACAATTAGCATGCAACTC
 4315D-R4-1
GGGGACGTGGCCCCTCCCCCCCGGAGCGGGACTCCAAGAACTCCGGGGGGCGC
264
1
153319527
153319595
1
TGGGGGCTGACTTTCC
999996-L4-1
GTCTTCCCCCAACCCACAGCACACACCTGACTCCTCCCTTCCAGGGAAAAGAC
265
17
35759252
35759338
−1
CTCAGGGCTGCTGGTGAGTCAGAAATAGGAAGAC
 12730-R5-2
CCCGGCTCGGCCCCGCGTCTCTCCAGCTCCTCCGGCTCCTTTTAGTGCATAAA
266
17
75427123
75427229
1
TTAGTGATGGCATTTCCCGGAGAGCGGAGCACAACACAGGGCGCCGGGCTCGG
G
 12917-R5-1
GGACCTGGGGGCTTCTCTGACCCTTGAACAGCTTATACTATGAGACCTTGGGA
267
1
45246668
45246780
1
ACCTCCTCCATGCAGACACACAAGGCTCAATGTTGGGGGAAGGGAAGGGCCCA
TAGGTCC
 12917-R5-2
GGACCTGGGGGCTTCTCTGACCCTTGAACAGCTTATACTATGAGACCTTGGGA
268
1
45246668
45246780
1
ACCTCCTCCATGCAGACACACAAGGCTCAATGTTGGGGGAAGGGAAGGGCCCA
TAGGTCC
 13075-L5-1
AGAGGGCTGGGCTGGACTTCAGCTTTCACCTAGGAAATGAGTCTTGCTGCCCT
269
2
42137734
42137788
1
TT
 13108-L5-2
TTCCCACACGTGCTCAGGCCCCTCAACCAAGGAAGGCAGCAGGCCCACTGGCC
270
2
31479610
31479698
1
TCCTTATTCAGAGGGGCTGCACTGCACCCTAGGGAG
 13111-L5-3
AGCCTGTGGGAAAGAGAAGAGCAGGGCAGGGTGAAGGCCCGGCGGAGACACTC
271
16
3475382
3475470
−1
TGCCCACCCCACACCCTGCCTATGGGCCACACAGCT
 13122-L5-1
GGACTGGAGCAGGTGAGATGGAATTTCCTAAAGGTCCAGATATTTAGGACCCT
272
2
85447047
85447127
1
GGACCCATCTCACCCGCTGCCTCTGTCC
 13124-L5-2
TGAGGGGTAAGTTTAGGCTTTCGCGGAGGGGAGGAGACATGGAGCCTGGGAAC
273
1
154700544
154700634
−1
TCCTTGTTCTCCCCTCTGCTGCCTCTCCCCACCCCTTA
 13129-L5-3
CCAGACTCTGGGTGGATGGAGCAGGTCGGGGGCCAGGGGACAGGAAGGCTAGG
274
20
61388629
61388733
1
GCCCCAGAGACCTGTCCTGGGCCCCATGTCCAGCTCTGCCCTTAGTGCTTGG
 13168-L5-1
GTGGTTAAAAAAAAAAAAAATGGTTAAGGAAGCGGACCATGGAGCAGAAAGTT
275
11
78788919
78789022
−1
GCAGTGACTGGATTCTGGCTCCAGGCTGCAAATTTAACCATTGAATATCAC
 13181-L5-2
TCCTGAAAGAGGTTGGGGCAGGCAGTGACTGTTCAGACGTCCAATCTCTTTGG
276
1
98283397
98283491
−1
GACGCCTCTTCAGCGCTGTCTTCCCTGCCTCTGCCTTTAGGA
 13195-L5-1
AAAAAAAAAAAAGATACTAATACAAATGGTCATGGAGGGGGAATATAGAGAAG
277
3
54069253
54069352
1
ATCAATTTTGTACAGAAAAACCATTGGTTAGTATTTTTTTTTCTTTT
 13207-R5-4
GCCCCCCAAAATGCTTCTGTACCCCTGCCCCAACAAGGAAGGACAAGAGGTGT
278
10
677614
677734
−1
GAGCCACACACACGCCTGGCCTCCTGTCTTTCCTTGTTGGAGCAGGGATGTAG
AAGCACTTGCCGCAG
 13209-L5-2
GGGAGCCGCCGGCGGGCAGGCCGCCGGGGCAGCAGGCGAGTTACCTCAACTCC
279
10
74122118
74122238
1
CGGCCGCTCCGGAGGTTGCCGGGCACCGAGGAGCCGCCGTGCCCTTCAGGCGC
CTGCGGCGGCGACCA
 13219-L5-1
GCTGGAGCAGAGAGACTGAGTGAGGGAGTCAGAGAGTTAAGAGAATTAGTACA
280
11
100895740
100895860
−1
GGTGAGATTGTACTGATTATCTTAACTCTCTGACCCCCTCACTCAGTAAAGAT
CAGATTGTGCCAGGC
 13227-L5-2
AAGCAAGACACCGAGGTGGGAAGGGGGACGAGGAGGACTGGGCCCTATTTCTC
281
11
133373044
133373159
1
CCATCTATGTAAAGGGAGGGATATCAGGGAAGTCTCTGTCTGTGTACTCAAGT
TTGGGATGCT
 13229-R5-3
TGCTGGCCCAAGGGGTAAAGGGGCAGGGACGGGTGGCCCCAGGAAGAAGGGCC
282
11
199324
199422
1
TGGTGGAGCCGCTCTTCTCCCTGCCCACAGAGACTGGCGGAGCTGC
 13231-L5-3
AGGAACAGGACGATGATGCTGGCGTCGGTGCTGGGGAGCGGCCCCCGGGTGGG
283
11
34919943
34920052
1
CCTCTGCTCTGGCCCCTCCTGGGGCCCGCACTCTCGCTCTGGGCCCGCTCCTC
TTCC
 13247-L5-3
ATCTCACAGAGGAAGAACAGGGCTCTGAGGTCGGGAGGGGAAGGCGGCTCAGG
284
1
165748638
165748746
1
ACTTCTGGCTCCAGAGCCTCCTCTCCTTCCACCATAGTGCCTGCTCCAGAGGA
GAC
 13252-L5-3
CTTTGGCACAGTCCGTGCTCTCAAGGAGCTCACAGTCAGGAAGGCACGTGGAA
285
1
176734861
176734981
−1
TTTCAGCCTGGAGTTCCAAGTGCTGCCCTCAGGGAGTGCTGGGCCTGAGCTGG
GGTGAGGCTGCAGGG
 13254-R5-1
CTCACACATGGTACGTTTTCAATGAGCTGATTTTGTTTCTCCACTCAATGCAG
286
1
181542244
181542361
−1
TAATTGAGCTTCTTTGGTTCAGTGCATGAGTGGTTCAGTGGTTCATTGGGCAT
CCTGGTTGAGGG
 13260-L5-2
GTGCTATAGCTATAGAGACTGAGTGTGGGGTCTACAGAAAATGTGGCCATGCC
287
1
210949402
210949488
−1
CTCCACCCCAGTGGCTGGGCAGCCTTTGGCACAG
 13267-L5-1
CACCATAGGTGAGGTGGGGGCCAGCAGGGAGTGGGCTGGGCTGGGCTGGGCCA
288
1
226351579
226351677
1
AGGTACAAGGCCTCACCCTGCATCCCGCACCCAGGCTTCAACGTGG
 13274-L5-3
AGGTGGTGGTGGGGAGGACCCTGAGGGAGGGTGGGAGCACGGGAGAAGAGAAG
289
12
51578925
51579045
−1
GCATACCCAACCTGACCTACTTACCTGTCCCCTACCCCACAGAGGGCTTCCCT
GGAGGCCGCCATTGC
 13283-L5-3
GGGCACGGGGGTTGGGTGTGCAAAGGGTGGCAGCAAGGAAGGCAGGGGTCCTA
290
1
26753591
26753696
1
AGGTGTGTCCTCCTGCCCTCCTTGCTGTAGACTTTGGCCTGAGCAAAGAGGCC
 13291-L5-1
CGGGAGGGAAGGAGGGAGGAAGGGGCGCTTGGGCAGAACCAAGGGTGGCAGAT
291
1
36545595
36545702
1
TATCCTAGGGACTCTTGGGGCAGAACCAGACGCCTCTGCGTCCTCCCCTCTCC
CC
 13296-L5-3
CAGGAATTCCACTGGCAGCCAGGGCAGAGGGCACAGGAATCTGAGGTGACTGG
292
1
43686783
43686881
1
CACAGAAGACTCAGGCCTGTGGCTCCTCCCTCAGGACTGCTTCCTA
 13312-L5-1
GTGAGTGGGGCTGGGCTGTGGGGGAGGGGTGGGGTGGCAGGGAACAGGCAGAC
293
15
72689606
72689696
−1
CATCCCTTCTACCCACAGGATCCTGCTGCTGCAGACAG
 13325-R5-2
ACTCAGGCACTGCCTCTGACGATGCTCTCCCAGATCTGGTACGCTCATGGGGA
294
16
88088866
88088944
1
AGAGCCCAGCGCCAGGCAGTGTTGGA
 13335-L5-2
TGGCTGGGAGAGGAGCATAGGATGCGGCAGGAGGGCAGTGGAGGCTGAGGTAC
295
17
4803649
4803753
−1
GGATTTCTAGGCCCGCCCTACCCTCCTCTCTGCCCCTAGTGCCCGTGGCCAA
 13335-L5-3
TGGCTGGGAGAGGAGCATAGGATGCGGCAGGAGGGCAGTGGAGGCTGAGGTAC
296
17
4803649
4803753
−1
GGATTTCTAGGCCCGCCCTACCCTCCTCTCTGCCCCTAGTGCCCGTGGCCAA
 13339-L5-1
GCGGCGGACACCATCTTCTTTAAACCCTCAGTCCGTATTGGTCTCTATGGCAT
297
17
7150842
7150954
−1
CCATAGAGGCCATTCGGCTCTGAGGTCCTCAGTAAAGAAACTTAGATGGTATT
ACTGTGT
 13504-R5-3
TCACATGTCCTCAGCTGTTGTCTGGGTGAGGCATCCCTGTCGTGGGAGCAGCC
298
7
150369385
150369502
1
ACAGCTCTGCCTGGTCTCCCAGAGCAGGGACGCTTTGTCCGCATTTACAGCAG
TCTACACAGATG
 13532-L5-2
AGCCACACGGTCACACCTAATGTCATAGCCGGTAGAGCAGGGAGCCCTCTGGA
299
9
131989877
131989948
−1
TGGAAGCACTGTGAGGCTC
miR-1246
TGTATCCTTGAATGGATTTTTGGAGCAGGAGTGGACACCTGACCCAAAGGAAA
300
2
177173954
177174026
−1
TCAATCCATAGGCTAGCAAT
miR-1290
GAGCGTCACGTTGACACTCAAAAAGTTTCAGATTTTGGAACATTTCGGATTTT
301
1
19096152
19096229
−1
GGATTTTTGGATCAGGGATGCTCAA
miR-1308
CCCCGCATGGGTGGTTCAGTGGCAGAATTCTCAAATTGTAATCCCCATAATCC
302
X
21990180
21990233
−1
C
miR-142-3p
GACAGTGCAGTCACCCATAAAGTAGAAAGCACTACTAACAGCACTGGAGGGTG
303
17
53763592
53763678
−1
TAGTGTTTCCTACTTTATGGATGAGTGTACTGTG
miR-1826
ATTGATCATCGACACTTCGAACGCAATTGCAGCCCGGGTTCCTCCCAGGGCTT
304
16
33873009
33873093
1
TGCCTGTCTGAGCGTCGCTTGCCGATCAGTAG
miR-195
AGCTTCCCTGGCTCTAGCAGCACAGAAATATTGGCACAGGGAAGCGAGTCTGC
305
17
6861658
6861744
−1
CAATATTGGCTGTGCTGCTCCAGGCAGGGTGGTG
miR-200c
CCCTCGTCTTACCCAGCAGTGTTTGGGTGCGGTTGGGAGTCTCTAATACTGCC
306
12
6943123
6943190
1
GGGTAATGATGGAGG
miR-451
CTTGGGAATGGCAAGGAAACCGTTACCATTACTGAGTTTAGTAATGGTAATGG
307
17
24212513
24212584
−1
TTCTCTTGCTATACCCAGA
miR-483-5p
GAGGGGGAAGACGGGAGGAAAGAAGGGAGTGGTTCCATCACGCCTCCTCACTC
308
11
2111940
2112015
−1
CTCTCCTCCCGTCTTCTCCTCTC
miR-491-3p
TTGACTTAGCTGGGTAGTGGGGAACCCTTCCATGAGGAGTAGAACACTCCTTA
309
9
20706104
20706187
1
TGCAAGATTCCCTTCTACCTGGCTGGGTTGG
miR-494
GATACTCGAAGGAGAGGTTGTCCGTGTTGTCTTCTCTTTATTTATGATGAAAC
310
14
100565724
100565804
1
ATACACGGGAAACCTCTTTTTTAGTATC
miR-720
CCGGATCTCACACGGTGGTGTTAATATCTCGCTGGGGCCTCCAAAATGTTGTG
311
3
165541823
165541932
1
CCCAGGGGTGTTAGAGAAAACACCACACTTTGAGATGAATTAAGAGTCCTTTA
TTAG
miR-765
TTTAGGCGCTGATGAAAGTGGAGTTCAGTAGACAGCCCTTTTCAAGCCCTACG
80
1
155172547
155172660
−1
AGAAACTGGGGTTTCTGGAGGAGAAGGAAGGTGATGAAGGATCTGTTCTCGTG
AGCCTGAA
miR-98
AGGATTCTGCTCATGCCAGGGTGAGGTAGTAAGTTGTATTGTTGTGGGGTAGG
312
X
53599909
53600027
−1
GATATTAGGCCCCAATTAGAAGATAACTATACAACTTACTACTTTCCCTGGTG
TGTGGCATATTCA
miR-143
GCGCAGCGCCCTGTCTCCCAGCCTGAGGTGCAGTGCTGCATCTCTGGTCAGTT
313
5
148788674
148788779
1
GGGAGTCTGAGATGAAGCACTGTAGCTCAGGAAGAGAGAAGTTGTTCTGCAGC
miR-145
CACCTTGTCCTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTAAGATGG
314
5
148790402
148790489
1
GGATTCCTGGAAATACTGTTCTTGAGGTCATGGTT
miR-205
AAAGATCCTCAGACAATCCATGTGCTTCTCTTGTCCTTCATTCCACCGGAGTC
315
1
207672101
207672210
1
TGTCTCATACCCAACCAGATTTCAGTGGAGTGAAGTTCAGGAGGCATGGAGCT
GACA
miR-21
TGTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACACCA
316
17
55273409
55273480
1
GTCGATGGGCTGTCTGACA
miR-31
GGAGAGGAGGCAAGATGCTGGCATAGCTGTTGAACTGGGAACCTGCTATGCCA
317
9
21502114
21502184
−1
ACATATTGCCATCTTTCC

Microarray Validation

One or two microarrays were used for each of the samples in Table 8.

