Great research starts with great data.

Learn More
More >
Patent Analysis of

Markers to predict macrocyclic lactone drug resistance in dirofilaria immitis, the causative agent of heartworm disease

Updated Time 12 June 2019

Patent Registration Data

Publication Number

US10000811

Application Number

US14/896736

Application Date

25 June 2014

Publication Date

19 June 2018

Current Assignee

MCGILL UNIVERSITY,ELANCO US INC.

Original Assignee (Applicant)

ELANCO US INC.,MCGILL UNIVERSITY

International Classification

C07H21/04,C12Q1/68

Cooperative Classification

C12Q1/6883,C12Q1/6888,C12Q2600/124,C12Q2600/136,C12Q2600/156

Inventor

PRICHARD, ROGER K.,BOURGUINAT, CATHERINE,GEARY, TIMOTHY G.

Patent Images

This patent contains figures and images illustrating the invention and its embodiment.

US10000811 Markers predict macrocyclic lactone 1 US10000811 Markers predict macrocyclic lactone 2 US10000811 Markers predict macrocyclic lactone 3
See all images <>

Abstract

Disclosed are nucleic acid molecules from the genome of Dirofilaria spp. nematodes that contain single nucleotide polymorphisms related to reduced responsiveness of the nematodes to macrocyclic lactones. In one example, the species of Dirofilaria is Dirofilaria immitis (the agent of heartworm in animals). Also disclosed are methods for determining the responsiveness of Dirofilaria spp. nematodes to macrocyclic lactones, methods for selecting a treatment to treat an animal infected with a Dirofilaria spp. nematode, and kits for determining the responsiveness of Dirofilaria spp. nematodes to macrocyclic lactones.

Read more

Claims

1. A method for determining the genotype of a Dirofilaria immitis nematode, the method comprising:a) contacting a Dirofilaria immitis nucleic acid molecule with at least one oligonucleotide having a length of 15-300 nucleotides of SEQ ID NO: 118, or a reverse complement thereof; wherein the at least one oligonucleotide comprises a G nucleotide at position 151 of SEQ ID NO: 118; wherein the at least one oligonucleotide further includes a detectable label; and b) detecting a G nucleotide at position 151 of SEQ ID NO: 118 in the Dirofilaria immitis nematode nucleic acid molecule.

2. The method of claim 1, wherein the at least one oligonucleotide has a length of 15-100 nucleotides.

3. The method of claim 1, wherein the at least one oligonucleotide has a length of 20-30 nucleotides.

4. The method of claim 1, wherein the detection of the G nucleotide at position 151 of SEQ ID NO: 118 in the Dirofilaria immitis nucleic acid molecule with the at least one oligonucleotide is detected by DNA sequencing, hybridization-based methods including with allele specific oligonucleotides, microarray analysis, enzyme-based methods, single strand conformational polymorphism (SSCP), high resolution melt (HRM) or approaches based on PCR, RT-PCR, or qRT-PCR.

5. The method of claim 1, further comprising: a) contacting the Dirofilaria immitis nucleic acid molecule with at least a second oligonucleotide consisting of 15-300 nucleotides of a sequence selected from the group consisting of SEQ ID NOs: 1-113, 115-117, and 119-127, or a reverse complement thereof; wherein the at least a second oligonucleotide comprises position 151 of the sequence selected from the group consisting of SEQ ID NOs: 1-113, 115-117, and 119-127; wherein the at least a second oligonucleotide further comprises a detectable label, and b) detecting the nucleotide at position 151 of the sequence selected from the group consisting of SEQ ID NOs: 1-113, 115-117, and 119-127 in the Dirofilaria immitis nematode nucleic acid molecule.

Read more

Claim Tree

  • 1
    1. A method for determining the genotype of a Dirofilaria immitis nematode, the method comprising:
    • a) contacting a Dirofilaria immitis nucleic acid molecule with at least one oligonucleotide having a length of 15-300 nucleotides of SEQ ID NO: 118, or a reverse complement thereof; wherein the at least one oligonucleotide comprises a G nucleotide at position 151 of SEQ ID NO: 118; wherein the at least one oligonucleotide further includes a detectable label; and
    • b) detecting a G nucleotide at position 151 of SEQ ID NO: 118 in the Dirofilaria immitis nematode nucleic acid molecule.
    • 2. The method of claim 1, wherein
      • the at least one oligonucleotide has a length of 15-100 nucleotides.
    • 3. The method of claim 1, wherein
      • the at least one oligonucleotide has a length of 20-30 nucleotides.
    • 4. The method of claim 1, wherein
      • the detection of the G nucleotide at position 151 of SEQ ID NO: 118 in the Dirofilaria immitis nucleic acid molecule with the at least one oligonucleotide is detected by DNA sequencing, hybridization-based methods including
    • 5. The method of claim 1, further comprising:
      • a) contacting the Dirofilaria immitis nucleic acid molecule with at least a second oligonucleotide consisting of 15-300 nucleotides of a sequence selected from the group consisting of SEQ ID NOs: 1-113, 115-117, and 119-127, or a reverse complement thereof; wherein the at least a second oligonucleotide comprises position 151 of the sequence selected from the group consisting of SEQ ID NOs: 1-113, 115-117, and 119-127; wherein the at least a second oligonucleotide further comprises a detectable label, and
      • b) detecting the nucleotide at position 151 of the sequence selected from the group consisting of SEQ ID NOs: 1-113, 115-117, and 119-127 in the Dirofilaria immitis nematode nucleic acid molecule.
See all independent claims <>

Description

FIELD

Disclosed are genetics related to macrocyclic lactone (ML) endectocide resistance in nematode parasites (e.g., Dirofilaria immitis). Single nucleotide polymorphisms within the genome of D. immitis are disclosed that, singly or in combination, correlate with reduced responsiveness of the parasites to MLs. Also disclosed are methods for detection of these parasites, methods for treatment of these parasites, and methods and kits for determination of responsiveness of these parasites to MLs.

BACKGROUND

Dirofilariasis is a parasitic disease of animals and occasionally in humans, which may result from infection by a species of Dirofilaria such as D. immitis, D. repens, D. tenuis, D. ursi, D. subdermata, D. lutrae, D. striata and D. spectans.

Dirofilaria immitis (heartworm) is a parasitic nematode that commonly infects dogs, foxes, wolves, coyotes, and cats. Heartworms may cause serious vascular damage and may be fatal, especially in highly active animals.

The life cycle of D. immitis is well known (reviewed in McCall et al., Adv. Parasitol. 66:193-285, 2008). In brief, a mosquito may become infected when it draws blood from an infected host (e.g. a dog). In the mosquito, microfilariae (mf) develop to the infective larval stage. When the infected mosquito feeds, it may transmit larvae to a new host (e.g. another dog). In the new host, the larvae continue to mature for eight to ten weeks, after which time they move to the right side of the lungs and the pulmonary artery, where they become adult. Adult worms mate and females produce eggs, which develop in utero into the long thin embryos (microfilariae) that are released into the bloodstream. A mosquito that takes in the circulating mf when it draws blood from the infected host starts the cycle again.

D. immitis may be found wherever its vector, the mosquito, is found. Generally, D. immitis may be found on a world-wide basis, but are very common in areas with mild and warm climates.

Macrocyclic lactones (MLs) are often prescribed as therapeutics or prophylactics in the management of D. immitis in veterinary applications. Example MLs include ivermectin (IVM), milbemycin oxime (MO), moxidectin (MOX) and selamectin (SLM). However, resistance to MLs is common in a variety of parasitic nematodes and appears to be developing in D. immitis. A number of tests have been described for the detection of anthelmintic resistance in nematodes of livestock and horses, including, faecal egg count reduction test, the egg hatch test, microagar larval development test and molecular tests based on benzimidazole resistance (reviewed in Coles et al., Veterinary Parasitology 136:167-185, 2006). Prichard et al. (European patent EP 0979278) describes a P-glycoprotein sequence in Haemonchus contortus which may be useful for the diagnosis of ML resistance in parasitic nematodes. However, there remains a need for methods to detect D. immitis (heartworms) that are resistant to a ML.

SUMMARY

Genetic variations (e.g., SNPs) have been discovered in the genomes of Dirofilaria spp. nematodes that relate to reduced responsiveness of the nematodes to macrocyclic lactones. In one example, the nematode is Dirofilaria immitis (the agent of heartworm in animals). In one example, the macrocyclic lactones are ivermectin, selamectin, milbemycin oxime or moxidectin.

Methods for determining the responsiveness of a Dirofilaria spp. nematode to a macrocyclic lactone are disclosed. In one example, the method involves determining the genotype of the nematode at a polymorphic site in a nucleic acid molecule that includes one or more of SEQ ID NOs: 1-127 from the nematode. In one example, the nucleic acid molecule possesses at least 80% sequence identity to one or more of SEQ ID NOs: 1-127. In other examples, the nucleic acid molecule possesses at least 90% or at least 95% sequence identity to one or more of SEQ ID NOs: 1-127. In one example, the nucleic acid molecule includes a a fragment having a length of at least 100 nucleotides of one or more of SEQ ID NOs: 1-127 and includes the polymorphic site. In another example, the nucleic acid molecule includes a fragment having a length of at least 50 nucleotides of one or more of SEQ ID NOs: 1-127 and includes the polymorphic site. In one example, the nucleic acid molecule includes a fragment having a length of at least 100 nucleotides and that possesses at least 95% sequence identity to one or more of SEQ ID NOs: 1-127 and includes the polymorphic site.

In one embodiment of the method, the presence of an alternative nucleotide at the polymorphic site in the nucleic acid molecules indicates that the nematode is likely to be resistant to the macrocyclic lactone. In one embodiment, the method may include isolating the nucleic acid molecule from the nematode, and optionally purifying the nucleic acids prior to determining the genotype of the nematode. In one embodiment of the method, the genotype of the nematode is determined by DNA sequencing, hybridization-based methods including with allele specific oligonucleotides, microarray analysis, enzyme-based methods, single strand conformational polymorphism (SSCP), high resolution melt (HRM) or approaches based on PCR, RT-PCR, or qRT-PCR.

Isolated nucleic acid molecules comprising one or more of SEQ ID NOs: 1-127 are disclosed. In one example, the nucleic acid molecule possesses at least 80% sequence identity to one or more of SEQ ID NOs: 1-127. In other examples, the nucleic acid molecule possesses at least 90% or at least 95% sequence identity to one or more of SEQ ID NOs: 1-127. In one example, the nucleic acid molecule includes a fragment having a length of at least 100 nucleotides of one or more of SEQ ID NOs: 1-127 and includes the polymorphic site. In another example, the nucleic acid molecule includes a fragment having a length of at least 50 nucleotides of one or more of SEQ ID NOs: 1-127 and includes the polymorphic site. In one example, the nucleic acid molecule includes a fragment having a length of at least 100 nucleotides and that possesses at least 95% sequence identity to one or more of SEQ ID NOs: 1-127 and includes the polymorphic site.

Kits for determining the responsiveness of a Dirofilaria spp. nematode to a macrocyclic lactone are disclosed. In one example, the kit contains a probe capable of determining the genotype of the nematode at a polymorphic site of one or more of SEQ ID NOs: 1-127. The probe may be an oligonucleotide, a primer or an aptamer. Using the kit, the genotype of the nematode may be determined, for example, by DNA sequencing, hybridization-based methods including using allele specific oligonucleotides, microarray analysis, enzyme-based methods, single strand conformational polymorphism (SSCP), high resolution melt (HRM) or approaches based on PCR, RT-PCR, or qRT-PCR.

Methods for selecting a treatment to treat an animal infected with a Dirofilaria spp. nematode are disclosed. In one example, the method involves determining the genotype of the nematode at a polymorphic site in a nucleic acid molecule that includes one or more of SEQ ID NOs: 1-127 and selecting the treatment based on the genotype of the nematode. In one example, the nucleic acid molecule possesses at least 80% sequence identity to one or more of SEQ ID NOs: 1-127. In other examples, the nucleic acid molecule possesses at least 90% or at least 95% sequence identity to one or more of SEQ ID NOs: 1-127. In one example, the nucleic acid molecule includes a fragment having a length of at least 100 nucleotides of one or more of SEQ ID NOs: 1-127 and includes the polymorphic site. In another example, the nucleic acid molecule includes a fragment having a length of at least 50 nucleotides of one or more of SEQ ID NOs: 1-127 and includes the polymorphic site. In one example, the nucleic acid molecule includes a fragment having a length of at least 100 nucleotides and that possesses at least 95% sequence identity to one or more of SEQ ID NOs: 1-127 and includes the polymorphic site.