All sequences for which the intensity of the spot was higher than the local background mean intensity plus 1.5 times its standard deviation were declared “expressed.” The normalization was based on the signal obtained for positive controls.

The following parameters where used to check the quality of the microarray data for this experiment.

Control HeatMap: allows verification, after normalization, of:

a. the low signal of the negative control,

b. the specificity (CTL26 versus CTL26_MUT),

c. the approximate equality between positive control signals (without CTL30, which is a purification and labelling control),

d. the approximate equality between block signal medians (based only on positive controls),

e. the approximate equality between array signal medians (based on all sequences detected)

f. the purification and labelling control (CTL30).

Correlation within Sample Type:

for one sample type, the correlation between technical replicates (2 by 2) are computed, then the mean of all correlations obtained is computed.

Approximation of the Number of Detected Sequences by Sample:

When only one array is run for a sample, a very large or very small number of detected sequences may suggest a technical problem.

Effect of the Block and Array on the Normalized Signal:

based on the positive controls used for normalization, an ANOVA analysis is done to show the effect of the block and the array on the normalized signal. We check that the normalized signal obtained for one control on a particular block and a particular array is not due to the particular block or array.

Standard Deviation for Positive Control within One Particular Array and Among all Arrays:

The standard deviation for each positive control among all arrays is computed, as well as the mean of the standard deviation obtained for each control within one particular array. The normalization process may allow computation of similar “intra” and “inter” array variation (mean of standard deviation obtained within each array and standard deviation among all arrays).

Ability of the miRNA Profiles to Distinguish Sample Type:

A hierarchical classification among all arrays is applied, taking into account all predictions (the distance used is based on Pearson correlation and the agglomerate method is “Ward's minimum variant method”). A good clustering by sample type (technical replicates) indicates data of good quality.

Results of Microarray Validation

Control Heatmap:

The positive, block, and labeling/purification controls gave approximately the same normalized signals. We found that the specificity of all of the arrays was excellent.

Correlation, Standard Deviation, Approximate Number of Detected Sequences.

As shown in Table 13, the correlations obtained for tissues with two technical replicates were excellent. A higher or lower number of detected sequences were observed in some tissues compared to the typical number of detected sequences (see Table 13, bold rows). That result may be due to the degradation state of the RNA obtained.


TABLE 13
Number of
Number of
Number of
Correlation
detected
Arrays kept
Arrays not
(mean)
sequences
for analysis
computed
ASCC-1
322
1
0
SCC-1
0.983
~400
2
0
SCC-2
0.969
~300
2
0
ADC-1a
97
1
0
normal
0
1
SCC-3a
0.962
~300
2
0
SCC-4
0.99
~100
2
0
SCC-1b
0.986
~250
2
0
SCC-3b
291
1
1
ADC-1b
74
1
0
SCC-5
0.978
~450
2
0
ASCC-1b
624
1
0
CIN1
0
1
SCC-6
123
1
0
CIN3
0
1
SCC-7
610
1
0
SCC-8
249
1
0
ex-normal-1
109
1
0
ex-normal-3
66
1
0
ex-normal-4
365
1
0
Mean/Total
0.978
961
23
14.81%

Effect of the Array and Block on the Normalized Signal Obtained.

Based on the ANOVA analysis, we observed no effect of the array and block on the positive control normalized signal.

Standard Deviation of Positive Controls.

The intra-array standard deviation was 0.29, and the inter-array standard deviation was 0.32. Both numbers are low and suggest little array effect on the normalized signals.

Ability of the miRNA Profiles to Distinguish Between Sample Types.

All tissues that were analyzed in duplicate clustered together in this analysis, suggesting that the miRNA profiles did distinguish between sample types.

Based on the quality criteria considered, this microarray experiment was technically successful. For some tissues, however, a low number of sequences were detected, suggesting that tissue or RNA degradation may have affected some samples.

5.4 Example 4: mRNA Expression in Cervical Cell Lines and Clinical Samples

Cell Lines and Tumor Samples

The cell lines shown in Table 5 were used in this experiment. Total RNA from the cell lines was prepared as described in Example 1.

In addition, total RNA from two normal cervix and one squamous cervical tumor (SCC) were purchased from Applied Biosystems (Foster City, Calif.). See Table 14.


TABLE 14
Total RNA from Ambion
sample
Applied Biosystems
normal cervix - Ambion #1
AM6992 lot no. 07060421
normal cervix - Ambion #2
AM7276 lot no. 03030243
cervix tumor - Ambion #1 (squamous)
AM7277 lot 03030253

Total RNA was prepared from fresh frozen samples using TRIzol® Reagent (Invitrogen; Carlsbad, Calif.) according to manufacturer's protocols. All RNA samples showed a good A260/280 ratio.


TABLE 15
Clinical samples
Sample name
Sample type
SCC-1c
Frozen
SCC-3b
Frozen
SCC-4b
Frozen
SCC-5
Frozen
SCC-8
Frozen
SCC-9
Frozen
SCC-10
Frozen
ADC-1b
Frozen
ASCC-1b
Frozen
CIN1#1
Frozen
CIN1#2
Frozen
CIN2#1
Frozen
cx-normal-6
Frozen
cx-normal-8
Frozen
cx-normal-9
Frozen
cx-normal-12
Frozen

cDNA Synthesis—Cell Lines and Ambion Samples

Reverse transcription was performed using 1 μg total RNA. In each case, the cDNA preparation was performed in a 50 μL reaction volume using random hexamers and TaqMan® reverse transcription reagents (Applied Biosystems; Foster City, Calif.) according to manufacturer's instructions. In parallel, the same reactions were performed without the reverse transcriptase as no-RT controls.

cDNA Synthesis—Clinical Samples

Reverse transcription was performed using 0.5 μg total RNA in a 20 μL reaction volume using random hexamers and the High Capacity cDNA RT kit from Applied Biosystems, Inc. (Foster City, Calif.) according to manufacturer's protocol. In parallel, the same reactions were performed without the reverse transcriptase as no-RT controls. In order to evaluate the variation of cDNA synthesis within a sample, three parallel cDNA syntheses were performed on a selection of RNA samples.

Selection of Reference Genes

For the cell lines, ACTB and TBP were used as reference genes. For the clinical samples, ACTB, TBP, and GAPDH were used as reference genes for the clinical samples.

Selection of mRNA Targets

The mRNA targets are shown in Table 16.


TABLE 16
mRNA targets
amplicon
exon
gene
alias
size
boundary
comment
CDKN2A
p16ink4
70
1-2
all major
isoforms
BIRC5
survivin
86
1-2
all major
isoforms
TOP2A
72
23-24
MCM5
70
16-17
KRT19
CK19
64
2-3
EPCAM
TACSTD1
82
2-3
MMP2
86
10-11
MMP9
67
1-2
MCM2
82
2-3
VEGFC
93
4-5
TERT
94
3-4
PCNA
117
5-6
RPSA
67LR
121
7
MAPK3
Erk-1
64
2-3
IGF2BP3
L523S,
97
12-13
IMP-3
PIK3CA
104
6-7
POU4F1
brn-3a
104
1-2
MKI67
Ki-67
66
8-9

PCR

All PCR reactions were performed in triplicate in a 25 μL reaction volume on a Stratagene MX3000p instrument using a template concentration corresponding to 2 ng total RNA/reaction. TaqMan® Universal PCR Master Mix (Applied Biosystems Inc, Foster City, Calif.) was used for all reactions. The primers and probes used in the PCR reactions are shown in Tables 17 and 18. All probes were FAM-labeled and all reactions were run in singleplex.


TABLE 17
Primers and probes for mRNA target PCR reactions
SEQ
ID
CDKN2A
forward
5′-CATAGATGCCGCGGAAGGT-3′
318
reverse
5′-CCCGAGGTTTCTCAGAGCCT-3′
319
probe
FAM-CCTCAGACATCCCCGATTGAAAGAACC-TAMRA
320
BIRC5
forward
5′-CTTTCTCAAGGACCACCGCA-3′
321
reverse
5′-GCCTCGGCCATCCGCT-3′
322
probe
FAM-CATTCAAGAACTGGCCCTTCTTGGAGG-TAMRA
323
KRT19
forward
5′-AGATCGACAATGCCCGT-3′
324
reverse
5′-AGAGCCTGTTCCGTCTCAAA-3′
325
probe
FAM-TGGCTGCAGATGACTTCCGAACCA-TAMRA
326
EPCAM
forward
5′-TCATTTGCTCAAAGCTGGCTG-3′
327
reverse
5′-AAACTTGGGAGAAGAGCAAAACC-3′
328
probe
FAM-AAATGTTTGGTGATGAAGGCAGAAATGAATGG-
329
TAMRA
VEGFC
forward
5′-TTCATTCCATTATTAGACGTTCCCT-3′
330
reverse
5′-GATTATTCCACATGTAATTGGTGGG- 3′
331
probe
FAM-CCAGCAACACTACCACAGTGTCAGGCA-TAMRA
332
PCNA
forward
5′-TTAAATTGTCACAGACAAGTAATGTCG-3′
333
reverse
5′-TGGCTTTTGTAAAGAAGTTCAGGTAC-3′
334
probe
FAM-TGGTTCATTCATCTCTATGGTAACAGCTTCCTCC
335
T-TAMRA
MMP9
forward
5′-CCCTGGAGACCTGAGAACCA-3′
336
reverse
5′-AACCATAGCGGTACAGGTATTCCT-3′
337
probe
FAM-TCTCACCGACAGGCAGCTGGCA-TAMRA
338
MMP2
forward
5′-CCTGAGATCTGCAAACAGGACAT-3′
339
reverse
5′-CCAAATGAACCGGTCCTTGA-3′
340
probe
FAM-TTGATGGCATCGCTCAGATCCGTG-TAMRA
341
IGF2BP3
forward
5′-GCTAAAGTGAGGATGGTGATTATCACT-3′
342
reverse
5′-ACTAACAAAGTTTTCTTCTTTAATTTTTCCAT-3′
343
probe
FAM-ACCAGAGGCTCAGTTCAAGGCTCAGGGAA-
344
TAMRA


TABLE 18
Primer/probe kits used for mRNA target PCR reactions
Applied Biosystems Item Number
ACTB
Hs99999903_m1
GAPDH
Hs00266705_g1
TBP
Hs00427621_m1
TOP2A
Hs03063307_m1
MCM5
Hs01052142_m1
MKI67
Hs010332443_m1
POU4F1
Hs00366711_m1
MCM2
Hs00170472_m1
PIK3CA
Hs00180679_m1
MAPK3
Hs00385075_m1
RPSA
Hs03046712_g1
TERT
Hs99999022_m1

Primer and probe concentrations, as well as threshold settings used on the Stratagene MX3000 are shown in Table 19.


TABLE 19
mRNA target PCR conditions
Master Mix 25 μL reaction
Threshold
target
[forward]
[reverse]
[probe]
setting
CDKN2A
300 nM
300 nM
100 nM
500
BIRC5
100 nM
900 nM
150 nM
500
EPCAM
200 nM
200 nM
200 nM
500
KRT19
200 nM
200 nM
200 nM
500
VEGFC
500 nM
500 nM
200 nM
500
PCNA
500 nM
500 nM
200 nM
500
MMP2
500 nM
500 nM
200 nM
500
MMP9
500 nM
500 nM
200 nM
500
IGF2BP3
500 nM
500 nM
200 nM
250
RPSA 20X mix
1.25 μL
500
MAPK3 20X mix
1.25 μL
500
MCM5 20X mix
1.25 μL
250
TOP2A 20X mix
1.25 μL
500
TERT 20X mix
1.25 μL
250
MCM2 20X mix
1.25 μL
500
MKI67 20X mix
1.25 μL
500
PIK3CA 20X mix
1.25 μL
150
POU4F1 20X mix
1.25 μL
250
ACTB mix
1.25 μL
500
TBP mix
1.25 μL
500
GAPDH mix
1.25 μL
500

All reactions, except for EPCAM, were cycled as follows: 10 minutes at 95°, followed by 40 cycles of 20 seconds at 95° C. and 1 minute at 60° C. For EPCAM, the reaction was cycled as follows: 10 minutes at 95°, followed by 40 cycles of 20 seconds at 95° C. and 1 minute at 64° C.

Expression and Statistical Analysis

For the analysis of relative expression, GenEx 4.4.2 software was used (multiD analysis, Gothenburg, Sweden). The GenEx software uses the ΔΔCt formula, compensating for differences in PCR efficiency. All fold-change values are calculated relative to one normal sample from Ambion (AM6992). The GenEx statistical module was used for descriptive statistics and t-test analysis.

Results

PCR Specificity.

Specificity was determined using no-RT controls and analysis of amplicon size on an agarose gel. All amplicons tested were of the expected size, and we observed no amplification in no-RT controls, except for the no-RT controls for PCNA and RPSA, which was at very low levels and may have been due to contaminating DNA.

PCR Efficiency.

In order to estimate the PCR efficiency for target and control mRNAs, a pool of cDNA from all of the cell lines was diluted in three-fold steps to generate a standard curve. PCR efficiency was calculated by the MX3000p software (Stratagene). Most assays had a similar efficiency, as shown in Table 20, except for MMP2, IGF2BP3, PIK3CA and POU4F1, which had very low expression levels in the cell lines, so it was not possible to generate a standard curve. We found that MMP9 was not expressed in cell lines at all.


TABLE 20
PCR efficiency in pooled cDNA from cell lines
gene
PCR efficiency (%)
ACTB
95
TBP
95
GAPDH
95
CDKN2A
95
BIRC5
80
TOP2A
90
MCM5
95
KRT19
80
EPCAM
90
MMP2
too low expression
MMP9
no expression in cell lines
MCM2
75
VEGFC
80
TERT
too low expression
PCNA
75
RPSA
95
MAPK3
80
IGF2BP3
too low expression
PIK3CA
too low expression
POU4F1
too low expression
MKI67
90

Expression in Cell Lines.

In this experiment, CDKN2A and MKI67 were highly elevated compared to the normal cervix sample from Ambion. BIRC5 and TOP2A also show elevated levels. See Tables 21 and 22. MMP2, MMP9, TERT, and POU4F1 generated very high or no Ct values. IGF2BP3 was expressed at fairly high levels in all but one cell line.


TABLE 21
Fold-changes in expression levels:
Cell lines vs. normal#1 (Ambion)
cell line
CDKN2A
BIRC5
TOP2A
MCM5
MKI67
CaSki
589.3
11.4
16.5
7.2
128.8
SiHa
241.6
5.3
3.3
1.3
47.0
C4-1
294.6
5.1
2.7
0.5
85.6
C4-2
899.5
17.7
49.5
22.9
507.9
sw756
684.8
6.3
9.5
0.9
217.1
ME-180
455.7
4.2
4.4
0.7
98.0
C33-A
523.7
4.3
12.0
3.9
67.8
HeLa S3
487.1
5.1
20.8
3.9
137.4


TABLE 22
Fold-changes in expression levels: Cell lines vs. normal#1 (Ambion)
cell line
KRT19
EPCAM
MCM2
RPSA
PCNA
MAPK3
VEGFC
CaSki
2.86
1.27
0.27
0.82
1.51
0.40
0.23
SiHa
0.02
0.02
0.13
0.20
0.36
0.21
0.06
C4-1
2.11
2.19
0.06
0.80
1.02
0.61
0.26
C4-2
4.79
1.47
0.97
3.49
3.79
2.72
0.12
sw756
No Ct
0.20
0.14
0.58
1.46
0.36
0.17
ME-180
2.05
0.36
0.16
0.28
0.81
0.37
No Ct
C33-A
No Ct
0.03
0.31
1.90
0.55
0.78
1.72
HeLa S3
0.06
0.03
0.61
1.27
1.70
0.36
0.60

Expression in Clinical Samples.

All of the clinical samples, except for CIN3, SCC6, and SCC7, generated reliable Ct values for all of the reference genes. CIN3, SCC6, and SCC7 were therefore excluded from the analysis. See Tables 23 and 24.


TABLE 23
Fold-changes in expression levels: Clinical
samples vs. normal#1 (Ambion)
Tissue
samples
CDKN2A
BIRC5
TOP2A
MCM5
MMP9
MKI67
CIN1#1
21.6
9.5
26.1
23.0
70.9
0.2
CIN1#2
24.0
1.0
1.3
1.9
1.1
0.8
CIN2#1
30.8
3.5
3.7
0.4
2.0
1.2
SCC1c
304.3
7.0
65.7
31.6
14.0
137.9
SCC3b
202.2
5.5
79.5
39.8
6.4
107.0
SCC4b
282.1
9.9
39.3
13.4
3.4
46.4
SCC5
248.5
13.9
77.7
90.5
57.7
352.1
SCC8
292.0
4.0
26.1
11.9
8.8
48.7
SCC9
1.4
3.6
34.4
14.1
4.2
15.8
SCC10
261.4
4.0
15.7
1.5
11.9
9.6
ADC1b
76.6
13.1
82.3
21.3
12.2
ASCC1b
131.6
6.7
43.4
66.6
1.9
144.1
Tumor
382.8
2.5
57.8
47.9
1.4
84.4
AM7277
Ambion
Normal
3.6
0.6
1.9
1.6
0.1
1.8
AM7276
Ambion
normal#6
4.8
3.1
6.9
1.0
0.8
4.8
normal#8
6.3
3.7
3.5
2.1
0.8
6.2
normal#9
4.5
2.6
2.7
2.4
0.4
5.2
normal#12
8.7
1.4
1.0
1.1
4.2
2.6


TABLE 24
Fold-changes in expression levels: Clinical samples vs. normal#1 (Ambion)
Tissue
samples
KRT19
EPCAM
MMP2
MCM2
RPSA
PCNA
MAPK3
CIN1#1
1.1
0.8
0.02
1.5
6.2
1.7
0.9
CIN1#2
2.8
3.2
0.26
0.3
4.9
1.3
1.8
CIN2#1
1.4
1.0
0.23
0.3
3.1
2.4
3.3
SCC1c
2.8
1.8
0.09
4.7
4.6
1.7
0.8
SCC3b
2.2
2.7
0.30
4.5
2.8
4.4
1.4
SCC4b
4.7
17.6
0.41
5.2
3.6
1.0
2.2
SCC5
4.6
2.5
0.09
10.7
4.6
2.1
1.9
SCC8
7.5
1.6
0.32
2.1
3.3
1.2
0.5
SCC9
11.9
0.9
0.08
1.7
5.6
0.8
0.7
SCC10
5.0
1.6
0.39
1.0
6.0
8.1
2.4
ADC1b
2.7
31.8
0.38
2.6
1.5
1.6
3.8
ASCC1b
7.5
9.5
0.16
4.9
2.8
4.4
0.6
Tumor
0.3
0.1
0.07
3.3
0.7
0.6
1.6
AM7277
Ambion
Normal
0.5
1.2
0.11
1.2
1.4
0.4
3.0
AM7276
Ambion
normal#6
1.5
0.3
0.39
0.5
4.4
2.8
3.8
normal#8
2.0
0.9
0.40
0.7
2.2
2.8
7.6
normal#9
4.2
32.5
0.60
1.0
10.5
3.6
6.2
normal#12
2.3
7.2
1.31
0.6
8.0
2.3
4.3

The expression patterns for the cell lines in this experiment was similar to the expression patterns in the tumors. CDKN2A showed very high fold-changes in all SCC samples except for SCC9. SCC9 was further evaluated by immunohistological staining, and interestingly, the SCC9 sample was CDKN2A negative on the protein level. It is possible that SCC9 is HPV negative. MKI67, TOP2A, and MCM5 also showed high fold-changes in many of the tumor specimens.

There was a divergence in the results between the two CIN1 samples in this experiment. Because the CIN samples originate from biopsies without further micro-dissection, it is possible that the samples contain differing amounts of normal cells.

In this experiment, VEGFC, TERT, PIK3CA, POU4F1, and IGF2BP3 showed low to absent expression in all tumor an normal samples. Interestingly, IGF2BP3 was only detected in tumor samples, although with very high Ct values, and not in any of the normal samples.

Log 2 fold-change in expression values relative to the Ambion normal sample were plotted for all tumor samples, except for CIN samples, and for all of the normal samples. Those results are shown in FIGS. 3A and 3B. Error bars represent standard deviation (SD).

Statistical Analysis.

Tumor samples (n=10) and normal samples (n=6) were further analysed for significant differences in relative expression levels, using the t-test. Because SCC9 alone among tumor samples did not appear to express CDKN2A, SCC9 was excluded in the t-test. All genes fulfilled the normal distribution criteria for the t-test to be valid. The results are shown in Table 25.


TABLE 25
Statistical (t-test) analysis of expression data - tumor vs. normal
gene
expression pattern
p-value
CDKN2A
tumor > normal
0.000000012
BIRC5
tumor > normal
0.0015591
TOP2A
tumor > normal
0.0000002
MCM5
tumor > normal
0.0000901
MMP9
tumor > normal
0.0015077
MKI67
tumor > normal
0.0000787
KRT19
0.1037645 NS
EPCAM
0.7343875 NS
MMP2
tumor < normal
0.0315609
MCM2
tumor > normal
0.0002907
RPSA
0.8822517 NS
PCNA
0.8408861 NS
MAPK3
tumor < normal
0.0116822
NS = not significant

In this experiment, expression levels of CDKN2A, MKI67, TOP2A, and MCM5 were clearly elevated, and that elevation was statistically significant. Increased expression of at least those four mRNAs, and possibly others, correlate with tumors.

5.5 Example 5: mRNA Expression in Liquid PAP Specimens

Materials and Methods

Samples.

Three to six week old clinical liquid PAP specimens in PreservCyt transport media (Cytec) were used in this study. Four mL of each cell suspension was centrifuged at 2200×g for 15 minutes. The cell pellet was mixed with 700 μL QIAzol lysis reagent (Qiagen; Hilden, Germany). Total RNA was extracted using miRNeasy RNA extraction kit (Qiagen; Hilden, Germany), according to manufacturer's protocol. The RNA concentration of each sample was measured with a NanoDrop instrument (Thermo Scientific; Wilmington, Del.).

cDNA Synthesis.

Reverse transcription was performed using 10 μL total RNA (0.1-0.5 μg) in a 20 μL reaction volume using random hexamers and the High Capacity cDNA RT kit (Applied Biosystems, Inc.; Foster City, Calif.) according to manufacturer's protocol. In parallel, the same reactions were performed without the reverse transcriptase for no RT controls.

Selection of Reference mRNAs and Target mRNAs.

ACTB, GAPDH and TBP were selected as references for this experiment. CDKN2A and MKI67 were selected as target mRNAs.

PCR Reactions.

All PCR reactions were performed in triplicate in a 25 μL reaction volume on a Stratagene MX3000p instrument using a cDNA concentration corresponding to about 2 ng total RNA/reaction. TaqMan® Universal PCR Master Mix (Applied Biosystems, Inc; Foster City, Calif.) was used for all reactions. Primer and probe sequences, concentrations and thermal cycling conditions were the same as discussed in Example 4. All probes were FAM-labeled and all reactions were run in singleplex.

Expression Analysis.

GenEx 4.4.2 software (multiD analysis, Gothenburg, Sweden) to analyse relative expression. The GenEx software uses the ΔΔCt formula, compensating for differences in PCR efficiency.

Results

Total RNA yield varied between 0.3 μg-4 μg. Four of the samples yielded insufficient concentrations of RNA to be used for cDNA synthesis. Ten out of twenty-one cDNAs were further analyzed for mRNA expression; the remaining samples resulted in Ct values that were too high to be reliable. Ct values for the analyzed samples are shown in Table 26. The relative log 2 fold-changes are plotted in FIG. 4.


TABLE 26
Ct values
Sample ID
ACTB
GAPDH
TBP
CDKN2A
MKI67
HPV0056, HSIL
24.19
26.21
33.73
31.37
34.53
24.16
26.28
34.31
31.3
34.16
24.46
26.46
33.58
31.14
34.72
HPV0059, HSIL
24.79
27.20
35.30
28.9
35.14
24.54
27.42
35.18
29.18
35.2
25.03
27.24
35.27
28.99
35.74
HPV0060, HSIL
25.38
24.92
31.75
28.91
32.41
25.63
25.10
31.67
28.95
32.31
25.65
25.13
31.59
29.09
32.76
HPV0061, HSIL
25.88
25.98
31.69
26.98
29.68
25.79
25.93
32.09
27.01
29.52
26.05
25.91
31.93
26.89
29.86
HPV0062, HSIL
25.64
28.14
33.87
29.61
36.34
25.48
28.05
35.43
29.56
35.64
25.86
28.10
34.76
29.66
36.16
HPV0065, LSIL
29.72
28.07
35.75
32.44
34.86
29.62
27.87
35.92
32.22
34.98
30.01
27.82
34.90
32.84
34.82
HPV0066, LSIL
27.17
27.72
35.23
32.41
35.27
27.29
27.56
34.97
32.18
35.21
27.31
27.67
35.02
32.41
34.34
HPV0069, negative
26.56
29.05
34.97
31.21
No Ct
26.60
28.72
36.00
31.04
39.36
26.97
28.88
35.15
31.11
No Ct
HPV0071, negative
28.32
29.21
34.89
31.9
36.69
28.48
28.90
34.50
32.14
35.78
28.70
29.17
34.69
32.07
36.8
HPV0074, negative
28.37
27.09
32.97
31.06
35.18
28.60
27.02
32.74
31.05
36.25
28.46
27.00
33.01
31.3
36.26
HPV0078, negative
28.90
29.19
34.03
32.78
38.61
28.91
29.16
34.63
32.94
36.39
28.93
29.29
34.61
33.03
39.07
LSIL = low grade squamous intraepithelial lesion
HSIL = high grade squamous intraepithelial lesion

This experiment demonstrates that mRNA expression markers can be detected in liquid PAP specimens.

5.6 Example 6: Microrna Detection in Clinical Samples by RT-PCR

Materials and Methods

Samples.

Total RNA from normal cervix was purchased from Applied Biosystems, Inc. (Foster City, Calif.; ABI AM 6992; “Ambion sample”). Total RNA from cervical tumor and normal specimens were prepared as in Example 3.

MicroRNAs Selected for Analysis.

miR-21 was analyzed for each of the samples shown in Table 27. miR-1290 was analyzed for a subset of the samples, as shown in Table 27. RNU44, U47, and RNU48 were used for normalization.