In one embodiment, the method involves treating the animal with one or more alternative agents when an alternative nucleotide is found at the polymorphic site. Alternative agents may include one or more of an arsenic-based therapy, diethylcarbamazine, and antibiotics. In one embodiment, the method may include isolating the nucleic acid molecule from the nematode, and optionally purifying the nucleic acids prior to determining the genotype of the nematode. In one embodiment of the method, the genotype of the nematode is determined by DNA sequencing, hybridization-based methods including with allele specific oligonucleotides, microarray analysis, enzyme-based methods, single strand conformational polymorphism (SSCP), high resolution melt (HRM) or approaches based on PCR, RT-PCR, or qRT-PCR.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1-28 illustrate the genotype frequencies for the SNP within each of the indicated markers, for susceptible and LOE isolates. The graphs are representative of markers that are also designated as SEQ ID NOs: 1-109 within the application. For markers designated with an asterisk (*), the genotype indicated shows analysis of the reverse complement of the sequences shown as SEQ ID NOs: 1-109 within the application.

FIG. 1 illustrates the genotype frequencies for the SNP within Marker 617 (SEQ ID NO: 1), Marker 714 (SEQ ID NO: 2), Marker 814 (SEQ ID NO: 3), and Marker 887 (SEQ ID NO: 4).

FIG. 2 illustrates the genotype frequencies for the SNP within Marker 1514 (SEQ ID NO: 5), Marker 2557 (SEQ ID NO: 6), Marker 3367 (SEQ ID NO: 7), and Marker 3488 (SEQ ID NO: 8).

FIG. 3 illustrates the genotype frequencies for the SNP within Marker 4553 (SEQ ID NO: 9), Marker 5266 (SEQ ID NO: 10), Marker 5365 (SEQ ID NO: 11) and Marker 5667 (SEQ ID NO: 12).

FIG. 4 illustrates the genotype frequencies for the SNP within Marker 6568 A (SEQ ID NO: 13), Marker 6568 B (SEQ ID NO: 14), Marker 7633 (SEQ ID NO: 15), and Marker 9400 (SEQ ID NO: 16).

FIG. 5 illustrates the genotype frequencies for the SNP within Marker 9473 (SEQ ID NO: 17), Marker 9858 (SEQ ID NO: 18), Marker 10349 (SEQ ID NO: 19), and Marker 10520 (SEQ ID NO: 20).

FIG. 6 illustrates the genotype frequencies for the SNP within Marker 10678 (SEQ ID NO: 21), Marker 11676 (SEQ ID NO: 22), Marker 11933 A (SEQ ID NO: 23), and Marker 11933 B (SEQ ID NO: 24).

FIG. 7 illustrates the genotype frequencies for the SNP within Marker 12716 (SEQ ID NO: 25), Marker 12925 (SEQ ID NO: 26), Marker 13063 (SEQ ID NO: 27), and Marker 15000 A (SEQ ID NO: 28).

FIG. 8 illustrates the genotype frequencies for the SNP within Marker 15000 B (SEQ ID NO: 29), Marker 15709 A (SEQ ID NO: 30), Marker 15709 B (SEQ ID NO: 31), Marker 17333 (SEQ ID NO: 32).

FIG. 9 illustrates the genotype frequencies for the SNP within Marker 18110 (SEQ ID NO: 33), Marker 19999 (SEQ ID NO: 34), Marker 20570 (SEQ ID NO: 35), and Marker 20587 (SEQ ID NO: 36).

FIG. 10 illustrates the genotype frequencies for the SNP within Marker 20698 (SEQ ID NO: 37), Marker 21554 (SEQ ID NO: 38), Marker 22174 (SEQ ID NO: 39), and Marker 22254 (SEQ ID NO: 40).

FIG. 11 illustrates the genotype frequencies for the SNP within Marker 22259 (SEQ ID NO: 41), Marker 24708 (SEQ ID NO: 42), Marker 25276 A (SEQ ID NO: 43), and Marker 25443 (SEQ ID NO: 44).

FIG. 12 illustrates the genotype frequencies for the SNP within Marker 26447 (SEQ ID NO: 45), Marker 26730 (SEQ ID NO: 46), Marker 26974 (SEQ ID NO: 47), and Marker 27080 A (SEQ ID NO: 48).

FIG. 13 illustrates the genotype frequencies for the SNP within Marker 27349 (SEQ ID NO: 49), Marker 27461 (SEQ ID NO: 50), Marker 29128 (SEQ ID NO: 51), and Marker 29168 (SEQ ID NO: 52).

FIG. 14 illustrates the genotype frequencies for the SNP within Marker 29455 (SEQ ID NO: 53), Marker 29816 (SEQ ID NO: 54), Marker 30575 (SEQ ID NO: 55), and Marker 30991 (SEQ ID NO: 56).

FIG. 15 illustrates the genotype frequencies for the SNP within Marker 31796 (SEQ ID NO: 57), Marker 32164 (SEQ ID NO: 58), Marker 32223 (SEQ ID NO: 59), and Marker 34439 (SEQ ID NO: 60).

FIG. 16 illustrates the genotype frequencies for the SNP within Marker 34903 (SEQ ID NO: 61), Marker 35336 (SEQ ID NO: 62), Marker 36040 (SEQ ID NO: 63), and Marker 37881 (SEQ ID NO: 64).

FIG. 17 illustrates the genotype frequencies for the SNP within Marker 38662 A (SEQ ID NO: 65), Marker 38662 B (SEQ ID NO: 66), Marker 38622 C (SEQ ID NO: 67), and Marker 38622 D (SEQ ID NO: 68).

FIG. 18 illustrates the genotype frequencies for the SNP within Marker 39492 (SEQ ID NO: 69), Marker 42291 (SEQ ID NO: 70), Marker 42411 (SEQ ID NO: 71), and Marker 45689 (SEQ ID NO: 72).

FIG. 19 illustrates the genotype frequencies for the SNP within Marker 45719 (SEQ ID NO: 73), Marker 46063 (SEQ ID NO: 74), Marker 47481 (SEQ ID NO: 75), and Marker 47722 A (SEQ ID NO: 76).

FIG. 20 illustrates the genotype frequencies for the SNP within Marker 48750B (SEQ ID NO: 77), Marker 48750 C (SEQ ID NO: 78), Marker 48790 (SEQ ID NO: 79), and Marker 49731 (SEQ ID NO: 80).

FIG. 21 illustrates the genotype frequencies for the SNP within Marker 49824 (SEQ ID NO: 81), Marker 49904 A (SEQ ID NO: 82), Marker 50378 (SEQ ID NO: 83), and Marker 51565 (SEQ ID NO: 84).

FIG. 22 illustrates the genotype frequencies for the SNP within Marker 58162 A (SEQ ID NO: 85), Marker 58864 (SEQ ID NO: 86), Marker 62666 A (SEQ ID NO: 87), and Marker 62666 B (SEQ ID NO: 88).

FIG. 23 illustrates the genotype frequencies for the SNP within Marker 7060 (SEQ ID NO: 89), Marker 12056 (SEQ ID NO: 90), Marker 16261 (SEQ ID NO: 91), and Marker 23195 (SEQ ID NO: 92).

FIG. 24 illustrates the genotype frequencies for the SNP within Marker 28579 (SEQ ID NO: 93), Marker 48869 (SEQ ID NO: 94), Marker 53021 (SEQ ID NO: 95), and Marker 7986 (SEQ ID NO: 96).

FIG. 25 illustrates the genotype frequencies for the SNP within Marker 48094 (SEQ ID NO: 97), Marker 6568 (SEQ ID NO: 98), Marker 17022 (SEQ ID NO: 99), and Marker 55751 A (SEQ ID NO: 100).

FIG. 26 illustrates the genotype frequencies for the SNP within Marker 55751B (SEQ ID NO: 101), Marker 15893 (SEQ ID NO: 102), Marker 25462 (SEQ ID NO: 103), and Marker 33494 (SEQ ID NO: 104).

FIG. 27 illustrates the genotype frequencies for the SNP within Marker 17935 (SEQ ID NO: 105), Marker 48561 (SEQ ID NO: 106), Marker 42003 (SEQ ID NO: 107), and Marker 29566 (SEQ ID NO: 108).

FIG. 28 illustrates the genotype frequencies for the SNP within Marker 33868 (SEQ ID NO: 109).

FIG. 29 presents Table 1 which displays genotype frequencies for markers representing SEQ ID NOs: 110-127.

DETAILED DESCRIPTION

Definitions

Herein, “macrocyclic lactones” or “MLs” means products, or chemical derivatives thereof, of soil microorganisms that belong to the genus Streptomyces including, but not necessarily limited to, avermectins and milbemycins. These molecules are used to treat species of endo- and ectoparasites in a wide range of hosts. Avermectins in use include, without limitation, ivermectin, abamectin, doramectin, eprinomectin and selamectin. Available milbemycins include, without limitation, milbemycin oxime and moxidectin. Macrocyclic lactones have a potent, broad antiparasitic spectrum at low dose levels. They are active against many immature nematodes (including hypobiotic larvae) and arthropods. A single therapeutic dose may persist in concentrations sufficient to be effective against incumbent nematode infections for prolonged periods after treatment.

Macrocyclic lactone (ML) heartworm preventatives were developed for the treatment of dogs and cats, which were not already infected, to prevent establishment of adult infections by targeting the developing L3/L4 stages. Macrocyclic lactones also have effects on the microfilarial stage (L1). Macrocyclic lactone endectocides such as ivermectin (IVM), milbemycin oxime (MO), moxidectin (MOX) and selamectin (SLM) are used during the transmission season for chemoprophylaxis for heartworm in dogs and cats.

Herein, “responsiveness” means that a nematode responds following exposure to a macrocyclic lactone (ML). In embodiments of the invention, a nematode may respond by being sensitive or resistant to a ML. Sensitivity or sensitive to a ML means that the macrocyclic lactone adversely affects the exposed D. immitis nematode. For example, a ML may be lethal or sub-lethal to the D. immitis nematode, shorten its life-span or inhibit its ability to reproduce. Resistance is the reduction in effectiveness of a drug, herein MLs, in curing a disease or improving symptoms (e.g., eradicating heartworm organisms from a dog). A D. immitis nematode may be ML resistant if the drug meant to neutralize it is ineffective, less effective or has reduced effectiveness. A D. immitis nematode may also be ML resistant if the drug, at a specific dose that is meant to neutralize it, has reduced effect. In embodiments of the invention, responsiveness of a nematode to a macrocyclic lactone may be determined in vivo or in vitro.

Herein, “loss of efficacy” or “LOE” means that there is at least a perceived decrease in responsiveness of nematodes to MLs. The perceived decrease in responsiveness may be perceived or may be actual. In one example, the decrease in responsiveness of nematodes to MLs may be real, in which case the nematodes may be said to be resistant to MLs. In another example, the decrease in responsiveness of nematodes to MLs may be perceived and not real. For example, in the case where a dog infected with heartworm is treated with MLs, for the purpose of eliminating heartworm from the dog, the dog owner may not be compliant in properly administering the MLs to the dog. In such a case, the heartworm infection may not be eliminated from the dog because sufficient doses of MLs were not administered, for example. The dog owner, or other observer, may mistakenly believe that MLs were compliantly administered to the dog (e.g., the owner believes s/he administered MLs as directed but, in reality, missed administrations, administered inadequate dosages, etc.) and, because the heartworms were not eliminated from the dog, the heartworm parasites are resistant to MLs. In at least some of these cases, heartworms are not eliminated from the dog because of the lack of compliance. In these cases, continued presence of heartworm may not be due to ML resistance of the heartworm organisms (i.e., the decrease in responsiveness of the heartworm parasites is perceived and not real). In cases of LOE, generally there is no confirmation that the heartworm infection is actually resistant to MLs.

Herein, “resistant” or “confirmed resistant” generally means that the heartworm organisms were shown to have at least reduced responsiveness to MLs. In one example, dogs infected with heartworm are treated with MLs, using a regime known to normally rid dogs of heartworm infection (i.e., compliance of the ML treatment is not in question), but the treatment does not rid the dog of heartworm organisms. Such heartworm organisms, which would normally be eliminated from the dogs by the compliant treatment, are not eliminated because of their reduced responsiveness to ML. Such heartworm organisms are said to be resistant to the MLs.

In one example, a D. immitis nematode may be said to be resistant to a ML if less than about 93%, less than about 91%, less than about 89%, less than about 87%, less than about 85%, less than about 83%, less than about 81%, less than about 79%, less than about 77%, less than about 75%, less than about 73%, less than about 71%, less than about 69%, less than about 67%, less than about 65%, less than about, 63%, less than about 61%, less than about 59%, less than about 57%, less than about 55%, less than about 53%, less than about 51%, less than about 49%, less than about 47%, less than about 45%, less than about 43%, less than about 41%, less than about 39%, less than about 37%, less than about 35%, less than about 33%, less than about 31%, less than about 29%, less than about 27%, less than about 25%, less than about 23%, less than about 21%, less than about 19%, less than about 17%, less than about 15%, less than about 13%, less than about 11%, less than about 9%, less than about 7%, less than about 5%, less than about 3%, less than about 1% or if 0% of nematodes died following exposure to a LD95 (a lethal dose or concentration of a drug that should have killed 95% of D. immitis nematodes) dose or concentration of a macrocyclic lactone.

In another embodiment, a D. immitis nematode may be said to be sensitive to a macrocyclic lactone if at most about 5%, at most about 4%, at most about 3%, at most about 2%, at most about 1% or if 0% of nematodes survived following exposure to a LD95 (a lethal dose or concentration of a drug that should have killed 95% of D. immitis nematodes) dose or concentration of a macrocyclic lactone.

Herein, “nucleic acid”, “nucleotide sequence” or “nucleic acid molecule” may refer to a polymer of DNA and/or RNA which may be single or double stranded and optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers. “Nucleic acids”, “nucleic acid sequences” or “nucleic acid molecules” may encompass genes, cDNA, DNA (e.g. genomic DNA) and RNA encoded by a gene. Nucleic acids or nucleic acid sequences may comprise at least 3, at least 10, at least 100, at least 1000, at least 5000, or at least 10000 nucleotides or base pairs.

“Nucleic acids”, “nucleic acid sequences” or “nucleic acid molecules” may be modified by any chemical and/or biological means known in the art including, but not limited to, reaction with any known chemicals such as alkylating agents, browning sugars, etc.; conjugation to a linking group (e.g. PEG); methylation; oxidation; ionizing radiation; or the action of chemical carcinogens. Such nucleic acid modifications may occur during synthesis or processing or following treatment with chemical reagents known in the art.

Herein, an “isolated nucleic acid molecule” may refer to a nucleic acid molecule that does not occur in nature as part of a larger polynucleotide sequence; and/or may be substantially free from any other nucleic acid molecules or other contaminants that are found in its natural environment. As used herein, an “isolated nucleic acid molecule” may also encompass recombinantly or synthetically produced nucleic acid molecules.

Herein, the term “identity” or “identical” refers to sequence similarity between two or more polynucleotide molecules, at one position in within molecules, or at more than one position within the molecules. Identity can be determined by comparing each position in the aligned sequences. A degree of identity between nucleic acid sequences is a function of the number of identical or matching nucleic acids at positions shared by the sequences, for example, over a specified region. Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, as are known in the art. In one example, sequence identity may be determined using the well-known and publicly available BLAST algorithm (e.g. BLASTn and BLASTp). In another embodiment, the person skilled in the art can readily and properly align any given sequence and deduce sequence identity/homology by mere visual inspection.

Herein, “single nucleotide polymorphisms” or “SNPs” refer to genetic variations (or non-identity) at specific locations in a genome (i.e., polymorphic site). Generally, at a specific position in a genome, the identity of a nucleotide may be invariant or constant. At some positions in a genome, however, the identity of a nucleotide may not be invariant. At such positions, there may be a nucleotide present at the position at a relative higher frequency than other nucleotides, when the genomes of different individuals within a population are analyzed. The nucleotide most commonly found at such a position may be referred to as the wild-type nucleotide at this position. However, there may be one or more other nucleotides found at this position at relatively lower frequencies. These nucleotides may be referred to as alternative nucleotides. The frequencies by which the alternative nucleotides are found may vary. In one example, the SNPs described herein may play a role in responsiveness of nematodes to MLs. In one example, the SNPs may identify or tag a region of a genome that may play a role in responsiveness of nematodes to MLs (i.e., the SNP itself is not directly involved in the altered responsiveness to MLs but may be genetically linked to genetic changes that are involved in altered responsiveness). In one example, presence of one or more of the disclosed SNPs may indicate that the parasite whose genome contains the one or more SNPs is less responsive to MLs compared to parasites that do not have the SNPs.

As used herein, the term “polymorphic site” may refer to a region/specific location in a nucleic acid at which two or more alternative nucleotide sequences are observed in a significant number of nucleic acid samples from a population of individuals. A polymorphic site that is one nucleotide in length may be referred to herein as a “single nucleotide polymorphism” or a “SNP.”

Herein, “marker” or “markers” generally refer to nucleic acid sequences that can contain one or more SNPs. These nucleic acid sequences can be of different lengths.

Herein, “genotype” refers to the genetic constitution of a cell, an organism, or an individual (i.e. the specific allele makeup of the individual) usually with reference to a specific character under consideration. In the context of this application, genotype generally refers to identity of nucleotides at positions of SNPs. In one example, a GG genotype may mean that at a specific position of a gene (e.g., a polymorphic site) which has two alleles, the nucleotide at the same location in each allele is G (guanine). Alleles are alternative DNA sequences at the same physical locus, which may or may not directly result in different phenotypic traits, but generally within the context of this application, correlate with decreased responsiveness of parasites to MLs. In any particular diploid organism, with two copies of each chromosome, the genotype for each gene comprises the pair of alleles present at that locus, which are the same in homozygotes and different in heterozygotes.

Suitable approaches for use in determining genotype are known in the art and may include, without limitation, PCR, RT PCR, qRT PCR, SSCP and hybridization with allele specific oligonucleotides. Other approaches may include nucleic acid hybridization to DNA microarrays or beads, restriction fragment length polymorphism (RFLP), terminal restriction fragment length polymorphism (t-RFLP), amplified fragment length polymorphism (AFLP), and multiplex ligation-dependent probe amplification (MLPA).

Herein, “consists essentially of” or “consisting essentially of” means that the nucleic acid sequence may include one or more nucleotide bases, including within the sequence or at one or both ends of the sequence, but that the additional nucleotide bases do not materially affect the function of the nucleic acid sequence.

Genomes and SNPs

In one aspect, the invention relates to isolated nucleic acid molecules possessing at least 80% sequence identity to SEQ ID NOs: 1-127, over their entire length, and comprising the alternative nucleotides at the location of the SNP (i.e., polymorphic site), the alternative nucleotides indicated by the underlined nucleotide in SEQ ID NOs: 1-127, as disclosed in this application. The alternative nucleotides generally have a lower frequency of occurrence at the indicated positions within the sequences, as shown in FIG. 1 and in Table 1. In one embodiment of the invention, the genome of a nematode parasite, or a population of parasites, may contain one or more of the alternative nucleotides at the polymorphic sites shown in SEQ ID NOs: 1-127. The presence of these alternative nucleotides generally correlates with reduced sensitivity of the parasites to MLs as compared to parasites that do not contain the alternative nucleotides.

In another aspect, the invention relates to isolated nucleic acid molecules comprising, consisting of, or consisting essentially of the sequence depicted in SEQ ID NOs: 1-127.

A nucleic acid molecule of the invention may comprise a sequence corresponding to that of SEQ ID NOs: 1-127 over their length, and containing the alternative nucleotide at the SNP site (i.e., polymorphic site). In embodiments of the invention, the nucleic acid sequence may be at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to SEQ ID NOs: 1-127, but that was isolated from a nematode having the alternative nucleotide at the position in each sequence shown by the underlined nucleotide as disclosed in this application.

In other embodiments, the nucleic acid molecule of the invention may comprise a part of, or fragment of, SEQ ID NOs: 1-127 that also contains the polymorphic site and the alternative nucleotide at the polymorphic site. In various examples, the fragment of SEQ ID NOs: 1-127 may be 5, 20, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300 or more nucleotides in length.

A nucleic acid molecule of the invention may be derived from a D. immitis nematode containing one or more of SEQ ID NOs: 1-127 as disclosed in this application. As used herein, “derived from” may refer to a nucleic acid molecule that was isolated from a natural source, e.g. a Dirofilaria immitis nematode. It may also refer to a nucleic acid molecule that is man-made, e.g. recombinantly or synthesized on the basis of a nucleic acid molecule isolated from a D. immitis nematode.

Detection of SNPs

SNPs may be detected by any method that can determine the identity of a nucleotide at a specific position in a genome (e.g., polymorphic site) and that allows for comparison of the identities of nucleotides at the specific genome position between individuals or populations of individuals. Differences in the identities of nucleotides at a specific position may be indicative of a SNP.

A variety of methods may be used to detect SNPs. In one example, hybridization-based methods can be used. Hybridization-based methods generally rely on hybridizing complementary DNA probes to the site containing the SNP. In one method, dynamic allele-specific hybridization (DASH) relies on differences in melting temperatures resulting from mismatched base pairing. By designing probes that differentially hybridize based on nucleotide changes in target genomes, SNPs can be detected.

In one example of a hybridization-based method, molecular beacons can be used. Molecular beacons are single-stranded nucleotide probes, with a fluorochrome at one end and a fluorochrome quenching molecule at the other end, that can form a stem-loop structure and place the fluorochrome and quenching molecule in close proximity to one another. In absence of hybridization of a molecular beacon to a genome region, the fluorochrome will be quenched, due to its close proximity to the quenching molecule. When the molecular beacon hybridizes to a genome region, the fluorochrome generally will not form a stem-loop structure. Under these conditions, the fluorochrome will fluoresce, due to the increased distance to the fluorochrome from the quenching molecule.

In one example of a hybridization-based method, oligonucleotide microarrays, which are high-density arrays containing hundreds of thousands of probes, are used for hybridization to SNPs. By comparing differential hybridization to redundant probes, it is possible to detect SNPs.

In one example of detecting SNPs, enzyme-based methods may be used. In one example of an enzyme-based method for detecting SNPs, restriction endonucleases are used to digest a genomic DNA. By determining the fragment lengths that result from the digest, it can be determined whether certain sites within a genome fail to be cleaved by the endonuclease due to a nucleotide change (e.g., alternative nucleotide) in the sequence recognized by the endonuclease.

In one example of an enzyme-based method for detecting SNPs, PCR (polymerase chain reaction)-based methods are used. In one example of this, two primer pairs are designed such that only one of them will function to amplify a site containing a SNP, depending on whether the SNP is present. The sizes of the amplified products are distinguishable, therefore informing which primer pair functions, and whether the SNP is present.

In one example of an enzyme-based method for detecting SNPs, nucleotide probes are designed to hybridize to a genomic site and produce a mismatch, whether or not a SNP is present at the specific genomic site. An endonuclease (e.g., Flap endonuclease) that cleaves one of the probes, depending on whether a mismatch exists, is used. Using fluorochromes and quenching molecules, attached to one or more of the probes, SNPs can be detected.

In one example of an enzyme-based method for detecting SNPs, primer extension is used. In this method, primers are hybridized to genome DNA immediately upstream of the SNP. DNA polymerase is then used to extend the primer in a mini-sequencing reaction. The sequencing reaction determines the presence of a SNP.

In one example of an enzyme-based method for detecting SNPs, the 5′-nuclease activity of Taq DNA polymerase is used. A TaqMan assay is performed concurrently with a PCR reaction. The method is set up so the PCR reaction will extend through a site containing a SNP, and release a fluorochrome from a probe hybridizing to the SNP region, depending on whether the probe contains a mismatch due to presence of the SNP.

In one example of an enzyme-based method for detecting SNPs, DNA ligase is used to ligate two probes, one hybridizing to a SNP site in a genome, depending on whether the SNP is present, and a second probe hybridizing adjacent to the SNP site. If both probes hybridize to the genome without mismatches, ligase will connect the two probes, which can be measured.

Other methods of detecting SNPs exist, including for example, detection of single-stranded conformation polymorphisms, temperature gradient gel electrophoresis to detect duplex mismatches due to SNPs, denaturing high performance liquid chromatography to detect mismatched duplexes, high resolution melting analysis, use of mismatch-binding proteins, and others.

In one example of detecting SNPs, a biological sample comprising a D. immitis nematode may be obtained from a subject. The subject may be, without limitation, a dog, fox, wolf, coyote or cat. In the context of the invention, a biological sample may be any sample (e.g. bodily fluid, excrement, organ, tissue, etc) from a subject. The biological sample may be from a subject that is known to have, or is suspected of having, a D. immitis nematode infection. The D. immitis nematode may be isolated from the biological sample with standard separation methods and techniques.

A nucleic acid sample may be isolated or obtained from a D. immitis nematode prior to use. Methods of isolating nucleic acids from organisms and tissues are known. Such methods may include, but are not limited to, traditional DNA extraction, with proteinase K digestion followed by phenol chloroform extraction, sodium hydroxide extraction, and physical disruption, followed by purification, e.g. by cesium chloride centrifugation or high performance liquid chromatography (HPLC); or the use of commercial kits. A skilled person would appreciate that different approaches may be used to isolate a nucleic acid sample from an adult D. immitis nematode in comparison to a microfilaria. In an embodiment of the invention, the nucleic acid sample comprises genomic DNA.