TABLE 27
RNA samples and microRNAs selected for expression analysis
Sample
Sample
name
description
miR-21
miR-1290
SCC-1c
Frozen
x
x
SCC-3b
Frozen
x
x
SCC-4b
Frozen
x
x
SCC-5
Frozen
x
x
SCC-8
Frozen
x
x
SCC-9
Frozen
x
x
SCC-10
Frozen
x
x
SCC-11
Frozen
x
SCC-12
Frozen
x
SCC-13
FFPE
x
SCC-14
FFPE
x
SCC-15
FFPE
x
SCC-16
FFPE
x
SCC-17
FFPE
x
ASCC-1b
Frozen
x
AIS-1
FFPE
x
AIS-2
FFPE
x
ADC-1b
Frozen
x
ADC-2
FFPE
x
ADC-3
FFPE
x
ADC-4
FFPE
x
CIN3-2
FFPE
x
cx-normal-6
Frozen
x
cx-normal-8
Frozen
x
cx-normal-9
Frozen
x
cx-normal-12
Frozen
x
x
cx-normal-13
Frozen
x
cx-normal-14
Frozen
x
cx-normal-15
Frozen
x
cx-normal-16
Frozen
x
cx-normal-17
Frozen
x
cx-normal-19
Frozen
x
cx-normal-20
Frozen
x
normal
ABI
x
x
Ambion
frozen
hyperplasia-1
Frozen
x
(benign)
SCC = Squamous Cervical Carcinoma, ADC = Cervical Adenocarcinoma, ASCC = Adeno-Squamous Cervical Carcinoma, AIS = Adenocarcinoma in situ

RT-PCR Reactions.

All microRNA RT-PCR assays were purchased from Applied Biosystems Inc (Foster City, Calif.), including those for normalization genes. The cDNA synthesis and PCR reactions were performed according to manufacturer's protocols. All PCR reactions were run on an MX3000 instrument (Stratagene).

Expression Analysis.

For the analysis of relative expression, the GenEx 4.4.2 software (multiD analysis, Gothenburg, Sweden) was used. The GenEx software uses the ΔΔCt formula, compensating for differences in PCR efficiency. The GenEx statistical module was used for t-test analysis.

Results

MiR-205 and miR-1290 show a statistically significant difference in expression levels between tumor and normal samples. See FIGS. 5 and 6. Interestingly, miR-205 is markedly down-regulated in adeno-carcinoma specimens, which originate from glandular endothelial cells, while it is upregulated in squamous carcinoma specimens, which are derived from epithelial cells. This result is consistent with reports discussing other forms of cancer, such as lung cancer.

These results demonstrate that RT-PCR can be used to detect increases in expression of microRNAs in cervical specimens.

5.8 Example 7: Bioinformatic Analysis to Identify microRNAs

In order to identify the microRNAs detected with the probes shown, e.g., in Tables 1 and 11, small RNA sequencing (smRNASeq) datasets were analysed using the probe sequences to identify expressed microRNAs detected by those sequences. The analysis identified 44 sequences with precise ends, corresponding to 37 arms (i.e., some of the sequences appear to be isomirs, or multiple candidate microRNAs from a single arm). Those 44 candidate microRNA sequences are show in Table 28.


TABLE 28
microRNA candidate sequences corresponding to
probes
microRNA candidate
SEQ
Arm name
sequence 5′ -> 3′
ID
12726-L
TCCCCCAACCCACAGCACACAC
345
12730-R
CCCGGAGAGCGGAGCACAACACA
346
12730-R
CCGGAGAGCGGAGCACAAC
347
13108-L
CCAAGGAAGGCAGCAGGC
348
13122-L
GATGGAATTTCCTAAAGG
349
13124-L
GGAGGGGAGGAGACATG
350
13181-L
GCAGTGACTGTTCAGACGTCCA
351
13207-R
TGTCTTTCCTTGTTGGAGCAGG
352
13209-L
CAGCAGGCGAGTTACCTCAA
353
13227-L
GAGGAGGACTGGGCCCTA
354
13229-R
AGCCGCTCTTCTCCCTGCCCACA
355
13229-R
AGCCGCTCTTCTCCCTGCCCACAG
356
13231-L
TGGGGAGCGGCCCCCGGG
357
13247-L
GAGGTCGGGAGGGGAAGGCGGCT
358
13252-L
TCAAGGAGCTCACAGTC
359
13254-R
GCATGAGTGGTTCAGTGGT
360
13267-L
GTGGGCTGGGCTGGGCTGGGC
361
13274-L
GGAGGACCCTGAGGGAGGGTGGG
362
13274-L
TGAGGGAGGGTGGGAGC
363
13283-L
TGGCAGCAAGGAAGGCAGGGGTC
364
13291-L
GAGGGAAGGAGGGAGGAA
365
13296-L
CAGGGCAGAGGGCACAGGAATCTGA
366
13325-R
GGGAAGAGCCCAGCGCC
367
13339-L
ACCCTCAGTCCGTATTGGTCTCT
368
13504-R
GTCTCCCAGAGCAGGGACGCTTT
369
   25-R
TTAGAAAAAGAGGGGGTGAGG
370
 3371-L
TGGGGTGTGGAGGGGAGG
371
 3744-R
AGGGGAGCAGGGAGGAA
372
 3995-L
TGGCCTGACGTGAGGAGGAGG
373
 4417-R
ACGGACAGGGAACTTTTTGAT
374
 4440-L
GCCCAGTGCTCTGAATGTCAAA
375
 4440-L
TCTGCCCAGTGCTCTGAATGTCA
376
 4440-R
GGCGGGAGTAACTATGAC
377
 4440-R
CGGGTAAACGGCGGGAGTAACT
378
 4498-L
AGCAGGCGCACGGCCGTCTGGATC
379
 4498-L
GCACGGCCGTCTGGATCTCC
380
 5192-L
GAGGAAGGAAGGGGAAA
381
 6216-L
CAGTGCTCTGAATGTCAAAGTGAAGA
382
 6216-R
GGGTAAACGGCGGGAGTA
383
 6235-R
AAATGGATTTTTGGAGCAG
384
 6930-R
TGCAAGATCAGAGGGGAGA
385
 7578-L
GGGGCTGTAGCTCAGGG
386
 8339-R
GCCGGTACAGTGAAAAT
387
 8339-R
GCCGGTACAGTGAAAATG
388

All publications, patents, patent applications and other documents cited in this application are hereby incorporated by reference in their entireties for all purposes to the same extent as if each individual publication, patent, patent application or other document were individually indicated to be incorporated by reference for all purposes.

While various specific embodiments have been illustrated and described, it will be appreciated that changes can be made without departing from the spirit and scope of the invention(s).