The nucleic acid sequences of the nucleic acids from the parasite may be determined using any one of numerous methods known in the art. In some techniques, sequences of separate pieces of the genome are assembled into linear whole genome representations of the parasite using computer-based methods. In one example, massive parallel sequencing may be used. Massive parallel sequencing (also called “next-generation sequencing”) may encompass various high-throughput DNA sequencing methods. One such method is the HiSeq2000 system from ILLUMINA®.

Through comparison of sequences from separate parasites or parasite populations (e.g., comparison of a consensus or reference genome obtained from parasites sensitive to MLs with a consensus or reference genome obtained from parasites resistant to MLs), presumptive SNPs can be identified.

The presumptive SNPs can be analyzed further. In one example, high-throughput SNP analysis using multiplex PCR and MALDI-TOF mass spectrometry (SEQUENOM® analysis) was used. Generally, this system uses extension of an oligonucleotide primer or probe using chain terminating nucleotides to product different sized PCR products for each allele of a SNP. The different sized PCR products are analyzed using MALDI-TOF mass spectrometry.

Disclosed SNPs

In one example, genetic markers from D. immitis include the sequences below (SEQ ID NOs: 1-109), where the underlined nucleotides (i.e., the polymorphic sites) indicate the nucleotide position within the fragment that correlates with resistance to MLs (i.e., the alternative nucleotide). In these sequences, the nucleotide at the underlined position is generally different than the nucleotide found at this position in organisms that are not resistant to MLs (wild-type). In the sequences below, the nucleotide underlined in the indicated sequence is the alternative nucleotide which correlates with resistance to MLs. In the heading for each sequence, the nucleotide change from wild-type to the alternative nucleotide (alternative correlates with ML resistance) at the polymorphic site is shown (e.g., C in wild-type and A in the alternative sequence is designated as C→A). The genotype frequencies for each SNP at the polymorphic sites are shown in FIGS. 1-28. In FIGS. 1-28, for markers designated with an asterisk (*), the graph presents the genotypes of the reverse complement sequence, as compared to the nucleotide sequence presented in SEQ ID NOs: 1-109.


MARKER 617 (SEQ ID NO: 1); C→A
AACATAAACATATTGAACTGAATCCTGCAAACAGTTCTCTTATAACGTGAACCATAACT
AAATTTAGAGAAAATATGAAAAAGAAAAATAAGTTGCTTTTGCTCGTGCACCAACTCTA
ATACCCAGGAAATCAAGAAGTGATAATGAGTAATGTCATCATTAGATTCAGTAATTGG
TGACACTATCAATATTATTATTATTATACTTAAAAATACGACGACCACTTATCGTAACTT
AAAGCATGCATAATACGACTGTCATCATATTACATTTCTTCAAGTTCGTATTGGACAAG
TGATT
MARKER 714 (SEQ ID NO: 2); C→T
GACAAGCGTTGACGGGAGAGACGATATAATAATAAAGAAGGCATTGGGTATCAGAAG
GCACAATCCAATTATAAATGCCAAGGCAAAATGAATAAAATTTATGCTGACGATTTGA
TCAATTACGAAGAATTTCCGATCGGCTCGAATCTTTGTTTGTATGTGCACTACTGTTA
ACTTAATCTTTGTTTTATATACTTTTGCGTGTCATATATAATATATTCATGTCAACTGAT
ACGTTATGATGTTTTTTTGTAAATTAAGTTGATCGGAAACCTGAAGTCTATTTCAAATT
TAAGAAAT
MARKER 814 (SEQ ID NO: 3); T→C
TTTTAGGAAAATGGTGACTGTAGAGAGATATTATCGGAACGACAAGGTCCACTTCGA
ACGGGTCTTTTATTGTCGACGGATTGTGAACCAAGTTTTGGCATTCATAATGACAGGT
AGCTATTTTTCCATCATCCCATTTTTGTATTAGTGCAAGCAAGTCATGAGTCGAAAGA
AAATCTCAAAAGAAAAAAATGAAATTTCAGGTTCAAAGGACTGCGTCCATTATTCGCA
CTGGTTGATGAGAACGTACAGATTCCAGAGCGGCAATGCTGCACAGTATCTTTTGTT
TCACTTCTGAAT
MARKER 887 (SEQ ID NO: 4); C→T
TCGATTAAAAATTATCATCGATAAAATTCTAAAATTTATTTTAGTAAAATTATTATTATTT
TGATGAATAAGTTAACAAAAAAATTTTAATAACTTTTTGATTCGCCAAAAATCTAATTCG
TTAAAAAGTCGTTCCAAACAGATATCGCTTGTTCGATGAAAATGTCCGGTTGTTAGAA
AATCATAAATTGGTTCAAATAATTTTCCAGAACGTTCGAAAAAATATTCCCTTGTATCG
GATAAATAACCATTACAATTTTCCACTCGTGTTGCATGTGTTTCTCGACAAAAATCAGC
TAA
MARKER 1514 (SEQ ID NO: 5); T→C
TCAACAGAAATCGAGATTCCAAAAAGTTTCCTACAAATACTTAATTATCAATGGATATT
TAGTTTTGTTATCTGTTATCATAAGTTCTGCTTCTTACACGATTAAAAATGTCCAAGAA
TTTTTTACTATTCAAATGAGGGAAATAAAAAACCAATGCCAATAATATCCAGAAACTAC
ATACATCTTTCTTTTTTCGAAGCTCATCTATTCCGGCCGAAAACAATGAAGAACATTAA
AATTCTTAAAAGATAGTCTTAGCCTTTTCCTTGACCACTATCTTAACTGTCAGCGCTAA
AATGT
MARKER 2557 (SEQ ID NO: 6); T→C
AATAGTCGTCTCATTACTTTTTGACTTTTATAATTCGAGAATCTTATGTAGTCCTTCACT
TTACCCTTCTTCTGTCGAACTAAGAATTACAGCATTATTTTCGAATTTAATGTGTAAAA
GACAATAGCAGATTTTGTAATTTTGTGTTAACCTCACTTTATATTTCGCTTCATATCGT
GACAGAGAATTACTATTTCAGAGAGTATTACTTGTCACCAGAGAATCTCCAGAAAGAT
TTTTATTTACGTCGGAAAATGGACAAAAATGGTTTCTTATCATTAGCACTGATAGCTAG
TTTCC
MARKER 3367 (SEQ ID NO: 7); G→A
TATCTCTTGTTGTGTGTTCTGCATTGTATCAAAGTGGGTAAATTTTGCTTTAGACGTTG
ACTTATTGTCTTTTTTAAGTTATATTCTAGTCCATGTTTTTCTCTTTGCAAATATTTTTTT
CCGCCGCCTATGATTCATTGTTTTGTTTGTAACTCTCTATTAAGTTGCTTTTAGTTTGA
ATTGTATCAAAATTTCAAACATTTAAAATACGCACTAGCACTATTTTTTCTTATCTCAAT
TAAGCGAATCCCGGAACAAGATTTAATCGATTTCCGAATCACAATTAAATCACTGGAA
AAC
MARKER 3488 (SEQ ID NO: 8); T→C
ATTTTCCTTAACAAATCATTTTCAAACGAAAAAACATTAAAAAGTGTTAAAATAAAATG
GTGATATTGATAAGAAATTAATTCAACCTGCATATCAATTCTTGTAGCGGCCATTTTCT
TAGCAAGTTCTATAGCAGCTCGATCCATATCACCTTCTTGCTCTAATGTCAATTCCGG
TTCCGGAATTTTTTTTATTTTGCCATTCTTCATCTTTTTTTTATTTTTTACTGATATAGCT
ATAGACCCTTTCTCCCGTGCATGCCTGTAGGCCTGTTCTGATATACAGGCTTGTGAA
CCACTG
MARKER 4553 (SEQ ID NO: 9); C→T
TTCTGGGGTAGTTATACGGAAAATTAGACAATGAAGAGAATCAAAAAACATGCGATTT
TCAAACAGAGGAACTTTGGTACTTTTGCCTCGACTTACTTTATTTTAAAACCCATACAA
AATAAATGTTTCATTTGATTGATATTGTCGTACTAATAATTAGAGCTTCAACATTAGGA
TTTTAATAACCTTCAATTTATTTCAGAATTTAAGAAACTTACGTATGGATGGAGAAAAT
ATAAAGAATGGCGATGACAAATAAGATTTGCTATGAAAAAACTAATGCCACAAGATCC
GAATGCA
MARKER 5266 (SEQ ID NO: 10); C→T
TTTATGAACAAAAATAATAAAAATTAGGATAACAGATATCAATTTCTTTTAGCTATAAAT
ATACGCTTCGATTGAAAAAAGCTTTCAAATTATAATTAAGGCATACGTTACGATATAGA
CAATTAAGTCGACATTAATTATTTGAAATATTTTAAATTTTTTTCTCTTTCTTTTTTTCTA
TTCTCTTCCAAAGTGTCAAATAGTTATGAAATTGTCAGAAGCTAAAATGATAATATTAT
TCAAGTTTATTACCTAATCTTTTATCACCTCATTTCTTATCATTTATCTGAAAATCTAATC
MARKER 5365 (SEQ ID NO: 11); G→A
ATGTTGAATTTTTAATGAAACTTTTTCGGTGCATAAGCATTACAGATCTGTAAGCTGTG
CAAACCCTGTTTCTTTGTAAATTGAAACAAAGATCATTTATTGTTTCCAGCGTCGATTT
GACCTGGATAAATGTGGTACCAAAAGTAGATGACGAGAGGTAAGTGCAAACAAAATG
CACAAAAATGATTTTGATGCACTCAAATCATTTTTAAGTTTTGTGCAATTTTCCATTTTA
TAGTTTCGTGATCGGTTGTTATTCATCAACTTGATTTTGTTTGTTTTTTGTGACTTATAT
TTCAT
MARKER 5667 (SEQ ID NO: 12); G→A
TTTGACACTTTCAGATACCTTACAAACTCATCTCCAGCACCCAATTTACAATATCGCTG
CCTAAATAAAGAATTTATTCGGATATGAGACTGTAGTTTTCATTCCGTACCAATCATAG
TAGAACAGATCTATAGCATGGTGTCCTACTAAAGTTGTGACTGGCTATTAAGTATGTG
GGTGTTTTTACGTGTGCGTGGGTGTTTGTGCGTGTGTGCGTGTGCGTTTCTGCACAT
ATTTTCGTGCGCGGTGTCTGTGTGTGTCCGTTTGTATATGCCGAGTGTAGCTGTGTG
TATGTTCTTG
MARKER 6568 A (SEQ ID NO: 13); G→C
CACTCATAATATACCTGTCAACAAACTCAGAAATCTGAATAAAATGACGCAAAAATGA
CAAAAACATTTTATCAACCTTTTCTTCATCACTCCCCCGCATTTCCAATTTTCTTCCAA
ACTGTTTTTGTCGTGCTACAAAGTCATCAGCCACTTCATTTTCTTCAAGATGGTTCGA
GACGCCATTCTTGGATTCACCCCTTATTTCAACTGTTTCCGAAGTCCCAGCAGTTGAA
GCTGAACCTAGCATTTATATCACCACCCGATGTCAAAAAATGACAGCGGTCAGAGAA
TACGACTTCC
MARKER 6568 B (SEQ ID NO: 14); G→A
GCTAGGTCAACAGTTGGTTTATTTGGACTTATACGATATTAAACATAATATCGCCTCAT
ATACACAGAAATATCAAAAAAACGAACACAGCTAAATCGAAGAATACGAACAAATGTT
TTAAAAATTATATTAAATCTTTTAATGCTCTCTACAATGTCGTATCTTCCCTTTTGTCTG
TATTTCTCCTTTCGTTCCACCACTGCTATTTCTCATGCCTTTGAACTATGGTTCTCGTT
GCGTCGAATTGTCCTCGAAACTGTTGTTTCTGTCGAATTACGTCGAACTGCTGGACTT
TGTCGG
MARKER 7633 (SEQ ID NO: 15); T→C
ATATCTCACTTCTGACATAAATTGAAGTGGCACTGATTTGAATGAAATGATAAATAAAA
TAAAGACGACAAGGTAGTGGAAAAAAAAAGAGGAGAAAACACCGTTTAGTTTTGGAT
GCAAGCTCGAATCTGAGTTTTCTTGCAAACCGTACACTGATCAATTTTCTTACACAAA
CATAAGAAAAAAAGAAGTGATTTTACTGTAGCTGTATCGTATAATTCAAATCATATATA
TATATGTTTCAATAATCTATACATTTATGTATATTTTTTTTTGAATGGAACAGTGAATGA
TTTTAAA
MARKER 9400 (SEQ ID NO: 16); T→C
ACAAATGCCATCGGGAGAGAAATATCGTTGGCGTACTGATCACATTGGCGGTATCAC
TTCTTTGAAAACTCCAGCTGGTATTGTGTATCATTTCATGCAATACGCTATTTTTGATC
GAATATGTCGACGGCGTAGTGTTTCATTTTCCAACGCATCTTACGTTGCGTGTATGGA
TGATGACGGACAATTATTGGAATATCAAACACCGGATCGATTGCATTCCGTAACCTTG
AAACGTGACATATATGGGAGAGTAGTGCAAATAACTTCAGATGGCGAAAATATTTTCT
TCGAATATGG
MARKER 9473 (SEQ ID NO: 17); C→G
ATAATATATATTTCCATTGATAATATTTTTCATATTATGTGATGTTTGAAATTTTCTGCA
ATTGCTACATTCCGATTAAAAACTTTTATTATCCGTACTGGAGAATTTTGCTTTTTTTTG
ACGGTTTGTTCAATAAGTTGTCAATATATTGTCTGCCTTAGTAAAACCTTTCTAATCTA
TCCGTTCGAATTGGAAGTTGAAAGTTCAGCATCATTCTTTTAGTGAGGTGTTTAAGTT
GTTCAATAGATATTATTTAGAACGATCTCAATTAAAATCTTCTGAATGATTTTATGTTTT
TAT
MARKER 9858 (SEQ ID NO: 18); A→G
GCAGCACATTGCACACAGTAAACTGCAAACTGAATTAAGAGATATTGGGTTGAATTAT
TTCTAATTTAAAAGGATATAATAAATGACTTTGATGATTGTTGATTTTAAGGTATCTCG
GAAGACTCCATCAGTCTCAGTGCTCTAGCAATCGCTATAGGTACTAAAAGAAAAGAAA
AGATGTCTCGTTATTCACTTTGAAATGTACATATCAAATCATTTTGTCGTATGAAATTA
AGTATATTATGTCTAATCGTATCATTCGAAATGAATTTACTGTCACTGTTAGAACTATT
TAGGCAG
MARKER 10349 (SEQ ID NO: 19); A→G
AGAGTTCAATCGCCAAGTTGTTCTTTTTCTCGCTCGCAGAGATCAAAACGGTGTTGG
CTATACACTCATTCATCAGGCTGTGATAGACATCTCTTAGAATTTCAGTGCTTTTCTG
GATGAAAACATTATTTCTCAAACATGACACTTAAGGACAATAGTGCGTGACTTCTTTG
TTAACGTACACGAGAAAACAAAACAGATGATGCTTGTTATCTTGGTGATAAATGTGTA
TTCAGAATAATGTTATATATCTTTGCGTGACAAATATCATTTCGTTATACTTCGGATAC
GCCTTTTTAT
MARKER 10520 (SEQ ID NO: 20); A→G
AACTTTACTTGAACTTTTTTGGTGTTCAATTTTGAATATTATACCAACCATTCAGAAGA
CTGTATATAGAAATGAACCTTCAAGAATTAATCGAAATTTTTATTAAAATCTTTTATTTG
AATATTTCATTATTTAAACTCATTACTATTTGCAGTATATTATTAGATCTAATGTAGAAA
AAAAAATCAGATGGCAAAAATAATATCATAGGTTTGTTTTTAAAATTCATTGCAAAATT
CAGTGCGCCGTTCCAGTCGCTCGTAATTACCCTATCCCTGAGCTTTACAAAAAGAAT
GCTTT
MARKER 10678 (SEQ ID NO: 21); A→T
AGGTATCTAGATAGCATAATAAATTACTACACAAACCGATGGAAACGCAAGTTTGGCG
TTGCGTGTTGATACAAAATATTAGAGCCAAGGATGGTATCACATGTAAAACTGCAATT
TTGCTATTTGTTTAAAGCAAATAAGAAATAAATATTTCGTTCTTATTCTTTAATTTATTTC
ATCAGATGGCTTTGTTATACCATAATTGTAAATCTGTCATATCTTAATTGCGCAATAGC
CCAAGATTCTTGTATATTCTTACATTTCACAATTTATTTTCTTATTTCTAGTTTTAGAATT
ATA
MARKER 11676 (SEQ ID NO: 22); A→G
AATAGCTACTCACAGCTTAAGTTAACTAATGGATTCTTGAATTTATTTAAGCGTGTAGT
TAAGCGATTAATATGATGGATGCCCAGAATCGCTTTGTCTTATAGTTTTGTCTCGACA
GAAAGGATGCATTGTTGTCTTGAATTTGTTCAAGGGAAAATTAAATAGGTTTCTTTCAA
TGACTCCTATTAAATTTTTTTGAATTTAGGCTTGCATTGCGTGTTCTGATCCACTATTA
GCACGTACGGGTATCGCAGTGCCATGTGATGCAGCACTATGCAAAAACCACCTCCAT
GTCACTTG
MARKER 11933 A (SEQ ID NO: 23); A→G