<160> NUMBER OF SEQ ID NOS: 409

<210> SEQ ID NO: 1

<211> LENGTH: 44

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 1

tttcctttcc tcccctccac accccatgac tccccacact tgag 44

<210> SEQ ID NO: 2

<211> LENGTH: 36

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 2

ggaaagtcag cccccagcgc cccccggagt tcttgg 36

<210> SEQ ID NO: 3

<211> LENGTH: 36

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 3

ctcctcctcc ccgtctttgg ataccaaaca ctggac 36

<210> SEQ ID NO: 4

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 4

ctcagcccca gctggagaat ttttcccctc atta 34

<210> SEQ ID NO: 5

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 5

ttcttgccct ccaatccccg ggctccacca gcc 33

<210> SEQ ID NO: 6

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 6

gctccctctc tggttggacc tcacccaaag at 32

<210> SEQ ID NO: 7

<211> LENGTH: 40

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 7

aatcatccat ttcatccgca tctccctctt ggccccttgc 40

<210> SEQ ID NO: 8

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 8

aaagtctcgc tctctgcccc tca 23

<210> SEQ ID NO: 9

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 9

tcggccctgc ctcctcctcc t 21

<210> SEQ ID NO: 10

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 10

taaagagact tcctccactg ccagagatct 30

<210> SEQ ID NO: 11

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 11

tcagcgcaac aagccccgca gtcacccctc t 31

<210> SEQ ID NO: 12

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 12

aaatggctcc tttccccttt ccctccaccg 30

<210> SEQ ID NO: 13

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 13

cgtctccctc cctcatgtgc 20

<210> SEQ ID NO: 14

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 14

acaggctact ttcagcaaat atgtccatcc t 31

<210> SEQ ID NO: 15

<211> LENGTH: 39

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 15

cccagaagac atcagacaga gttgtttctt ctccctcta 39

<210> SEQ ID NO: 16

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 16

gccctctggc ccctgcctaa ttggctgc 28

<210> SEQ ID NO: 17

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 17

catttttccc cttccttcct ctatatcagc aa 32

<210> SEQ ID NO: 18

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 18

gattccagcc ccttccccc 19

<210> SEQ ID NO: 19

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 19

cattaacccc cattatcaca gcacgcccca ttc 33

<210> SEQ ID NO: 20

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 20

gattccactt ttcttaatga ctttcccctc ct 32

<210> SEQ ID NO: 21

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 21

gccccgcccc acctttcggg gctcacctgg c 31

<210> SEQ ID NO: 22

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 22

gggttgcctc taatgtggta atagatgtca tt 32

<210> SEQ ID NO: 23

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 23

ccctcctttc cccacctcag t 21

<210> SEQ ID NO: 24

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 24

ctcagctgtt cccggtgcca g 21

<210> SEQ ID NO: 25

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 25

attaatcctt ctctcccctc tg 22

<210> SEQ ID NO: 26

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 26

gcccctgcca gaatcctcta acagctctaa ttgg 34

<210> SEQ ID NO: 27

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 27

accgcgacat agcctcgccc cc 22

<210> SEQ ID NO: 28

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 28

ctcgcaaagg atctccttca tccctcccca 30

<210> SEQ ID NO: 29

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 29

ccctctctgc ctctctcatc accaataaca gac 33

<210> SEQ ID NO: 30

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 30

cccagctaca cctccacgca 20

<210> SEQ ID NO: 31

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 31

atcagggtat cctctcccca 20

<210> SEQ ID NO: 32

<211> LENGTH: 39

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 32

aaataatcat tccaaatggt tctccctgct atgattcac 39

<210> SEQ ID NO: 33

<211> LENGTH: 55

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 33

cccgagcccg gcgccctgtg ttgtgctccg ctctccggga aatgccatca ctaat 55

<210> SEQ ID NO: 34

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 34

gccaagcttg gaacctctcc ctgccagcat cac 33

<210> SEQ ID NO: 35

<211> LENGTH: 29

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 35

tctggagtac cacctgtttt tcccccact 29

<210> SEQ ID NO: 36

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 36

gtgatgcaga ggacttcctg ctccaggtct c 31

<210> SEQ ID NO: 37

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 37

aaggctgtcc ctcaccagac ttccccaccc ct 32

<210> SEQ ID NO: 38

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 38

gcggtcccgc ggcgccccgc ct 22

<210> SEQ ID NO: 39

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 39

catcaccttc cttctcctcc a 21

<210> SEQ ID NO: 40

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 40

cactgcaccg cgtcccgtcc ct 22

<210> SEQ ID NO: 41

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 41

ctgcgattcc tccctctact gt 22

<210> SEQ ID NO: 42

<211> LENGTH: 94

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 42

ctcaagtgtg gggagtcatg gggtgtggag gggaggaaag gaaaggtatt ttgtttcttt 60

gtctatacat ttcctagatt tctatgcagt tggg 94

<210> SEQ ID NO: 43

<211> LENGTH: 69

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 43

ggggacgtgg cccctccccc ccggagcggg actccaagaa ctccgggggg cgctgggggc 60

tgactttcc 69

<210> SEQ ID NO: 44

<211> LENGTH: 73

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 44

ctttttctct ctgctgggaa accttgcttg acttcatgtc cagtgtttgg tatccaaaga 60

cggggaggag gag 73

<210> SEQ ID NO: 45

<211> LENGTH: 73

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 45

ctcagtatct tcagcttggg aaactgacct cgttaatttt aatgagggga aaaattctcc 60

agctggggct gag 73

<210> SEQ ID NO: 46

<211> LENGTH: 87

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 46

ggaagggcac tgtctctctg attcccaggg cctgtcattt cccgagggct ggtggagccc 60

ggggattgga gggcaagaag cccagcc 87

<210> SEQ ID NO: 47

<211> LENGTH: 74

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 47

gccacctttc atggtgagga tgcctgccac cttcaggatc acatctttgg gtgaggtcca 60

accagagagg gagc 74

<210> SEQ ID NO: 48

<211> LENGTH: 84

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 48

gcaaggggcc aagagggaga tgcggatgaa atggatgatt taatgggtca tctctcctgt 60

agttaatttc tctagatctc ttgt 84

<210> SEQ ID NO: 49

<211> LENGTH: 94

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 49

ataaaggaag ttaggctgag gggcagagag cgagactttt ctattttcca aaagctcggt 60

ctgaggcccc tcagtcttgc ttcctaaccc gcgc 94

<210> SEQ ID NO: 50

<211> LENGTH: 84

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 50

gcttggtgag aggaggagga ggcagggccg accgccaccc gcctgtctgc catctggtcc 60

ccttcccctc cctcctctca ttgc 84

<210> SEQ ID NO: 51

<211> LENGTH: 70

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 51

tgaagaattt cttctggatg actgaccaag aggctattca agatctctgg cagtggagga 60

agtctcttta 70

<210> SEQ ID NO: 52

<211> LENGTH: 75

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 52

agaggggtga ctgcggggct tgttgcgctg aagatttaca atgtacttct tgcaggcggc 60

tcagcaaccc cctct 75

<210> SEQ ID NO: 53

<211> LENGTH: 75

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 53

cggtggaggg aaaggggaaa ggagccattt tctgctgcac atcagtcagt gcctgcgccc 60

tccctccctc cgccg 75

<210> SEQ ID NO: 54

<211> LENGTH: 78

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 54

tgctggaggt aagggttttc tgaagcctgg tgccatggcc acatgtgcac atgagggagg 60

gagacgctga ggctagca 78

<210> SEQ ID NO: 55

<211> LENGTH: 71

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 55

aggatggaca tatttgctga aagtagcctg tgcattaatt ggttatggaa gtttaaaaat 60

ggtgtcctcc t 71

<210> SEQ ID NO: 56

<211> LENGTH: 78

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 56

tagagggaga agaaacaact ctgtctgatg tcttctggga tggccttaat acagatagca 60

ttgtctcttc catttctg 78

<210> SEQ ID NO: 57

<211> LENGTH: 70

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 57

gcccagttaa ttggtctctc aacctacatt agctgttgca ttgcagccaa ttaggcaggg 60

gccagagggc 70

<210> SEQ ID NO: 58

<211> LENGTH: 80

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 58

gtctttgctg atatagagga aggaagggga aaaatgagcg cattagttct cttttattaa 60

aagagttatt tcagcatgac 80

<210> SEQ ID NO: 59

<211> LENGTH: 75

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 59

gggggaaggg gctggaatca tcgtgggttg gaacagttaa aggaacctct gttcagcccc 60

agccccaagg ctccc 75

<210> SEQ ID NO: 60

<211> LENGTH: 89

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 60

gccatgggcc tccatagttt cctgtagccc ccttggttcc caagaatagt tttggaatgg 60

ggcgtgctgt gataatgggg gttaatggt 89

<210> SEQ ID NO: 61

<211> LENGTH: 83

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 61

gattcatcta ttctttttct ccttcttcaa agataactct gtaagcactt aaggagggga 60

aagtcattaa gaaaagtgga atc 83

<210> SEQ ID NO: 62

<211> LENGTH: 74

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 62

agcagccagg tgagccccga aaggtggggc ggggcagggg cgctcccagc cccaccccgg 60

gatctggtga cgct 74

<210> SEQ ID NO: 63

<211> LENGTH: 84

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 63

aatgacatct attaccacat tagaggcaac ccataacaat cccttataga atgtttgtct 60

caattttggt tatttaatgt catt 84

<210> SEQ ID NO: 64

<211> LENGTH: 87

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 64

ccctcccagt tcccatagca actgggctgt agcagccaga acttgattga gcccagcagt 60

ggcccgactg aggtggggaa aggaggg 87

<210> SEQ ID NO: 65

<211> LENGTH: 71

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 65

caaattacat ctgtttatgc ttctatttgt tagacaatct ggcaccggga acagctgagc 60

agaaggattt g 71

<210> SEQ ID NO: 66

<211> LENGTH: 73

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 66

tgtcatttgt ccattttctc ttctgaccca gtggtattct gcaagatcag aggggagaga 60

aggattaatg tca 73

<210> SEQ ID NO: 67

<211> LENGTH: 90

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 67

gcctctgtgc gcatggatat aatcagcttt gataggcaga ggctgaggct gtttttccaa 60

ttagagctgt tagaggattc tggcaggggc 90

<210> SEQ ID NO: 68

<211> LENGTH: 85

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 68

gggggcgagg ctatgtcgcg gtggcagccc ggatgggccg gcagggccgg gagtaacggg 60

acgtcgccgc ggagcttctt ccccc 85

<210> SEQ ID NO: 69

<211> LENGTH: 73

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 69

ggcatttctt cttgtgtttc ctcttctcct cttctgggga gggatgaagg agatcctttg 60

cgagaggcat gtt 73

<210> SEQ ID NO: 70

<211> LENGTH: 88

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 70

tgctatctcg cctcacacat caacacacgt gccagacaga ttctgactgc aaagtctgtt 60

attggtgatg agagaggcag agagggca 88

<210> SEQ ID NO: 71

<211> LENGTH: 86

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 71

cagctggcct ggtgccctgg tgcgtggagg tgtagctggg ctctgaccca gctcctcaaa 60

caggttccat atggccctcc cggctg 86

<210> SEQ ID NO: 72

<211> LENGTH: 73

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 72

gtcaggctgc tgtattctct tacacagatg ccagtaagaa caaaggcatc acgtggggag 60

aggataccct gat 73

<210> SEQ ID NO: 73

<211> LENGTH: 98

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 73

aaataagcca ttccaaacca ttctctgatt tgctgtgagt ggcagaatca ttcaccgtgg 60

tgaatcatag cagggagaac catttggaat gattattt 98

<210> SEQ ID NO: 74

<211> LENGTH: 107

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 74

cccggctcgg ccccgcgtct ctccagctcc tccggctcct tttagtgcat aaattagtga 60

tggcatttcc cggagagcgg agcacaacac agggcgccgg gctcggg 107

<210> SEQ ID NO: 75

<211> LENGTH: 85

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 75

ggcccagaag atgaaaagct gaagtccttt cccttccagc tgaagccagg tgtgatgctg 60

gcagggagag gttccaagct tggcc 85

<210> SEQ ID NO: 76

<211> LENGTH: 66

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 76

ttctgagata tgatctgttg gattctctac taccaaagtg ggggaaaaac aggtggtact 60

ccagaa 66

<210> SEQ ID NO: 77

<211> LENGTH: 85

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 77

ggacactctg aaccccaagt ggaattccaa ctgccagttc ttcatccgag acctggagca 60

ggaagtcctc tgcatcactg tgttc 85

<210> SEQ ID NO: 78

<211> LENGTH: 75

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 78

aggggtgggg aagtctggtg agggacagcc ttgagtcaaa ggatggtcac cgctccatgt 60

ggctgcccca cccct 75

<210> SEQ ID NO: 79

<211> LENGTH: 93

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 79

ccttccggcg tcccaggcgg ggcgccgcgg gaccgccctc gtgtctgtgg cggtgggatc 60

ccgcggccgt gttttcctgg tggcccggcc atg 93

<210> SEQ ID NO: 80

<211> LENGTH: 114

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 80

tttaggcgct gatgaaagtg gagttcagta gacagccctt ttcaagccct acgagaaact 60

ggggtttctg gaggagaagg aaggtgatga aggatctgtt ctcgtgagcc tgaa 114

<210> SEQ ID NO: 81

<211> LENGTH: 96

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 81

cgggccccgg gcgggcggga gggacgggac gcggtgcagt gttgtttttt cccccgccaa 60

tattgcactc gtcccggcct ccggcccccc cggccc 96

<210> SEQ ID NO: 82

<211> LENGTH: 98

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 82

tcaaggccac tgggacagta gagggaggaa tcgcagaaat cactccagga gcaactgaga 60

gaccttgctt ctactttacc aggtcctgct ggcccaga 98

<210> SEQ ID NO: 83

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

oligonucleotide

<400> SEQENCE: 83

cgcgcgucgc uuuaucuacu gu 22

<210> SEQ ID NO: 84

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

oligonucleotide

<400> SEQENCE: 84

uuaucguucg auaagucgcg uu 22

<210> SEQ ID NO: 85

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

oligonucleotide

<400> SEQENCE: 85

gaaguuacua uguaggcaac cu 22

<210> SEQ ID NO: 86

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

oligonucleotide

<400> SEQENCE: 86

cgcgggacua auuguuaccg gg 22

<210> SEQ ID NO: 87

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

oligonucleotide

<400> SEQENCE: 87

ucgcgucgaa cuccgcaacc ga 22

<210> SEQ ID NO: 88

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

oligonucleotide

<400> SEQENCE: 88

accgaacgcc guacccaucg gg 22

<210> SEQ ID NO: 89

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

oligonucleotide

<400> SEQENCE: 89

cgaggguaac gacucucgug uc 22

<210> SEQ ID NO: 90

<211> LENGTH: 15

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 90

ttgtaatacg actca 15

<210> SEQ ID NO: 91

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 91

ugaggggcag agagcgagac uuu 23

<210> SEQ ID NO: 92

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 92

aggcggggcg ccgcgggacc gc 22

<210> SEQ ID NO: 93

<211> LENGTH: 21

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 93

uggaggagaa ggaaggugau g 21

<210> SEQ ID NO: 94

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 94

agggacggga cgcggugcag ug 22

<210> SEQ ID NO: 95

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 95

acaguagagg gaggaaucgc ag 22

<210> SEQ ID NO: 96

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 96

ucuuugguua ucuagcugua uga 23

<210> SEQ ID NO: 97

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 97

acaguagucu gcacauuggu ua 22

<210> SEQ ID NO: 98

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 98

cccaguguuc agacuaccug uuc 23

<210> SEQ ID NO: 99

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 99

cccaguguuu agacuaucug uuc 23

<210> SEQ ID NO: 100

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 100

guccaguuuu cccaggaauc ccu 23

<210> SEQ ID NO: 101

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 101

uuuggucccc uucaaccagc ug 22

<210> SEQ ID NO: 102

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 102

uuuggucccc uucaaccagc ua 22

<210> SEQ ID NO: 103

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 103

acagcaggca cagacaggca gu 22

<210> SEQ ID NO: 104

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 104

cugaagcuca gagggcucug au 22

<210> SEQ ID NO: 105

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 105

cugugcgugu gacagcggcu ga 22

<210> SEQ ID NO: 106

<211> LENGTH: 24