TCTGTTGTAAGTTTCACAATCCAGTTAATTTAAGCTCAGCTTATTTGAAATTTTCAACA
AAATTACGAAAATTACTTTCTCGGTTCATTTTTTTCAACCACCAAATATTTAGCATAATT
GGCCTGAAATCGTCAAAGTTTACAAACTTTTGTTCAGCAATCTTCTCTTACTCTTACAA
TAAACATGATTAACTTGTCGTCATACCAATCTCGTTTATAGCAAATTCTTTTCAAAAAA
ACATTGCTACAAATTTTATATCGCATCATTTCAACACGCATAATTATTTTTCATATATGA
AAA
MARKER 11933 B (SEQ ID NO: 24); T→C
TTCACAATCCAGTTAATTTAAGCTCAGCTTATTTGAAATTTTCAACAAAATTACGAAAA
TTACTTTCTCGGTTCATTTTTTTCAACCACCAAATATTTAGCATAATTGGCCTGAAATC
GTCAAAGTTTACAAACTTTTATTCAGCAATCTCCTCTTACTCTTACAATAAACATGATT
AACTTGTCGTCATACCAATCTCGTTTATAGCAAATTCTTTTCAAAAAAACATTGCTACA
AATTTTATATCGCATCATTTCAACACGCATAATTATTTTTCATATATGAAAAACCATATT
ATAA
MARKER 12716 (SEQ ID NO: 25); A→G
ATTAACTCTGAACCCAAAGACTGTTGGTTAAAATAAAGATCTATTTTAGTTATACATCT
AACATTAAAGGTTTTCGTACGGAAACAAGTAGGTTTGATAATTTTCATGTAACTGTAAA
GAACACCTGTGAAAGGGATCAGTAAAATTTGGGGGATGTAGCACGGAAATATGAAGC
TGAGTGTTTTGTACCCAAAAGTTTTTCAAATCTGCGAAATAACGAGAGGTGTAATGAT
CGTTTTTAACCAAATTTTTTGATTCTAATCCTTCCCACAGTTTTGAAATTCAGTAAGCA
TTTCTTTT
MARKER 12925 (SEQ ID NO: 26); T→C
TTGCAACAAATCAATAATAAAAGACTTGCGGCTAACAATATATTTGATTCTTTTTTACC
GTTATTATTATGACAGGTAATAATAGTATTACAAGCATATTTGTAGGTGTCAATTTTTT
CAATTCAAATTTTCTTAATTCATTATTTCTTCCTTTCCTTAATAAATAGTCTTTCCATTTA
AGAATTAACTTTTTGAAATCTTTAATGAGAAGACACAAAAGATTCCGGATAATTTTGCA
TCATCTTTTCTATTTCGCGTTAGTATTTTATGTTTTCAACAGATTTTTATGATTTAACTA
TA
MARKER 13063 (SEQ ID NO: 27); C→T
GATAAAATGGGTTCTTGTCAAGCTCATTTGGCATATCTTCGTCTTCTATATTTATATCC
TTTAATATCTTCTCTTTTTTCAAATTTTCCTTCCCGACGTTTTCCATATCGACCTCTTTC
TTCATAAATTTATCTTCCTCATTTGCCTCATTTTTTGACTTTTCATCCGTTTCATCCTTA
TTTTTCTTTTTTTCATCTCCTATTTTACCTTTTCCTTTATCAACTTCTATCTTAACTTTCT
CAATGTTTTTTTTATTTTCTTTCATCTTTTTGTTTTCTTCTATTGACATACTATAACAAA
MARKER 15000 A (SEQ ID NO: 28); T→A
TTTTACGAACAATTATTTCATAAAAGATTCGTATTTTTGATTAGTTTTTAAGAATTTTTTT
TTATTATTTTTAGCCAACAAATATATTTTTCAAAATTGTTAAATTTGAAATTATAAATTTC
AACTAAAAAAAAGCAAAAAGCTAAGCCAATAGAAATAACATACATGTGTAATATAAAAT
ATAAAGTATTCGAAATGAAAATCAAAGTTTCATAACAAAAAACAAAAAATATTCTAACC
TTTTAGATTTCATCAAAACTTCACTAAAAAGTTAAATTTAAATTTTCAAATTGTTATACA
MARKER 15000 B (SEQ ID NO: 29); A→G
CGAACAATTATTTCATAAAAGATTCGTATTTTTGATTAGTTTTTAAGAATTTTTTTTTATT
ATTTTTAGCCAACAAATATATTTTTCAAAATTGTTAAATTTGAAATTATAAATTTCAACTA
AAAAAAAGCAAAAAGCTAAGCCATTAGAGATAACATACATGTGTAATATAAAATATAAA
GTATTCGAAATGAAAATCAAAGTTTCATAACAAAAAACAAAAAATATTCTAACCTTTTA
GATTTCATCAAAACTTCACTAAAAAGTTAAATTTAAATTTTCAAATTGTTATACAATGAT
MARKER 15709 A (SEQ ID NO: 30); T→C
TCAAAGACAAAATGAAGAACTTAACAAAAAAAAGGCCAATAAATAAAGGCTATTTCGT
GAAAAATCTAAAAAAAAAAAGATCTGTTCCTTTCGAATCAAGTGATTCTTCCTACTACA
TTCGTGTTGTAATTCTTACTTGTATACAGTCCCCAGTTTTTCGACGATAAAAAACATTT
CGATAAGTGAGTTTGAATTAATTGAATTTTAAAAGATCATAAAAATAAAATCAAAATAA
AAAGACCAAAATTAAGTCTGATAATTCCAGAAAACACAATAATAAATATACAAATAATA
AAAACT
MARKER 15709 B (SEQ ID NO: 31); T→A
AAATAATTCACTAATTTCTCATCATCAAATTATTTCGTACAATCGATAAATCAACGATTA
TAATAGCGAAGAGAATGAAAATTAATGTGGTGCACAGTATACGGACCCCATATACAAT
GTTCAACAGAGATGAACATTTTTTTTCTATTAAAGTTTTCTGTTCGGCGAAAGAAAGAC
ACTTTCTAACGATGCTTTCCTCCCAACTCCCCTTGCAATGATAGAGGATGCAGCCAA
GATTCGTCGACTCAAGCAGCATCACTCAACCGGCCATCACTTCGGGACCTTTTTCCC
TGCCTTTTA
MARKER 17333 (SEQ ID NO: 32); A→G
CATTGCGAATGACCGCTATGGAATATCAATTAGCAGATATTAATCGTGAATTAAGCAC
ATTGGTGGAATTTTTACGACCAAATCGAATTTCAAAAAATGCTACACTTGCAACATCA
GCAACCATTGCAACATATAACAGTACTTCGATGCGTAATGTAAAAAAGAAATGTAATG
CATCTGAAAGCTGAAAATTCATCTGATATATTGAAGCAAAAGGTAAGATTATTTTTAAG
ATATCATTCTTGATGCTCTCATAATTTCTACATCAAATTTAATCAAACGATTCATTTATG
TTCATTT
MARKER 18110 (SEQ ID NO: 33); C→T
TTCTTGTTGTACCTATCATAGATGATAACTTAAGTACCAATAGCAATAGTGCAACGAT
GCAAGGATTCTGATTAATGATTATAAAAGTTTAACCAATCTTCTTCATTCCTTCTAATC
AAGAGAAAAAAAAATGAGAACATTTTTATGACATTTGAAGAAAGGCAATTTATCGCTG
AAAATTCTACTGCGATATGGAAGTATCAGATAGAGAAAATAAATATTAAAATATGGATT
TCATACGAAAAATGATAAAAGATAATAATTTACATTTTGGTGCTTTACTGATATGATTG
GAGTATT
MARKER 19999 (SEQ ID NO: 34); T→A
CGATATTTTTTGGACGAATCAAACCTTTTTGGGAAATCATTTGATGTCACAAGCATGG
TTTGAGAAATTTTTTTCCGAATTAGTTCTGCTAAAAATACTCCAAATGAGTCTAGTGGA
ATTAAGCTAAGCACCTTAAGTAAGTTGAGAAAAACGTTTCCATTTGACTAACAAGGCT
AGTATATCGACATGAGACAGAAATGGTTATTACTTCACTCACTTCATGAAGCGAATAC
GAAATATCTGTTCACTTTAGTTTCAATCTACTATTTTACCAATAAACGTGTTCTTTTCCG
GATAAAT
MARKER 20570 (SEQ ID NO: 35); T→C
TCTTAATTGATTTTCTTAACTCGAAACACTTGTCTTGATTACTGTGCTGTACTTTATCTT
ATTAAATTAAATAATTTCCATGACCACTTCATACCATTGACCATCAAACTTTGATGAAG
TTTATGTGTGAAGTGCCAAACAATCATTCATCCCTTCAGTTTAACTTATTGCTGGTCAA
ATTCATAAAAATGCAAATTATCAAGCAGATAGTAATTCAGTGAACGTAGCGTATTCTC
GAAATTTCTTTCCTTGTATTTACCTTATATAGAACAACGTATATTTGTAGCATATATTCA
ATAT
MARKER 20587 (SEQ ID NO: 36); G→A
TTTCTGAGTTTGCGTTACAGCGCCAAATCTTCACGGAGATAGATAAAATACTTATCGT
GAAATTTTGGCGCCATGATTTAAAAAACACGGAGATAAAAATAAAATGCTTATCGGTG
ATAATTTAGCGCCATAATATGAATGAATTGAAAAAACAATTTGAGTAGAAACATGACAT
AGAGTTTTCGTTTTCTGGCTACGAAAATGGATGAATTTTTCTGGAATCGAATTCAGTC
AAAGAAATAGGAACGTTGTTACTAAATGATCGAAAAGCTTTCTAAAATTAAATTTATGA
CGTCTAAG
MARKER 20698 (SEQ ID NO: 37); T→C
ATCTAAATCTTCGTTTTATAGTGGTAAGACTTCCATTTGCTGCATTCTTGCAAATTAAG
CTGTTGAAAATACTTTTTTTTTTGATAGATTTCCAATTTAATCATATTATAAGAAGAATT
AATTTCGAATAGAATTTTTAAATCATTTAAACTTTAAGTTTTAAAACTAATATAAGTTAT
GCAGATTTCGCGAAAAAGTCTCATTTGTTAATTCAATTATTCCAAAATGTAATAATTTT
ATAAATTCAAATTTAAACTACTACTAACTTCTGAAGTCAGGAGCCAGTAGCAACAACG
TAAT
MARKER 21554 (SEQ ID NO: 38); A→G
AACTTTACATTTATATTCAATTTTTTTTTATTTTGTTTGTTTTTAGAAATTTGAAAATGGG
TACTAATCAGTGTCATTTGCAGCCTCTTAGACCCTCTTTATAACGACCGATTCGATGA
AATACGTCATCAATATGCCAGTTTATTGTTCGGGTGGAGAATGTTTTCAAAAGTTGCT
GAAGTGATGAAGTATAGTGAGAATGCACCTTATTCAGCACCATTAAGAAGTAAATTTT
TGCTTTGGAATTTGACAAAGACAAAGCAGGAAGTTGACAACGATGTTCTGATGAAAC
GGTTTCGA
MARKER 22174 (SEQ ID NO: 39); A→C
GTCTATTTTGGCTGTCTTCTAATAATTCATTTTGTAACCTTTTGAAATATGATAAATGTA
GAAATTTTTTCTTCCTGGTCTATAATAGTTTAATAATGTGTTGTAGTAATAGTTTTGGT
GCCGTTGAAATATTTCAATGATATGCTATCGCAAAATTAGGAATTCAAATCAAGGTTA
CAAGATAATTCAAAAACAAACAACGTAAAAATGAAATAATTTCTTCTTCTTACTTACCA
ACAGGCATATCATCATCATCCTCAAATTCATGACTATATTTAACATTGTCATATTTGAA
TAATC
MARKER 22254 (SEQ ID NO: 40); C→A
CGACGCAAAAATCTTTCAAATTGTCACCCAGTTCTCTAAGTGATTCCAATGATGTTGG
TAAACATTCTGCATGATGTACCGGGTAATGAACTACCAAGTTGTTTTTTGCTTTTAATA
CAACTCGCAAAGATTCTGAAAACCATGAAATTAAGAAAGATTAAAATAATCTGAACTCT
TTTTTTCATTTTTCCTTGAACTTAGCAATATACTGAGTTGGATAAAATTTAGAAACGAA
ATTTCGCAAATTTATTCAGTAAATTCAGGAAAACTCGGTTTCGGTATTCTAAATATAAA
TAGATA
MARKER 22259 (SEQ ID NO: 41); A→G
GTTTCTTTGGTTTATCTCAGTAAGATTTGGGCGGAAATTTCAGTTATACTTTTCATTTC
CATGTGCTGTTTTAAATTTCTTCCATATTAGTATAATTTTCAAATAATTGTAGCGTCACT
GGTTTATTTAAGGATAACAGGTTGGACTGCAGTGGCTGAGAAGTGTCTTGCCGGTCA
ATTGTTTGTTGGTGATCAACTTGTACGAGTTACTGATATCGACATATATAATACACGG
CAAATTCCATTCGTTTTCAGTACTGCATCAAAAACGGGATTATCGGTACTTTGTAAATC
GCAGTAT
MARKER 24708 (SEQ ID NO: 42); C→T
GACCCCTGCTCACAAGGCAGTTCCCACAGACAATCACACATCTAATCACACACATCA
ACTCATCCGACGTAGGCTATCAATAAGGAAAATTGCATTGCTTTATCGTCTAACTGTA
ATAAACATCTACATAATGAAATTATTTCGCCACTATGACAACTAATATCGCCCAATGCA
AATATTTGTCTCAGAGTTATTCCCTTTTAACAGCTGTTGAACGAATAGATAGGACGTC
ATGTGGATGATCTACTTGTTTCAAAGGTTGAGGTAACACATGAAACACATGAAAACGG
TAATTTAAAA
MARKER 25276 A (SEQ ID NO: 43); A→G
AAAGAATGGTCAGCAAGATGTGGAAAATCGATTACTATAGTTGAAGTATGAATCGAAG
AGGTTTTTTTAAATTCTAAGAGAACGAATAATCGGCAAAGAGAAAGTTGAGTAACCTT
ATTTTGCCTTGTTTTCAGTCAATTTATAATATGCGGTTAATTGTGTTAAAGAAAGTACA
AGGTATGAAATCTAAGCCAAGAAATAAGAGAAAACAGCTAATGATTATTTCTGCATTTT
TTCTTTTTCGACACAAACTTGGAACCAGAATCAATTGAACTAGTAATCAGATTTTGATT
ATTGCTT
MARKER 25443 (SEQ ID NO: 44); T→C
TTAGATTTTGCTGAAGCATTGTTGGTTAGATCGATGAAAATATAATTATGAGAGATTTT
GTTGAAATTCAGCAACAAAATTATTATTCATGTCTTCATGCTGTCAGTTTTGTTTTTATT
TCTTCTTTGACATCGGTTATATTTTTGTCTTCCAACAATATAAAAAAAAAATTATAATCA
ATTGGTAATCAAATTAAAACTCTAATTGTTAGCTCCCTAAATCAGCTTTAAAAAAATAA
TTGCTTAATTGGTATTTGCTACTATTAGCAAACTGAAACTATCCTTTTCTCGAATGGTG
AAC
MARKER 26447 (SEQ ID NO: 45); G→A