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 106

uuuggcaaug guagaacuca cacu 24

<210> SEQ ID NO: 107

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 107

uauggcacug guagaauuca cu 22

<210> SEQ ID NO: 108

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 108

ugagaacuga auuccauggg uu 22

<210> SEQ ID NO: 109

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 109

uagcuuauca gacugauguu ga 22

<210> SEQ ID NO: 110

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 110

cagugcaaua guauugucaa agc 23

<210> SEQ ID NO: 111

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 111

uguaguguuu ccuacuuuau gga 23

<210> SEQ ID NO: 112

<211> LENGTH: 21

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 112

cauaaaguag aaagcacuac u 21

<210> SEQ ID NO: 113

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 113

uguaacagca acuccaugug ga 22

<210> SEQ ID NO: 114

<211> LENGTH: 21

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 114

augaccuaug aauugacaga c 21

<210> SEQ ID NO: 115

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 115

uauugcacau uacuaaguug ca 22

<210> SEQ ID NO: 116

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 116

auauaauaca accugcuaag ug 22

<210> SEQ ID NO: 117

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 117

ugugcgcagg gagaccucuc cc 22

<210> SEQ ID NO: 118

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 118

cugggaucuc cggggucuug guu 23

<210> SEQ ID NO: 119

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 119

aggaagcccu ggaggggcug gag 23

<210> SEQ ID NO: 120

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 120

ugucuacuac uggagacacu gg 22

<210> SEQ ID NO: 121

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 121

ccaguuaccg cuuccgcuac cgc 23

<210> SEQ ID NO: 122

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 122

auccgcgcuc ugacucucug cc 22

<210> SEQ ID NO: 123

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 123

ugcccuuaaa ggugaaccca gu 22

<210> SEQ ID NO: 124

<211> LENGTH: 24

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 124

uggggagcug aggcucuggg ggug 24

<210> SEQ ID NO: 125

<211> LENGTH: 21

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 125

aaggcagggc ccccgcuccc c 21

<210> SEQ ID NO: 126

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 126

cacccggcug ugugcacaug ugc 23

<210> SEQ ID NO: 127

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 127

ucuucucugu uuuggccaug ug 22

<210> SEQ ID NO: 128

<211> LENGTH: 21

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 128

cugacuguug ccguccucca g 21

<210> SEQ ID NO: 129

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 129

aaauuauugu acaucggaug ag 22

<210> SEQ ID NO: 130

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 130

aaggagcuua caaucuagcu ggg 23

<210> SEQ ID NO: 131

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 131

cggccccacg caccagggua ag 22

<210> SEQ ID NO: 132

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 132

cugcccuggc ccgagggacc ga 22

<210> SEQ ID NO: 133

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 133

ttctgctttc ccagagcctc accccctctt tt 32

<210> SEQ ID NO: 134

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 134

acacctgtct ctccccagtg cttccgcccc tca 33

<210> SEQ ID NO: 135

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 135

tccaacactg cctggcgctg ggctcttccc ca 32

<210> SEQ ID NO: 136

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 136

ccacacttct aattggacaa agtgcctttc aaact 35

<210> SEQ ID NO: 137

<211> LENGTH: 36

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 137

cagcctgcca ccgccgcttt tgaaagaagc acttca 36

<210> SEQ ID NO: 138

<211> LENGTH: 40

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 138

cttctccttc ctccctgctc ccctcccact aatgccaaat 40

<210> SEQ ID NO: 139

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 139

ggctccctag tgaaaaaatg caaaatttgt ataat 35

<210> SEQ ID NO: 140

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 140

ccactgccct cctgccgcat cctatgctcc tct 33

<210> SEQ ID NO: 141

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 141

actcggcgct catcaaaaag ttccctgtcc g 31

<210> SEQ ID NO: 142

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 142

tttgacattc agagcactgg gcagaaatca ca 32

<210> SEQ ID NO: 143

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 143

gtcatagtta ctcccgccgt ttacccgcat ttc 33

<210> SEQ ID NO: 144

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 144

gagatccaga cggccgtgcg cctgctgctg cct 33

<210> SEQ ID NO: 145

<211> LENGTH: 38

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 145

acagcatcac atggattctg tgtccagtgg ccttagca 38

<210> SEQ ID NO: 146

<211> LENGTH: 38

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 146

acatgctcct gacactttct cttagtttct cgggctcc 38

<210> SEQ ID NO: 147

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 147

tccctttgtg ctgcccgagt gccttccccc tg 32

<210> SEQ ID NO: 148

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 148

cgggtctccc gcttccccct cctgctccaa gg 32

<210> SEQ ID NO: 149

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 149

ctcctcctcc ccgtctttgg ataccaaaca c 31

<210> SEQ ID NO: 150

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 150

gactgagggt ttaaagaaga tggtgtccgc cgc 33

<210> SEQ ID NO: 151

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 151

gacattcaga gcactgggca gaaatcacat g 31

<210> SEQ ID NO: 152

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 152

catagttact cccgccgttt acccgtgctt c 31

<210> SEQ ID NO: 153

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 153

tctgctccaa aaatccattt aatatattgt 30

<210> SEQ ID NO: 154

<211> LENGTH: 29

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 154

gctccctctc tggttggacc tcacccaaa 29

<210> SEQ ID NO: 155

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 155

ggagatccag acggccgagc gcctgctgct gccc 34

<210> SEQ ID NO: 156

<211> LENGTH: 29

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 156

gcacacccgc tctccggccc gcgcccctg 29

<210> SEQ ID NO: 157

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 157

aactagccgt ttccgtcacc ttcccctgcc ccc 33

<210> SEQ ID NO: 158

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 158

acaatattta tccagggatg ggagtcagat gca 33

<210> SEQ ID NO: 159

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 159

cgcagtgcac accctgagct acagcccctc 30

<210> SEQ ID NO: 160

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 160

agcctgtgcc tgccgctgtc tagtactggt 30

<210> SEQ ID NO: 161

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 161

caagagccag cctgcactac cagtcccatg cca 33

<210> SEQ ID NO: 162

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 162

ggaactgctt ctccttgctc cagtcattga ag 32

<210> SEQ ID NO: 163

<211> LENGTH: 38

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 163

gatgctggcg tccgccgcag cctctcgccc catcccgg 38

<210> SEQ ID NO: 164

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 164

aaaagccaat acattttcac tgtaccggcc ac 32

<210> SEQ ID NO: 165

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 165

agactgctgt aaatgcggac aaagcgtccc tgc 33

<210> SEQ ID NO: 166

<211> LENGTH: 41

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 166

tgcttccatc ccgccagttt ggtttcattg tactgacaac c 41

<210> SEQ ID NO: 167

<211> LENGTH: 40

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 167

ctgggtgagg tcccaccgtg gtgcgcttgg ctgtgccagc 40

<210> SEQ ID NO: 168

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 168

acctcagcct ccactgccct cctgccgcat cctat 35

<210> SEQ ID NO: 169

<211> LENGTH: 29

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 169

ccctttaaga gcctctccgc gcgctgccg 29

<210> SEQ ID NO: 170

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 170

ccgtggatgt caactcagct gccttccgcc 30

<210> SEQ ID NO: 171

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 171

gcatgctaat tgtgccctgt tgtctttctt aaact 35

<210> SEQ ID NO: 172

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 172

tgctctaccg gctatgacat taggtgtgac cg 32

<210> SEQ ID NO: 173

<211> LENGTH: 38

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 173

gggaggagtc aggtgtgtgc tgtgggttgg gggaagac 38

<210> SEQ ID NO: 174

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 174

gcgccctgtg ttgtgctccg ctctccggga aatgc 35

<210> SEQ ID NO: 175

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 175

gggcccttcc cttcccccaa cattgagcct tg 32

<210> SEQ ID NO: 176

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 176

ggacctatgg gcccttccct tcccccaaca ttg 33

<210> SEQ ID NO: 177

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 177

tgaaagctga agtccagccc agccctct 28

<210> SEQ ID NO: 178

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 178

ctgctgcctt ccttggttga ggggcctgag cacg 34

<210> SEQ ID NO: 179

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 179

tctccgccgg gccttcaccc tgccctgctc ttct 34

<210> SEQ ID NO: 180

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 180

ttaggaaatt ccatctcacc tgctccagtc c 31

<210> SEQ ID NO: 181

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 181

gctccatgtc tcctcccctc cgcgaaagcc taaac 35

<210> SEQ ID NO: 182

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 182

agccttcctg tcccctggcc cccgacctgc tcca 34

<210> SEQ ID NO: 183

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 183

cgcttcctta accatttttt ttttttttaa ccac 34

<210> SEQ ID NO: 184

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 184

tggacgtctg aacagtcact gcctgcccca acct 34

<210> SEQ ID NO: 185

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 185

atgaccattt gtattagtat cttttttttt ttt 33

<210> SEQ ID NO: 186

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 186

ctgcggcaag tgcttctaca tccctgctcc aacaa 35

<210> SEQ ID NO: 187

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 187

taactcgcct gctgccccgg cggcctgccc gccg 34

<210> SEQ ID NO: 188

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 188

ctctgactcc ctcactcagt ctctctgctc cagc 34

<210> SEQ ID NO: 189

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 189

gggcccagtc ctcctcgtcc cccttcccac ctcgg 35

<210> SEQ ID NO: 190

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 190

gcagctccgc cagtctctgt gggcagggag aag 33

<210> SEQ ID NO: 191

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 191

ggcccacccg ggggccgctc cccagcaccg acgcc 35

<210> SEQ ID NO: 192

<211> LENGTH: 36

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 192

tcctgagccg ccttcccctc ccgacctcag agccct 36

<210> SEQ ID NO: 193

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 193

acgtgccttc ctgactgtga gctccttgag agc 33

<210> SEQ ID NO: 194

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 194

caatgaacca ctgaaccact catgcactga acc 33

<210> SEQ ID NO: 195

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 195

ctgtagaccc cacactcagt ctctatagct a 31

<210> SEQ ID NO: 196

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 196

cactccctgc tggcccccac ctcacctatg gtg 33

<210> SEQ ID NO: 197

<211> LENGTH: 36

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 197

ccttctcttc tcccgtgctc ccaccctccc tcaggg 36

<210> SEQ ID NO: 198

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 198

ggacccctgc cttccttgct gccacccttt gcaca 35

<210> SEQ ID NO: 199

<211> LENGTH: 33

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 199

cccaagcgcc ccttcctccc tccttccctc ccg 33

<210> SEQ ID NO: 200

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 200

cagtcacctc agattcctgt gccctctgcc ctgg 34

<210> SEQ ID NO: 201

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 201

ccacccctcc cccacagccc agccccactc ac 32

<210> SEQ ID NO: 202

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 202

ctcccttctt tcctcccgtc tt 22

<210> SEQ ID NO: 203

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 203

tccatcatta cccggcagta tta 23

<210> SEQ ID NO: 204

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 204

aactcagtaa tggtaacggt tt 22

<210> SEQ ID NO: 205

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 205

gtagaaggga atcttgcata ag 22

<210> SEQ ID NO: 206

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 206

gaggtttccc gtgtatgttt ca 22

<210> SEQ ID NO: 207

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 207

tggaggcccc agcgaga 17

<210> SEQ ID NO: 208

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 208

cctgctccaa aaatccatt 19

<210> SEQ ID NO: 209

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 209

tccctgatcc aaaaatcca 19

<210> SEQ ID NO: 210

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 210

ccactgaacc acccatgc 18

<210> SEQ ID NO: 211

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 211

attgcgttcg aagtgtcgat gatcaat 27

<210> SEQ ID NO: 212

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 212

ttgtaatacg actcatcggt tgcggagttc gacgcga 37

<210> SEQ ID NO: 213

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 213

ttgtaatacg actcacccga tgggtacggc gttcggt 37

<210> SEQ ID NO: 214

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 214

ttgtaatacg actcagacac gagagtcgtt accctcg 37

<210> SEQ ID NO: 215

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 215

ttgtaatacg actcagtccg tctacgcgtc ggtacgc 37

<210> SEQ ID NO: 216

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 216

ttgtaatacg actcaggccg tctacgcgtc ggtacgc 37

<210> SEQ ID NO: 217

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 217

ttgtaatacg actcacccgg taacaattag acccgcg 37

<210> SEQ ID NO: 218

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 218

gagctacagt gcttcatctc a 21

<210> SEQ ID NO: 219

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 219

agggattcct gggaaaactg gac 23

<210> SEQ ID NO: 220

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 220

cagactccgg tggaatgaag ga 22

<210> SEQ ID NO: 221

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 221

tcaacatcag tctgataagc ta 22

<210> SEQ ID NO: 222

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 222

agctatgcca gcatcttgcc t 21

<210> SEQ ID NO: 223

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 223

tccataaagt aggaaacact aca 23

<210> SEQ ID NO: 224

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 224

gccaatattt ctgtgctgct a 21

<210> SEQ ID NO: 225

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 225

aacaatacaa cttactacct ca 22

<210> SEQ ID NO: 226

<211> LENGTH: 87

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 226

tcccgcagcc ggtgactgga gcccacctct gcagagacaa aggttagaaa aagagggggt 60

gaggctctgg gaaagcagaa tgcgggg 87

<210> SEQ ID NO: 227

<211> LENGTH: 95

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 227

tgaggggcgg aagcactggg gagagacagg tgtgagcttc ccacgtggtg atcagctcac 60

acctgtcttg tgttcttggt attcacagac tctca 95

<210> SEQ ID NO: 228

<211> LENGTH: 110

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 228

aatgccagtg agtttgaaag gcactttgtc caattagaag tgtggagaaa tattcatcct 60

gtccatgaca aagatgaagt gcttctttca aaagcggcgg tggcaggctg 110

<210> SEQ ID NO: 229

<211> LENGTH: 110

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 229

aatgccagtg agtttgaaag gcactttgtc caattagaag tgtggagaaa tattcatcct 60

gtccatgaca aagatgaagt gcttctttca aaagcggcgg tggcaggctg 110

<210> SEQ ID NO: 230

<211> LENGTH: 83

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 230

cttctcttat tctccctgtt ttcatcctac ttttaagtaa taaatttggc attagtggga 60

ggggagcagg gaggaaggag aag 83

<210> SEQ ID NO: 231

<211> LENGTH: 83

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 231

ggcccttagg aaattagagt gtgtttgaat ttcacaagta taattttaat tatacaaatt 60

ttgcattttt tcactaggga gcc 83

<210> SEQ ID NO: 232

<211> LENGTH: 78