ATGAGCTGATATTTGATATGCATATTAAAAATAGGGTAAATTACATTAAGTTAGATATC
GTTCGGATAAATTAATTAGAAAAAATGTTTACCAATTAGATCGCAATGATGTAAAATTT
CACGTATTTTTATTCTTAAGATTTATTTGCAAAATTCAAAAATATGTCTTATGAAAAATA
ATATTTCTGTGTAAGAACAAGGGACCGATTCACTTGATTTATTCGCAAACAATCGAAA
TTCAAAATTAGTAATTTTAAATATTGCTTTATTCAAACCATACCAATAATAATTTGAGAG
ATTT
MARKER 26730 (SEQ ID NO: 46); A→G
ATTGATTGATTCAAATAAGAAATTTAAATTATTTCCCCTTTTTTTCAAAAGATTTAACAA
ATATTATTTATTTGATCTCCTCGTTCGTTCTTATCTTTTTGATTATCAATCCATCCTCCT
CCATCATATAGCTAATTTATTTTTTGCATCGTAAATCAATTGATGTATGATTGATTTCTT
GATTATAAAAAGTTAGAAGAATTGAATTGCTTAAATTTAATTATTGATAATGAAATATTA
TTATATTTCAAAATGATACGAAGAAATATGACGATGATAAGAGAAAATATGATATTTATC
MARKER 26974 (SEQ ID NO: 47); C→T
TACGATAAGTTATTTTATTTTACACATCTCCATCCTTGACTAGTGTCCGTGCCGACTGT
CGGACTTGAACCGACAACCTACTAATTACAAGTCAGTTGCTCTACCCAATTGAGCTAA
GCCGGCCATCTAGAATGTGCGACCCCGTCGTGGTACATCTTCTATAATCGTTTGGTA
TTCAGGACTCTCTTCTTTCGTGGGTGGAGGATCTTGATACAGTTGACTATTAAAAATA
GGGCCTTTGTTAGTCTGTTACAACTCATAGACAAAGGCGACAATTTTAGCTTACATCT
TACGTTATGC
MARKER 27080 A (SEQ ID NO: 48); A→G
ATGGTAGAAAATTATATGAAAAAATATCATACTAAAAATATAACAGATTGTTATAAGGT
ATGGTTTAAGAATTTACAACAATTGATTATTTATGATAAAAAAAAAAAAAGTAAATCAGT
GAATCATTAAGATAGTTATGATAAGCAGTTTGTATTCGGTAAAGCGAATGATTAGAGG
AATTATGGGACGAAACGTCTATAACCTATTCTCAAACTTTTAATGAGTATGACGTGTCT
TGCTTGCTTAAAATTATTTCAATGATCATTTCACTTTACCAGTATGATCATGATTAGAC
TTGAA
MARKER 27349 (SEQ ID NO: 49); T→A
TTAGTATCGATATTATCACAAATGATATCACTTTCATCAATACTGGATACGATTTTATTA
GTATCATAATTTTGTGGCTCGCATTCCGAAAGTTTTACACGTAGAAGATTAACCTGCA
ATATGATTTATTTTATCATTTTCGAATATCCAACTTTGAAATAATTCGAAAATGTTGAAA
AATTTTGAAAAATTGTTAACAAAATATTACAAAAATATCAAATGAAATTAAATAACTGTC
CATTTCAAAAAAAGAAGAAAAATTATGAAATTACCAATTAAAAACAGGACTTATTAATT
AAA
MARKER 27461 (SEQ ID NO: 50); G→T
TGTGGAAATAAAGTACAATTAATTGCTGTTCGCTTAATAATATTATTTTCATTCTTGGC
TTTTTTTTTCTTTCCCCGTGATATTATAAAATATAGTTTTTTAATTTTAACAAATCGTCAT
AATTATTTAAAAAATACTGAGGTGAGTAAATGTAATTGGTTGCTGGAAAAAAAGTGGG
TGATGAGAGGTGAATGAAAGCAGAATAGTTTATGATTGCATCAAATTTCCTCCTTAAT
CTGTGATTAAAATCAAACAAAACCCGAAAAGTTTCTTCTTCGCCTTTTTCTTCTCTTTG
TTTCA
MARKER 29128 (SEQ ID NO: 51); T→C
CGAAATCCGCCGCGTGCATTACTTTGCGCTTGTTGATTACGACGCATTTGTTCGTCG
TTGATAACCTTATCAATCATCATACGTCCGTTACGTATGCAATCAACATCGCCAGTTA
GGCTGAAATCAAATGGATGGCGATGATATCAAAAACAAAAATAAGGAGTATTTGCTGA
ATCATTTCTTTTTCTGTATTATTATCAAAATTTTCTCCTTTCCATTGTTTCCTTCTTAATC
AAGTGAATGCTCATTTCATTTTGAAATAATCCAACGTAATAATTCCCCATATTCCCAAT
TACTTTC
MARKER 29168 (SEQ ID NO: 52); A→G
AGAAATATTAAACTTTGAAAAGATGTGACATGTTCTGTAACAAAAGCCCAAAATTTCGA
CTGCTGCGGCTTGAAGTAAAATTTTGGAATATGCTACATCAGTAGTGCAACAGATGGT
TCGATAAATAGTGGTAAGTGATGGGAATCCTAGGAATAGATGGGAATTGTATTTCAGA
TATAAATTTGATGCATATTTTCATAGTTGATTATATCTACGATCACACGTTGAATATTCT
AAAAGCAAACTGTAATTAACTAATTGAATTTGAAAATTTCCAAGAATTAAAATTGGTAA
CAAAAA
MARKER 29455 (SEQ ID NO: 53); T→A
ATTGTCAGGAATGAGAAGCAAGTTTTGGATACTTAAGGGATGAATGGAACACATACAT
GGCAGAAAATGTTAGTAATCAAACCATTTAAATTACTTAGCCACTATGCTAAACTTTCT
AGAAGTATGGTTGAACGTTTAAAAACCTTCGCAAAAATTGTATTAGATTATCTTAATCT
TCCCTACATCAAAACAGAGAATTTTTGTTCTACGACGTGAGTCTGCATGTATTAAGGA
AGTTCGTATCATGACGTAAATATCCTGAGTGATTATTGAATTCAGAAAATGAGCTTTTT
CATTTGG
MARKER 29816 (SEQ ID NO: 54); G→A
ATATGAGTGTTACATGTGTACGTTACATGTAAATATTATATGTTATATGTAAAAATGTC
ATGTATAGCATCTATTCACGTGTACGTACACGTGTATATACATATACATTGATACTTAA
TACGTATACGCATGAATGAACAGATATTATATATTTACGTACACTAGACTCACATGTAC
CTCTGTATACGCATACATGTACAGATATATGTTTGACATACGTAAATTCATATATGCTT
TTATTTATGCTTATATTAATTGTCACATACATGCCTTATATTTTCGTTGTTATAAACACA
TAAA
MARKER 30575 (SEQ ID NO: 55); T→C
GAAAATAAAATTAGCTGAAAATATATGCGAGGTAAAGCACACAGAAGAATTAACTTAA
GGTAATATATTGTAAGAATTTTTATATTCGGCGCACCTAATAATTTTTAGACCGCATAT
GCCCAGTATTTGAAACTGGTAGCGCTGTTCGTACTTGCTGTTGTCCATGTTATGTATA
TGATACCATTCCTAAATACTTTTGCGGCTGTGGTTTCCAGTGTTGATGTGACTGGTAT
GATGCCTAACACTGGATCCTTCCATCTGCGGCATTTTGTTGAAATTCTTATTGATGTG
AGCTGTTTA
MARKER 30991 (SEQ ID NO: 56); A→G
CAACTGTGAATCATAAACATTACTTAAATTAATGAAGCTAGTTAACGACAAATATATTT
TTTTATGTATCAGTGCTATCATATAACATAAAAACTTACTTTCATTAATAAATGAGCTCA
AATATTGACTTTTGTCCAAAATGCTCAAAATGTCGTCATAATATTTGAAATGAAGATAA
TTTCACGCTTTTCGAAGCCTCCTCTCACGTCTTTTAATCTTCTTTTCTTCTTCTTGCTC
TAATGGTTCTGCGAAAAACCACGGTGCAATAATCACTTTCCATAATTTATACAGTACAT
AAGC
MARKER 31796 (SEQ ID NO: 57); A→G
CTGCTTAACTCTTTTCATTTTTCAGAGAATCTTCTCTAAAATTGTGAATTGATCCAAAC
CAAAGAATATGGATAATGTGATTCGAATTCCTGGAATTTAGATTTTGAGAGTTTTGAA
GTTTTTAAAGAGATTGAATTTCTGTGACCTTCTGGTATATTTGATGTCATTTCGGGATG
CGTATTTTTGCCGAAAATTTTTGGCCTCACTGCAATCTTGTTAAAAGTCAAAAAAATTC
AATCGTAGAATTTCGGGTTTACCTGATATTACTGGAAATCTCTGATCTTTGTTCTAGAT
TGCTGT
MARKER 32164 (SEQ ID NO: 58); A→T
ATAAAGAATTTGCAACTCTGTATACCTTTTTGCAGTGCAAAAGCGGATGAATTCTTCA
CTGCAGTGTGACAGATTCCTTTGATAAAATTGCTTCGTTCTTATGTAAACTTGGAAATT
CTCGGTAGTTATGCTTTTGCTAGTTGAAAATGTTCTGCTCTTGTAAAACATGCAAAAA
GAGATTATCTTTGTTCTATTATGGAAAGATTCTTTTGAAATTTTGACGACTGAGAAGAC
AAATTTTATCCCAACTTGTCATCTGCAATAAAAATTTTTCCTGACCTGTTTCTTAACCTT
CCAAGT
MARKER 32223 (SEQ ID NO: 59); T→C
AAAATCAAATCAATATGATCAGATAACTCATACTTATCTTACTGAAAATTCCTCATTCA
AGGGAAATAAATAATTGCAATTCTTGATTCCGATCATGGATGATTTTCAAGCAAATTAC
CAATGATATCTATCGATAACGATTACAGCATACAGCTATAACTTATTATTGATTGAATT
GATGAAAATAATTTTACCAGAAATTTATCAATGTTTATCTCATTGCAGTATACGATGTT
TAGTGTGACAACACTTTTTCTTGGAATAATTGTGCATAAATCATTGATTGCATTTAGTA
TTGGA
MARKER 34439 (SEQ ID NO: 60); T→C
TCCTGCCCACATTCTTTCTACTTTAGATAATCAACAGGAGTTAGTTGAAAGAGAAGAC
TAGGAACAGTTGCAACTTCTGAATCTTTCTGACTTTCTTTCGTTTTGTAAATTATTTATT
TGTATAAATTTAAAATTCGAAGAGAAATAATCCAAGGTCCAACTTCTTTTTCTGTTAGT
TCTTGCGAATGCTCCATCAAAATGCAAAAATATGATTAGAATTCTGATGGAAATTAACA
AAATCGATTAGATAAGAAAAGTACAAAACAGAAACTAACTTTTTCTCCCATTTTCATAT
TATAG
MARKER 34903 (SEQ ID NO: 61); T→C
TCATTGCTTTAATACTTTTTAACGAGAATTTTCTCGATCAAAATAAGATCTGCAATTGA
TATACGTCAATAAGCGAACATTAGCTGTATTACACGCTAATATTCACATATGATGAAC
GTTGTAAGCGTCATACATCAACATATATCCATCCGATAAATAATGACCACTACACATT
GCTACCAACCATCCTATCCCGCCACTATTTGAAATGAACTGAGAAGGAGTTATCGAC
ACAGGCTTCCTAGCAACCAAACAAAAGACGAGACAGATGAATAGATAGACAGACAGA
CGAACATACAA
MARKER 35336 (SEQ ID NO: 62); A→G
AGATTCTGGTTATTATTGTATTTCTGATTTATTTAATCCCAACTTAAAGATTCATTGGCT
ATTGTTTAGCATCTATATCAATTTTATAAATAAATAGTAATACCTGATGAAAAGCAATAA
ATAATTAGATGCAAATTTTAATTAGATACAGTTTGATGGAAAACATTGAAGCCATGTAC
AACTAATTTATGCATGTTGAATTATGCATGCATAATTAATTTATGCATGACAGCAAGTT
TGGTATAAAATTAATTTTGTATGAAGATAAAATTTTATAAATAATGATAATAATGCTGGT
AA
MARKER 36040 (SEQ ID NO: 63); T→C
ATTATTGAAAAGAATAATGTAGCTAATTAGTTGAAGCTGTTAAAAGTAAAGCTAAAAAG
ATGATGGAAATTATTCGTATAAACATTCTTTGTAAACAAACAGTCATTTCTGTGAATAA
ACAATTATAATTATAAACAATACTTTTCAAGACAATAAAAAAATTAGGAAGCATTGTTG
TGATAATCAATAGTTGATAGACTGTCAATGTATTTTTATCAGTCGTGCTGCTTTTTTTC
CCTTTCTTGACTCATTTATTTTATTATTTATTGATAGAATGTCAATATTCTAGTCATTTG
TTAT
MARKER 37881 (SEQ ID NO: 64); T→C
ATCTTAACTTGCTTTAAACAAATAAATTAAAACAGCCCAATGTTCCAAGAAAAAAAGAT
AAGTTAAAAGTGGGGTGTCCAAAAATTTATGAATTGAATTGGACAGTTATTCAGATCC
TGAAAATACGCTTCTCTGATCACTGCAAATATTCCCGATAAATAAGTGAACATTAGGT
TAATCTTAATTTTCCCTTAACTTTCCTTAGCCTTTTTTAAATTTTTGGATTATTCAAGCA
TTTTTATTGCGGTATCGTTTTTGTAAAAAAAAAAGTATAATTCAACATTCAGGCTCGAC
GTTATG
MARKER 38622 A (SEQ ID NO: 65); C→A
AATTAATAAAAAGAAAGGAATACGATAAAATATCTATTTTTTGAAACTAATCAAACATAT
TCCTCACTGCTCACCGGATAGTTGCTTTCTAATTTTACATTAAGAAATATATTTTTTTTT
TTCAATAAGGAAAGTTATGCAGACTAGGAGAATTCTACTCTGAAGAAGAGATAAGCAT
GTTAGAATTATTAAAATCTATGGAAATATCCTTAAAAGAATGCCTATAGTAGCTCTGAT
TTCGAAAAAAAAAGCAAAAAACAAAATAACAAATTCTGCTCAATTGAAATAAAAAACTT
TCCT
MARKER 38622 B (SEQ ID NO: 66); C→T
TAAAATATCTATTTTTTGAAACTAATCAAACATATTCCTCACTGCTCACCGGATAGTTG
CTTTCTAATTTTACATTAAGAAATATATTTTTTTTTTTCAATAAGGAAAGTTATGCAGAC
TAGGAGCATTCTACTCTGAAGAAGAGATAAGTATGTTAGAATTATTAAAATCTATGGA
AATATCCTTAAAAGAATGCCTATAGTAGCTCTGATTTCGAAAAAAAAAGCAAAAAACAA
AATAACAAATTCTGCTCAATTGAAATAAAAAACTTTCCTTCAACTTCCAGCATCACTGC
TGTGA
MARKER 38622 C (SEQ ID NO: 67); C→T