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 232

tggcctgacg tgaggaggag ggacttttcg aagttttata ggaaagtttc cgctttccag 60

tccccctccc ccgtccca 78

<210> SEQ ID NO: 233

<211> LENGTH: 77

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 233

gctggggttc atcggagaaa ctccctgcga tgagccacta gggtcacgga cagggaactt 60

tttgatgagc gccgagt 77

<210> SEQ ID NO: 234

<211> LENGTH: 84

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 234

gtgatgtgat ttctgcccag tgctctgaat gtcaaactga agaaattcag tgaaatgcgg 60

gtaaacggcg ggagtaacta tgac 84

<210> SEQ ID NO: 235

<211> LENGTH: 84

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 235

gtgatgtgat ttctgcccag tgctctgaat gtcaaactga agaaattcag tgaaatgcgg 60

gtaaacggcg ggagtaacta tgac 84

<210> SEQ ID NO: 236

<211> LENGTH: 84

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 236

ttccccaggc agcagcaggc gcacggccgt ctggatctcc ctggaggtga tggtcgagcg 60

cttgtcataa tgcgccaggc ggga 84

<210> SEQ ID NO: 237

<211> LENGTH: 78

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 237

acagcggcat ggttcatgcc aaattccgaa gcaatcttcc tgctaaggcc actggacaca 60

gaatccatgt gatgctgt 78

<210> SEQ ID NO: 238

<211> LENGTH: 85

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 238

ggagcccgag aaactaagag aaagtgtcag gagcatgtta atcagactcg ttacactgta 60

acaataacgt ctctctcggg tctcc 85

<210> SEQ ID NO: 239

<211> LENGTH: 85

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 239

ggtgtgtctg cctctctttc tgccccccta taccccttga ccccaggggg aaggcactcg 60

ggcagcacaa agggagcaga tgccc 85

<210> SEQ ID NO: 240

<211> LENGTH: 75

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 240

gggtccgggt ctctaccgcg ccctcatgca ggaggccctt ggagcaggag ggggaagcgg 60

gagacccggc agccc 75

<210> SEQ ID NO: 241

<211> LENGTH: 73

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 241

ctttttctct ctgctgggaa accttgcttg acttcatgtc cagtgtttgg tatccaaaga 60

cggggaggag gag 73

<210> SEQ ID NO: 242

<211> LENGTH: 80

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 242

catgtgattt ctgcccagtg ctctgaatgt caaagtgaag aaattcaatg aagcacgggt 60

aaacggcggg agtaactatg 80

<210> SEQ ID NO: 243

<211> LENGTH: 80

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 243

catgtgattt ctgcccagtg ctctgaatgt caaagtgaag aaattcaatg aagcacgggt 60

aaacggcggg agtaactatg 80

<210> SEQ ID NO: 244

<211> LENGTH: 80

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 244

catgtgattt ctgcccagtg ctctgaatgt caaagtgaag aaattcaatg aagcacgggt 60

aaacggcggg agtaactatg 80

<210> SEQ ID NO: 245

<211> LENGTH: 74

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 245

tctgttttta tcagtttaat atatgataca tcttctatcc aaggacaata tattaaatgg 60

atttttggag caga 74

<210> SEQ ID NO: 246

<211> LENGTH: 74

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 246

gccacctttc atggtgagga tgcctgccac cttcaggatc acatctttgg gtgaggtcca 60

accagagagg gagc 74

<210> SEQ ID NO: 247

<211> LENGTH: 70

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 247

gggcagcagc aggcgctcgg ccgtctggat ctccctggag gtgatggtcg agcgcttgtt 60

gtaatgcgcc 70

<210> SEQ ID NO: 248

<211> LENGTH: 84

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 248

caggggcgcg ggccggagag cgggtgtgca aagtgggcgc agggccctgg ggccgcgccc 60

cttgctctgc cggctcgact cttg 84

<210> SEQ ID NO: 249

<211> LENGTH: 84

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 249

gggggcaggg gaaggtgacg gaaacggcta gttacccaga attctctggg ggaaccagaa 60

aaatcggtta tctagaattc tccc 84

<210> SEQ ID NO: 250

<211> LENGTH: 90

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 250

gcaattagaa tgcagggagg ttcagaagct atttaactgg gtgacccctg aggtcgctgc 60

atctgactcc catccctgga taaatattgt 90

<210> SEQ ID NO: 251

<211> LENGTH: 81

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 251

gaggggctgt agctcagggt gtgcactgcg aggctggacc tgttgagtct gcagtggaca 60

tccatttagc ttcaggttgt c 81

<210> SEQ ID NO: 252

<211> LENGTH: 79

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 252

agcctgttcc gtgctcgcta actataaact atctgattta tattcattaa ccagtactag 60

acagcggcag gcacaggct 79

<210> SEQ ID NO: 253

<211> LENGTH: 83

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 253

acagtaggta tagctggcat gggactggta gtgcaggctg gctcttggaa aggagtatgt 60

attccaggct ggttggctgc tgt 83

<210> SEQ ID NO: 254

<211> LENGTH: 79

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 254

ggggctgcca tcctgctgtc cgtcatctgt gtggtgctgg tcacggcctt caatgactgg 60

agcaaggaga agcagttcc 79

<210> SEQ ID NO: 255

<211> LENGTH: 75

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 255

gatgccgggc gcccgccgca gccgctgccg ccggagcccg ggatggggcg agaggctgcg 60

gcggacgcca gcatc 75

<210> SEQ ID NO: 256

<211> LENGTH: 70

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 256

aagagcacaa acctttcatt ttgccgttta tttgtcttgt ggccggtaca gtgaaaatgt 60

attggctttt 70

<210> SEQ ID NO: 257

<211> LENGTH: 83

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 257

acagtaggta tagctggcat gggactggta gtgcaggctg gctcttggaa aggagtatgt 60

attccaggct ggttggctgc tgt 83

<210> SEQ ID NO: 258

<211> LENGTH: 82

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 258

tgttttcatc ttgcttcttc atggtccatg atgccagctg aggttgtcag tacaatgaaa 60

ccaaactggc gggatggaag ca 82

<210> SEQ ID NO: 259

<211> LENGTH: 85

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 259

ctgggaacaa tggggccatt gtgggaggat ggagtgcagc agactgctgg cacagccaag 60

cgcaccacgg tgggacctca cccag 85

<210> SEQ ID NO: 260

<211> LENGTH: 87

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 260

gcttgtccta aaagatcttc cttctgtttc cctgggttta tccacttggt tggcctgatg 60

ggagcaggag gcggtgaggg ggcgggc 87

<210> SEQ ID NO: 261

<211> LENGTH: 88

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 261

ctggcccatt ttcattctgc ataaaatttt aatggtctct ctggctgatc cgggacggca 60

gcgcgcggag aggctcttaa agggccag 88

<210> SEQ ID NO: 262

<211> LENGTH: 78

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 262

ggatgcaacc gtggaagccg gtgccgttga ggatctgcca caggcggaag gcagctgagt 60

tgacatccac gggcatcc 78

<210> SEQ ID NO: 263

<211> LENGTH: 91

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 263

gaggctgctt aatgaggtgc ccttttcaaa atgtcatctt aatcttttat tagtttaaga 60

aagacaacag ggcacaatta gcatgcaact c 91

<210> SEQ ID NO: 264

<211> LENGTH: 69

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 264

ggggacgtgg cccctccccc ccggagcggg actccaagaa ctccgggggg cgctgggggc 60

tgactttcc 69

<210> SEQ ID NO: 265

<211> LENGTH: 87

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 265

gtcttccccc aacccacagc acacacctga ctcctccctt ccagggaaaa gacctcaggg 60

ctgctggtga gtcagaaata ggaagac 87

<210> SEQ ID NO: 266

<211> LENGTH: 107

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 266

cccggctcgg ccccgcgtct ctccagctcc tccggctcct tttagtgcat aaattagtga 60

tggcatttcc cggagagcgg agcacaacac agggcgccgg gctcggg 107

<210> SEQ ID NO: 267

<211> LENGTH: 113

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 267

ggacctgggg gcttctctga cccttgaaca gcttatacta tgagaccttg ggaacctcct 60

ccatgcagac acacaaggct caatgttggg ggaagggaag ggcccatagg tcc 113

<210> SEQ ID NO: 268

<211> LENGTH: 113

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 268

ggacctgggg gcttctctga cccttgaaca gcttatacta tgagaccttg ggaacctcct 60

ccatgcagac acacaaggct caatgttggg ggaagggaag ggcccatagg tcc 113

<210> SEQ ID NO: 269

<211> LENGTH: 55

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 269

agagggctgg gctggacttc agctttcacc taggaaatga gtcttgctgc ccttt 55

<210> SEQ ID NO: 270

<211> LENGTH: 89

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 270

ttcccacacg tgctcaggcc cctcaaccaa ggaaggcagc aggcccactg gcctccttat 60

tcagaggggc tgcactgcac cctagggag 89

<210> SEQ ID NO: 271

<211> LENGTH: 89

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 271

agcctgtggg aaagagaaga gcagggcagg gtgaaggccc ggcggagaca ctctgcccac 60

cccacaccct gcctatgggc cacacagct 89

<210> SEQ ID NO: 272

<211> LENGTH: 81

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 272

ggactggagc aggtgagatg gaatttccta aaggtccaga tatttaggac cctggaccca 60

tctcacccgc tgcctctgtc c 81

<210> SEQ ID NO: 273

<211> LENGTH: 91

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 273

tgaggggtaa gtttaggctt tcgcggaggg gaggagacat ggagcctggg aactccttgt 60

tctcccctct gctgcctctc cccacccctt a 91

<210> SEQ ID NO: 274

<211> LENGTH: 105

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 274

ccagactctg ggtggatgga gcaggtcggg ggccagggga caggaaggct agggccccag 60

agacctgtcc tgggccccat gtccagctct gcccttagtg cttgg 105

<210> SEQ ID NO: 275

<211> LENGTH: 104

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 275

gtggttaaaa aaaaaaaaaa tggttaagga agcggaccat ggagcagaaa gttgcagtga 60

ctggattctg gctccaggct gcaaatttaa ccattgaata tcac 104

<210> SEQ ID NO: 276

<211> LENGTH: 95

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 276

tcctgaaaga ggttggggca ggcagtgact gttcagacgt ccaatctctt tgggacgcct 60

cttcagcgct gtcttccctg cctctgcctt tagga 95

<210> SEQ ID NO: 277

<211> LENGTH: 100

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 277

aaaaaaaaaa aagatactaa tacaaatggt catggagggg gaatatagag aagatcaatt 60

ttgtacagaa aaaccattgg ttagtatttt tttttctttt 100

<210> SEQ ID NO: 278

<211> LENGTH: 121

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 278

gccccccaaa atgcttctgt acccctgccc caacaaggaa ggacaagagg tgtgagccac 60

acacacgcct ggcctcctgt ctttccttgt tggagcaggg atgtagaagc acttgccgca 120

g 121

<210> SEQ ID NO: 279

<211> LENGTH: 121

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 279

gggagccgcc ggcgggcagg ccgccggggc agcaggcgag ttacctcaac tcccggccgc 60

tccggaggtt gccgggcacc gaggagccgc cgtgcccttc aggcgcctgc ggcggcgacc 120

a 121

<210> SEQ ID NO: 280

<211> LENGTH: 121

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 280

gctggagcag agagactgag tgagggagtc agagagttaa gagaattagt acaggtgaga 60

ttgtactgat tatcttaact ctctgacccc ctcactcagt aaagatcaga ttgtgccagg 120

c 121

<210> SEQ ID NO: 281

<211> LENGTH: 116

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 281

aagcaagaca ccgaggtggg aagggggacg aggaggactg ggccctattt ctcccatcta 60

tgtaaaggga gggatatcag ggaagtctct gtctgtgtac tcaagtttgg gatgct 116

<210> SEQ ID NO: 282

<211> LENGTH: 99

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 282

tgctggccca aggggtaaag gggcagggac gggtggcccc aggaagaagg gcctggtgga 60

gccgctcttc tccctgccca cagagactgg cggagctgc 99

<210> SEQ ID NO: 283

<211> LENGTH: 110

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 283

aggaacagga cgatgatgct ggcgtcggtg ctggggagcg gcccccgggt gggcctctgc 60

tctggcccct cctggggccc gcactctcgc tctgggcccg ctcctcttcc 110

<210> SEQ ID NO: 284

<211> LENGTH: 109

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 284

atctcacaga ggaagaacag ggctctgagg tcgggagggg aaggcggctc aggacttctg 60

gctccagagc ctcctctcct tccaccatag tgcctgctcc agaggagac 109

<210> SEQ ID NO: 285

<211> LENGTH: 121

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 285

ctttggcaca gtccgtgctc tcaaggagct cacagtcagg aaggcacgtg gaatttcagc 60

ctggagttcc aagtgctgcc ctcagggagt gctgggcctg agctggggtg aggctgcagg 120

g 121

<210> SEQ ID NO: 286

<211> LENGTH: 118

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 286

ctcacacatg gtacgttttc aatgagctga ttttgtttct ccactcaatg cagtaattga 60

gcttctttgg ttcagtgcat gagtggttca gtggttcatt gggcatcctg gttgaggg 118

<210> SEQ ID NO: 287

<211> LENGTH: 87

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 287

gtgctatagc tatagagact gagtgtgggg tctacagaaa atgtggccat gccctccacc 60

ccagtggctg ggcagccttt ggcacag 87

<210> SEQ ID NO: 288

<211> LENGTH: 99

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 288

caccataggt gaggtggggg ccagcaggga gtgggctggg ctgggctggg ccaaggtaca 60

aggcctcacc ctgcatcccg cacccaggct tcaacgtgg 99

<210> SEQ ID NO: 289

<211> LENGTH: 121

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 289

aggtggtggt ggggaggacc ctgagggagg gtgggagcac gggagaagag aaggcatacc 60

caacctgacc tacttacctg tcccctaccc cacagagggc ttccctggag gccgccattg 120

c 121

<210> SEQ ID NO: 290

<211> LENGTH: 106

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 290

gggcacgggg gttgggtgtg caaagggtgg cagcaaggaa ggcaggggtc ctaaggtgtg 60

tcctcctgcc ctccttgctg tagactttgg cctgagcaaa gaggcc 106

<210> SEQ ID NO: 291

<211> LENGTH: 108

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 291

cgggagggaa ggagggagga aggggcgctt gggcagaacc aagggtggca gattatccta 60

gggactcttg gggcagaacc agacgcctct gcgtcctccc ctctcccc 108

<210> SEQ ID NO: 292

<211> LENGTH: 99

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 292

caggaattcc actggcagcc agggcagagg gcacaggaat ctgaggtgac tggcacagaa 60

gactcaggcc tgtggctcct ccctcaggac tgcttccta 99

<210> SEQ ID NO: 293

<211> LENGTH: 91

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 293

gtgagtgggg ctgggctgtg ggggaggggt ggggtggcag ggaacaggca gaccatccct 60

tctacccaca ggatcctgct gctgcagaca g 91

<210> SEQ ID NO: 294

<211> LENGTH: 79

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 294

actcaggcac tgcctctgac gatgctctcc cagatctggt acgctcatgg ggaagagccc 60

agcgccaggc agtgttgga 79

<210> SEQ ID NO: 295

<211> LENGTH: 105

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 295

tggctgggag aggagcatag gatgcggcag gagggcagtg gaggctgagg tacggatttc 60

taggcccgcc ctaccctcct ctctgcccct agtgcccgtg gccaa 105

<210> SEQ ID NO: 296

<211> LENGTH: 105

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 296

tggctgggag aggagcatag gatgcggcag gagggcagtg gaggctgagg tacggatttc 60

taggcccgcc ctaccctcct ctctgcccct agtgcccgtg gccaa 105

<210> SEQ ID NO: 297

<211> LENGTH: 113

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 297

gcggcggaca ccatcttctt taaaccctca gtccgtattg gtctctatgg catccataga 60

ggccattcgg ctctgaggtc ctcagtaaag aaacttagat ggtattactg tgt 113

<210> SEQ ID NO: 298

<211> LENGTH: 118

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 298

tcacatgtcc tcagctgttg tctgggtgag gcatccctgt cgtgggagca gccacagctc 60

tgcctggtct cccagagcag ggacgctttg tccgcattta cagcagtcta cacagatg 118

<210> SEQ ID NO: 299

<211> LENGTH: 72

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 299

agccacacgg tcacacctaa tgtcatagcc ggtagagcag ggagccctct ggatggaagc 60

actgtgaggc tc 72

<210> SEQ ID NO: 300

<211> LENGTH: 73

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 300

tgtatccttg aatggatttt tggagcagga gtggacacct gacccaaagg aaatcaatcc 60

ataggctagc aat 73

<210> SEQ ID NO: 301

<211> LENGTH: 78

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 301

gagcgtcacg ttgacactca aaaagtttca gattttggaa catttcggat tttggatttt 60

tggatcaggg atgctcaa 78

<210> SEQ ID NO: 302

<211> LENGTH: 54

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 302

ccccgcatgg gtggttcagt ggcagaattc tcaaattgta atccccataa tccc 54

<210> SEQ ID NO: 303

<211> LENGTH: 87

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 303

gacagtgcag tcacccataa agtagaaagc actactaaca gcactggagg gtgtagtgtt 60

tcctacttta tggatgagtg tactgtg 87

<210> SEQ ID NO: 304

<211> LENGTH: 85

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 304

attgatcatc gacacttcga acgcaattgc agcccgggtt cctcccaggg ctttgcctgt 60

ctgagcgtcg cttgccgatc agtag 85

<210> SEQ ID NO: 305

<211> LENGTH: 87

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 305

agcttccctg gctctagcag cacagaaata ttggcacagg gaagcgagtc tgccaatatt 60

ggctgtgctg ctccaggcag ggtggtg 87

<210> SEQ ID NO: 306

<211> LENGTH: 68

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 306

ccctcgtctt acccagcagt gtttgggtgc ggttgggagt ctctaatact gccgggtaat 60

gatggagg 68

<210> SEQ ID NO: 307

<211> LENGTH: 72

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 307

cttgggaatg gcaaggaaac cgttaccatt actgagttta gtaatggtaa tggttctctt 60

gctataccca ga 72

<210> SEQ ID NO: 308

<211> LENGTH: 76

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 308

gagggggaag acgggaggaa agaagggagt ggttccatca cgcctcctca ctcctctcct 60

cccgtcttct cctctc 76

<210> SEQ ID NO: 309

<211> LENGTH: 84

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 309

ttgacttagc tgggtagtgg ggaacccttc catgaggagt agaacactcc ttatgcaaga 60

ttcccttcta cctggctggg ttgg 84

<210> SEQ ID NO: 310

<211> LENGTH: 81

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 310

gatactcgaa ggagaggttg tccgtgttgt cttctcttta tttatgatga aacatacacg 60

ggaaacctct tttttagtat c 81

<210> SEQ ID NO: 311

<211> LENGTH: 110

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 311

ccggatctca cacggtggtg ttaatatctc gctggggcct ccaaaatgtt gtgcccaggg 60

gtgttagaga aaacaccaca ctttgagatg aattaagagt cctttattag 110

<210> SEQ ID NO: 312

<211> LENGTH: 119

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 312

aggattctgc tcatgccagg gtgaggtagt aagttgtatt gttgtggggt agggatatta 60

ggccccaatt agaagataac tatacaactt actactttcc ctggtgtgtg gcatattca 119

<210> SEQ ID NO: 313

<211> LENGTH: 106

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 313

gcgcagcgcc ctgtctccca gcctgaggtg cagtgctgca tctctggtca gttgggagtc 60

tgagatgaag cactgtagct caggaagaga gaagttgttc tgcagc 106

<210> SEQ ID NO: 314

<211> LENGTH: 88

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 314

caccttgtcc tcacggtcca gttttcccag gaatccctta gatgctaaga tggggattcc 60

tggaaatact gttcttgagg tcatggtt 88

<210> SEQ ID NO: 315

<211> LENGTH: 110

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 315

aaagatcctc agacaatcca tgtgcttctc ttgtccttca ttccaccgga gtctgtctca 60

tacccaacca gatttcagtg gagtgaagtt caggaggcat ggagctgaca 110

<210> SEQ ID NO: 316

<211> LENGTH: 72

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 316

tgtcgggtag cttatcagac tgatgttgac tgttgaatct catggcaaca ccagtcgatg 60

ggctgtctga ca 72

<210> SEQ ID NO: 317

<211> LENGTH: 71

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 317

ggagaggagg caagatgctg gcatagctgt tgaactggga acctgctatg ccaacatatt 60

gccatctttc c 71

<210> SEQ ID NO: 318

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 318

catagatgcc gcggaaggt 19

<210> SEQ ID NO: 319

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 319

cccgaggttt ctcagagcct 20

<210> SEQ ID NO: 320

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 320

cctcagacat ccccgattga aagaacc 27

<210> SEQ ID NO: 321

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 321

ctttctcaag gaccaccgca 20

<210> SEQ ID NO: 322

<211> LENGTH: 16

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 322

gcctcggcca tccgct 16

<210> SEQ ID NO: 323

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 323

cattcaagaa ctggcccttc ttggagg 27

<210> SEQ ID NO: 324

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 324

agatcgacaa tgcccgt 17

<210> SEQ ID NO: 325

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 325

agagcctgtt ccgtctcaaa 20

<210> SEQ ID NO: 326

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 326

tggctgcaga tgacttccga acca 24

<210> SEQ ID NO: 327

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 327

tcatttgctc aaagctggct g 21

<210> SEQ ID NO: 328

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 328

aaacttggga gaagagcaaa acc 23

<210> SEQ ID NO: 329

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 329

aaatgtttgg tgatgaaggc agaaatgaat gg 32

<210> SEQ ID NO: 330

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 330

ttcattccat tattagacgt tccct 25

<210> SEQ ID NO: 331

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 331

gattattcca catgtaattg gtggg 25

<210> SEQ ID NO: 332

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 332

ccagcaacac taccacagtg tcaggca 27

<210> SEQ ID NO: 333

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 333

ttaaattgtc acagacaagt aatgtcg 27

<210> SEQ ID NO: 334

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 334

tggcttttgt aaagaagttc aggtac 26

<210> SEQ ID NO: 335

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 335

tggttcattc atctctatgg taacagcttc ctcct 35

<210> SEQ ID NO: 336

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 336

ccctggagac ctgagaacca 20

<210> SEQ ID NO: 337

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 337

aaccatagcg gtacaggtat tcct 24

<210> SEQ ID NO: 338

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 338

tctcaccgac aggcagctgg ca 22

<210> SEQ ID NO: 339

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 339

cctgagatct gcaaacagga cat 23

<210> SEQ ID NO: 340

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 340

ccaaatgaac cggtccttga 20

<210> SEQ ID NO: 341

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 341

ttgatggcat cgctcagatc cgtg 24

<210> SEQ ID NO: 342

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 342

gctaaagtga ggatggtgat tatcact 27

<210> SEQ ID NO: 343

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

primer

<400> SEQENCE: 343

actaacaaag ttttcttctt taatttttcc at 32

<210> SEQ ID NO: 344

<211> LENGTH: 29

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 344

accagaggct cagttcaagg ctcagggaa 29

<210> SEQ ID NO: 345

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 345

tcccccaacc cacagcacac ac 22

<210> SEQ ID NO: 346

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 346

cccggagagc ggagcacaac aca 23

<210> SEQ ID NO: 347

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 347

ccggagagcg gagcacaac 19

<210> SEQ ID NO: 348

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 348

ccaaggaagg cagcaggc 18

<210> SEQ ID NO: 349

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 349

gatggaattt cctaaagg 18

<210> SEQ ID NO: 350

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 350

ggaggggagg agacatg 17

<210> SEQ ID NO: 351

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 351

gcagtgactg ttcagacgtc ca 22

<210> SEQ ID NO: 352

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 352

tgtctttcct tgttggagca gg 22

<210> SEQ ID NO: 353

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 353

cagcaggcga gttacctcaa 20

<210> SEQ ID NO: 354

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 354

gaggaggact gggcccta 18

<210> SEQ ID NO: 355

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 355

agccgctctt ctccctgccc aca 23

<210> SEQ ID NO: 356

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 356

agccgctctt ctccctgccc acag 24

<210> SEQ ID NO: 357

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 357

tggggagcgg cccccggg 18

<210> SEQ ID NO: 358

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 358

gaggtcggga ggggaaggcg gct 23

<210> SEQ ID NO: 359

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 359

tcaaggagct cacagtc 17

<210> SEQ ID NO: 360

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 360

gcatgagtgg ttcagtggt 19

<210> SEQ ID NO: 361

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 361

gtgggctggg ctgggctggg c 21

<210> SEQ ID NO: 362

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 362

ggaggaccct gagggagggt ggg 23

<210> SEQ ID NO: 363

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 363

tgagggaggg tgggagc 17

<210> SEQ ID NO: 364

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 364

tggcagcaag gaaggcaggg gtc 23

<210> SEQ ID NO: 365

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 365

gagggaagga gggaggaa 18

<210> SEQ ID NO: 366

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 366

cagggcagag ggcacaggaa tctga 25

<210> SEQ ID NO: 367

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 367

gggaagagcc cagcgcc 17

<210> SEQ ID NO: 368

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 368

accctcagtc cgtattggtc tct 23

<210> SEQ ID NO: 369

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 369

gtctcccaga gcagggacgc ttt 23

<210> SEQ ID NO: 370

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 370

ttagaaaaag agggggtgag g 21

<210> SEQ ID NO: 371

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 371

tggggtgtgg aggggagg 18

<210> SEQ ID NO: 372

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 372

aggggagcag ggaggaa 17

<210> SEQ ID NO: 373

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 373

tggcctgacg tgaggaggag g 21

<210> SEQ ID NO: 374

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 374

acggacaggg aactttttga t 21

<210> SEQ ID NO: 375

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 375

gcccagtgct ctgaatgtca aa 22

<210> SEQ ID NO: 376

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 376

tctgcccagt gctctgaatg tca 23

<210> SEQ ID NO: 377

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 377

ggcgggagta actatgac 18

<210> SEQ ID NO: 378

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 378

cgggtaaacg gcgggagtaa ct 22

<210> SEQ ID NO: 379

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 379

agcaggcgca cggccgtctg gatc 24

<210> SEQ ID NO: 380

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 380

gcacggccgt ctggatctcc 20

<210> SEQ ID NO: 381

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 381

gaggaaggaa ggggaaa 17

<210> SEQ ID NO: 382

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 382

cagtgctctg aatgtcaaag tgaaga 26

<210> SEQ ID NO: 383

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 383

gggtaaacgg cgggagta 18

<210> SEQ ID NO: 384

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 384

aaatggattt ttggagcag 19

<210> SEQ ID NO: 385

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 385

tgcaagatca gaggggaga 19

<210> SEQ ID NO: 386

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 386

ggggctgtag ctcaggg 17

<210> SEQ ID NO: 387

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 387

gccggtacag tgaaaat 17

<210> SEQ ID NO: 388

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 388

gccggtacag tgaaaatg 18

<210> SEQ ID NO: 389

<211> LENGTH: 19

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 389

aauggauuuu uggagcagg 19

<210> SEQ ID NO: 390

<211> LENGTH: 19

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 390

uggauuuuug gaucaggga 19

<210> SEQ ID NO: 391

<211> LENGTH: 18

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 391

gcaugggugg uucagugg 18

<210> SEQ ID NO: 392

<211> LENGTH: 27

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 392

auugaucauc gacacuucga acgcaau 27

<210> SEQ ID NO: 393

<211> LENGTH: 21

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 393

uagcagcaca gaaauauugg c 21

<210> SEQ ID NO: 394

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 394

uaauacugcc ggguaaugau gga 23

<210> SEQ ID NO: 395

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 395

aaaccguuac cauuacugag uu 22

<210> SEQ ID NO: 396

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 396

aagacgggag gaaagaaggg ag 22

<210> SEQ ID NO: 397

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 397

cuuaugcaag auucccuucu ac 22

<210> SEQ ID NO: 398

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 398

ugaaacauac acgggaaacc uc 22

<210> SEQ ID NO: 399

<211> LENGTH: 17

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 399

ucucgcuggg gccucca 17

<210> SEQ ID NO: 400

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 400

ugagguagua aguuguauug uu 22

<210> SEQ ID NO: 401

<211> LENGTH: 21

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 401

ugagaugaag cacuguagcu c 21

<210> SEQ ID NO: 402

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 402

uccuucauuc caccggaguc ug 22

<210> SEQ ID NO: 403

<211> LENGTH: 21

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 403

aggcaagaug cuggcauagc u 21

<210> SEQ ID NO: 404

<211> LENGTH: 23

<212> TYPE: RNA

<213> ORGANISM: Homo sapiens

<400> SEQENCE: 404

uuaaugcuaa ucgugauagg ggu 23

<210> SEQ ID NO: 405

<211> LENGTH: 22

<212> TYPE: RNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

oligonucleotide

<400> SEQENCE: 405

gcguaccgac gcguagacgg ac 22

<210> SEQ ID NO: 406

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 406

ttgtaatacg actcaacagt agataaagcg acgcgcg 37

<210> SEQ ID NO: 407

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 407

ttgtaatacg actcaaacgc gacttatcga acgataa 37

<210> SEQ ID NO: 408

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 408

ttgtaatacg actcaaggtt gcctacatag taacttc 37

<210> SEQ ID NO: 409

<211> LENGTH: 37

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Description of Artificial Sequence Synthetic

probe

<400> SEQENCE: 409

ttgtaatacg actcacccgg taacaattag tcccgcg 37

Read more
PatSnap Solutions

Great research starts with great data.

Use the most comprehensive innovation intelligence platform to maximise ROI on research.

Learn More

Patent Valuation

$

Reveal the value <>

20.0/100 Score

Market Attractiveness

It shows from an IP point of view how many competitors are active and innovations are made in the different technical fields of the company. On a company level, the market attractiveness is often also an indicator of how diversified a company is. Here we look into the commercial relevance of the market.

67.0/100 Score

Market Coverage

It shows the sizes of the market that is covered with the IP and in how many countries the IP guarantees protection. It reflects a market size that is potentially addressable with the invented technology/formulation with a legal protection which also includes a freedom to operate. Here we look into the size of the impacted market.

70.49/100 Score

Technology Quality

It shows the degree of innovation that can be derived from a company’s IP. Here we look into ease of detection, ability to design around and significance of the patented feature to the product/service.

68.0/100 Score

Assignee Score

It takes the R&D behavior of the company itself into account that results in IP. During the invention phase, larger companies are considered to assign a higher R&D budget on a certain technology field, these companies have a better influence on their market, on what is marketable and what might lead to a standard.

13.0/100 Score

Legal Score

It shows the legal strength of IP in terms of its degree of protecting effect. Here we look into claim scope, claim breadth, claim quality, stability and priority.

Citation

Patents Cited in This Cited by
Title Current Assignee Application Date Publication Date
Methods of detecting sepsis CEPHEID 02 February 2010 09 September 2010
Transcriptome microarray technology and methods of using the same ALMAC DIAGNOSTICS LIMITED 03 November 2005 22 June 2006
Method For The Identification Of Sepsis SIRS-LAB GMBH 15 December 2004 20 November 2008
Companion diagnostic assays for cancer therapy ABBOTT LABORATORIES 20 December 2007 14 August 2008
Methods for the identification of microRNA and their applications in research and human health ACTIGENICS 08 November 2005 09 May 2007
See full citation <>

More Patents & Intellectual Property

PatSnap Solutions

PatSnap solutions are used by R&D teams, legal and IP professionals, those in business intelligence and strategic planning roles and by research staff at academic institutions globally.

PatSnap Solutions
Search & Analyze
The widest range of IP search tools makes getting the right answers and asking the right questions easier than ever. One click analysis extracts meaningful information on competitors and technology trends from IP data.
Business Intelligence
Gain powerful insights into future technology changes, market shifts and competitor strategies.
Workflow
Manage IP-related processes across multiple teams and departments with integrated collaboration and workflow tools.
Contact Sales
Clsoe
US10000808 Methods detecting cervical cancer 1 US10000808 Methods detecting cervical cancer 2 US10000808 Methods detecting cervical cancer 3