AACTGCTAAAAAATTGAAACTAGTGTTAGATTGATAAGTGGGCAGATTAAAACCAATT
GTGTTATTGGCCCGTTAATTAGTGACTCTGAATAGCTATGGCGAATCGTATAGTGTTG
TACCGACGACGTATCTATCAAATGTCTGCCTTGTTAAATTTCGATGATAGTTTATGTG
CCTATTATAGTTGTAACGAGTAACGGAGAATAAGGTTTCGACTCCGGAGAGGGAGCC
TGAGTTGCCACATTCAAGGAAGGAAGCAGTCGCGAAGATTACCCACTCTTAGAATGA
GGAAAGAGTGAC
MARKER 38622 D (SEQ ID NO: 68); C→T
GAAAACTAAGAAGTAAGTGAAATTTCTAAGTTCTTTCCCAGAAAGGTTAGATCCAATA
TTTGTTTTCATTTTAGCATTTTTATCCAATGAAAAATGTGCCCAATAAATACTTGTATAT
AGTATTGCATTTAAAAACTTCAGAAAGCACAATGAGATCTAAGCTCAGAAATATGACG
AATACCAATCCTTTTCCTAGTCTTACCGCTTCTTAACTTTTGTGTCGCTTTATAAAAATT
AAAAATAAAAAGTTGAACAATGGGAATTACATCATTTTCATCTGAATGGTTTATTTCCT
ATTCT
MARKER 39492 (SEQ ID NO: 69); T→C
CTTCCCTAGCTATGCCTTTTCGTCACTTAAGCTTCNNNNNNNNNNTCTAGCTACGTAT
CGTTATCATTTATGCTTCTTTAGCTACGTTTCTCCATCATTTATGCTTCCTAAGCTACG
TATCTTCATCACTTACGCTTCCCTAGCTATGTCCTTTCGTCACTTAAGCTTCTTTGGCT
GCGTGTCTTCATCATTAATCTTCTTTAGCTACGTATCGTTATCATTTACGCTTCCTTAG
CTACGTCTTTCCATCATTTATGCTTCCCAAGCTACGTATTTTCATCATTTATGCTTCCT
TAGATA
MARKER 42291 (SEQ ID NO: 70); G→A
GATCTTAAAATTCTATGAAACTTCTTCTGCATGGTATTGTTTCCAACAGAATATAATGA
CAATAGCAACAGTATTGGTTATATAAAAATATTGACTGCAGCAGGATTATATTTCAAGT
TCTTTTAATTTCATTTATTTATTCTTTCATTTACTTTTACTGTTTTTATGTTTTTCTTCTTT
AAAAAATATGATTTCTCTCACTGTTCTCTTTCATCTATCTATATTTATTTGATAATTGCT
TATATGATAACTAGCTAAAGGGAAATAAACTTTCAGTCATCATAGCTTCATTTTAGTAAA
MARKER 42411 (SEQ ID NO: 71); A→T
CTATACTAATCAGTCCACTATCCATTTTTAGGTTGCAAAAGTTGCAATGACGGTTTGAT
TTCATCCTCCAATGCAATTTTGAGTCTCAATCTCGAGAGATAGATCGATCGCTTTTAG
CTTGATTTAGCTTGGTTAATGTTGTGAGGGATATTGGGCAGAAATTCTGTCAAGCGTT
ACTTAATGAAATAGTAAATGATCACTGATATTTATTGTTAATGATACTTGAGCTCTCTA
GATTATGAACTGGAAGGTTTTCGATAGAAATAATCGATACATATATTAGAATCGACTTC
TTTTTTC
MARKER 45689 (SEQ ID NO: 72); A→C
TCATCTTTTTCACATTTCATTTAATCATCATTTTATCAATTCCTATTTTTAAACAAATTCT
TTTCAAATATTCTCTCTTTCCTTCTCTTTTTGTTTTCCGCTTATTCATTCTAATGATGAA
CAGATGTAGAAAATTTGCATTCTATTGCTCACTACAATTTTGAGTAGAATATATTTAAT
TATTTGATTCGAGACAGATGGTTATAGCCTTTAGCTTCAGCTTCTCGTTCAAATTAAGT
ACTTGTGACCTTTCCAAGTACCATTAAAGCTTTCCTGCGTTTCCTAATTAGAAAAAAAAGG
MARKER 45719 (SEQ ID NO: 73); G→A
GCATTTTAAGTTAAAAGTATCACGCTGCATGACACCTCACGTTTGCTATCTCAAATTG
AGTAGGTTAGAATCTTTTTTTGGCTACTATTCAAATATTAATAATAAATTGCTGCAAAC
AGATTTCACACCGGAAAAAAATTAAATTTTTCTAGCAATGTTTTAACTCCCTTATTAAAT
ATTTATAGAAAATCGACTACTTAAAAAGAATTGACTAACATTTCTGAATCTCTGCAGAG
ATTTATAGATGGATTAGCATCCTACAAGTTTTTATCTTTTTGCTATATTTCCATTATTTT
TTTA
MARKER 46063 (SEQ ID NO: 74); T→A
GATAAGACGTCTTATTTTGTAATAATTCAAAAATTAATTAATATAGAAGTAAGATCTTGA
TAATAATTAATATGCTCAAATTTCTTAATGAGAATATGTTCAGGATGAAGATGAAGTGA
AAGAAATTGATAGATTGAGGAAGCAATTGCTAATTGAAACAGAACAGCTCGTTTCCAA
TTCTCTTAAAGATTTACTGAAGAAAATTTATTATCCACTTGAAGAAGCTATTGATCTCA
AAATTCATCAGAAATTAATTCAACAAATTGCTGCCTTGTTGAAGTGTATTAGTATCTTG
GATAA
MARKER 47481 (SEQ ID NO: 75); C→G
ACCGCAAAATACCTAAAAATTTCTATAACAACGATTAACACGGCCTCGAACTGGAAGC
ATATTAATCCATGCGTGGCTCAAACTTCAATCATAAAGACAAGATCTAGAGATCAACA
CAAAATGGTGAATTGTTACCCTATCGTTGCTAAAGTTTGAGAGAAAAAAGTGCTAAAT
CAAGTAGTACACCAAATTTAGTTAATATTAAGAAATCAATTTAGTACTGAATTTAAACA
AATGAAATTTTACGATAAAATAAAAAAGTACCTGATCAAACAGCGTCCTCCCGTTATTC
CCATTGCT
MARKER 47722 A (SEQ ID NO: 76); C→T
TATAAGACTAGTAAACAGATCGTAATATAATAAATATCGATTTTATTTTAAATTTTCGAA
AACTTCCAAATCTATCGATATGAAATTAAAGATCAATTTTTAATTTCCATAATATATTTA
GATTCTATCCCAACATCACTCATCTTTATGTCAACTTATTTAATTCTCTTATTAACATTA
TATTTCTTGTTTACAATGATAAATTTTATCAATTTTCTAATATGATAGAACATCTTCATC
ATCTGAAGATATGCTTTTCTCATCTTTGTAACAATTCGTATCGCTTCTGATTTTACTTTC
MARKER 48750 B (SEQ ID NO: 77); G→A
GTTTTATTATTGCTTATTGAATAGTGATAATAACACTTTGATATGATATTGTTTTGTTGC
GATCATTGTATTGATTATAACCTTAATTAAACGAGGATATTATGGGAAATGTATTTATT
ACAAAATTAAATATGAAAGGTTGAAGTCTTGACGAAACTTTCAAACACATTTCTCGAAT
TTTCTCTGCAAAAATATCGTTACGATTTTTGGAAATTATGAAGTCCAAGAATTCAATCG
AGAGTTCGCCATGTCACTTTGGCTAGTTTCGTTTGTTTTTAATATTTCAATCAAAAGTC
AATT
MARKER 48750 C (SEQ ID NO: 78); G→A
CCTTGGATATTGTTCTTGACATCGTTGATCAGAAGGTCACCGTAGTGTTCGGTGAGC
GAGATGGAATTGGACTCAGGTTTATTCTCCGTTTTTTTCATGTTTTTGAATTTTAGAGA
GAAAATAATGTTTGTCTGAATGGTTAGCAAACTAATTAGTTTTTAAGTTATCAGGAACT
CGAAGTATCTTCTTTTGCACTTCTTTAACCTTTTTCATCAAATTTTTTAACAGTAACAAG
ATTTTTTTGAGAATTTTCAAAATATTTTTGACTTCTGATGATATTTGATGAGAAAACCAT
CACTG
MARKER 48790 (SEQ ID NO: 79); A→C
AGAGTATTATTATACATGATGATGATGATGATGATGATGATGATGATGATGATGATAT
GATGATGATGATGATGATGATGATATGATGATGATGATGATAATGATAATGATGATGA
TGATGATTAATTGCTTATTTTTAATGATTGATAACTTTAAAAGAAATCATTGAAATTTGA
TCGAATAAAAATTTTCTTAAAAAAAGCATTTGCTATTTATATAGTAAACCTATAAAAAAT
TACTTATTTTTATTACTAATATTCATTTGATTGTATGAAAGAGAAGAGAAAAAAAACCTT
TGCA
MARKER 49731 (SEQ ID NO: 80); T→A
TGGTATCACAGCACTGGGTTTAATTTCAACAATCGGTTGACGATCTTTTCGGGATATG
CCTATACCCAGAAATGAACGTATGCCAAACGATGGTATGTTTGATGCAACAGACGAC
GTCAACTTAAAATGTGTTTTTTTTTCAAAAATTCAATATTTTTAGTTTAAAATTGCACGT
CAGTAAAAATTAATTCATAATAAATCTCTTTGATTTCTTCGTTCTCCTTTTTTTTCAGAA
AAAATTGAAATTTTACATACCTGATTTCCAAGAGCATATAAAGCATCACTTAAAGCATT
CTGCGA
MARKER 49824 (SEQ ID NO: 81); T→C
TCCTTTTCATGATTTGTAGCTAACCAATAAGATGTGTATATGTTCATATATTTACTCTC
CCCTGACTCTTTTACACTCTCATTCTCTCATTTGTTCATTTAGATAAGTAATATGCGCC
TTTCTCTTCCTGATTCTCTCAATCTTTCATCCCTTCATCTCCTCAATCTTTCTCCCATTC
TCTCAATCTTTCCTGCATTGCATTCATTGATGAAACACGATAGTATTAATAAGCATAAT
TTGATAAATTGAAATAATTTTTTTTNNNNNNNNNNTCATTCTCTCAATCTTTCCTGCATT
GCA
MARKER 49904 A (SEQ ID NO: 82); A→G
TTTGAATTAACAAAATATTAACAATTACAACTATTTCGGAATTTAATTTAAGAATAATTT
AATTAATCAATTTCCTATTTTGTATTTTAAAAATTACCACAATAATTATGTAATTTTTGG
GATATTTGAAACTTTGAAAAAAGTGGTATTGTATTTGAGAATAAATTAATTAATGTAATT
CTTGCTGCTCATCGTTCCATAACTTACAAATATTTCTCGGTATTTTATTTGAGATAATT
CTTATCATTTCTTCCATAGCTTTCAATATATTTATAACTTATTTGTAATCACTCTTATCAC
MARKER 50378 (SEQ ID NO: 83); A→G
TTGAGATATCAAATCAAGCGTTGCATATTTATAGTACACTGGTGTAGCTGAAATCGCG
AAGAGAACACGAAAATCAGAGAAGTCAATGGTTCCTTTGTGTTGGATTTCACATGAAA
GCATCCTTATGTTGTACATGCGTGATTACAATATGATACAAGATGTAAGCTAAAAATT
GTTTTATCTTTGTCTATGAGATGTAGTTCATACTCTATAATAAAGTCCCAACCCTTAAT
TCTCATATTCACAACCGTATCAGAATCCAACACCAAACCATTATAAAGAATGTTCTTCG
TCGAGGCG
MARKER 51565 (SEQ ID NO: 84); C→T
CCACTATCGCTTACACTTTCTTTATCCTGTTCTTCTTCATCTTTCGTTTTGGACTTTATT
TTACTGTCAGGTGACAAGCAAAGTAACGATGTTGGACTTTGCGAAGATGTGGATGGT
ACGCTAGAAAAAAAATGAGGATTGGTTAATATGTCTAATTATTACATCGCTTTTTTTTA
AATCTTTTCTAAAATTAAACTGAATAATCAACTTATTTGCTATTCAGTTTATCTTATTTTT
TATCAACAAAATTCGAGGAAACAAATCGCTTATCAGAATAATTGTTTTGATCAACAAAT
AAAG
MARKER 58162 A (SEQ ID NO: 85); G→A
CAATCCCACAAATTCAGTGTGTCGGCGGGTCAGCGAAGGGAAAGTTTGAACCGAGG
GTATGTACAAATTGTGATAATTTTGTGATGACGTAGTAAATTTCATAGTTTTGCATGCT
TTAATGTTGATAGTCGCACAATCCTACGTTGATTAAATTTAGCTATTAGATATCCTACT
AAATTATGTTGTTCATAATTTTTGTTTTTAAAATGCTCCACTTATATTTTCAGGTTGTGC
AGTGCTACAATAGGGGTTATGACGGCAATGATGTCCAATGGGAGTGTAAAGCGGAAA
TGAGCAATC
MARKER 58864 (SEQ ID NO: 86); T→C
TCAGATAAATTGTATTTGATGTTAATTCAAAGAAGAAAAAAATAATCAGTAGAATATGA
ATCGAATAATATTCATACAACCAGTTTATTCATTATTATTCACTTTTAACGTCTAAATGA
CGTAGCTACGCTTTTTTTCTCGCTTTCAAGCCTTTACTGACCAAGATTAATGTACATTC
TGTTGAACAAGATTAATCGACATTCTATCGATCAAGATCAAGCTTTTACTGATCAAGAT
TAATAATGACATTCTTCTGTTGATCAAGATTAATCGACATTCCATTGATCAAGATTAAT
CGAC
MARKER 62666 A (SEQ ID NO: 87); G→A
CTCTCTAAAACCTATTGGTCACTAAACTTGCACTGACTAAAAACTATTGGTCATCAGA
CTTGTGATTCATTGAAAAGACCGTTAGCCGCTAAAATTATGATTCACTAAAAAAAATCT
ATTGATCATTAAATCTGTAATCATTGAGAAACTACAATCATTGGTCATTAAGTTTGTGC
TCTCTAAAACCTATTGGTCATTAAACTGACTAAAAACTATTGGTCACTGAACCTAGAGT
CTATTAAAAAAAAAATCATTGTATCAATAAATTTATTGTTTACTATCAAATCCATTGATT
ACTGA
MARKER 62666 B (SEQ ID NO: 88); A→T
TCTAAAACCTATTGGTCACTAAACTTGCACTGACTAAAAACTATTGGTCATCAGACTT
GTGATTCATTGAAAAGACCGTTAGCCGCTAAAATTATGATTCACTAAAAAAAATCTATT
GATCATTAAATCTGTAATCATTGAGAAACTGCATTCATTGGTCATTAAGTTTGTGCTCT
CTAAAACCTATTGGTCATTAAACTGACTAAAAACTATTGGTCACTGAACCTAGAGTCT
ATTAAAAAAAAAATCATTGTATCAATAAATTTATTGTTTACTATCAAATCCATTGATTAC
TGAATA
MARKER 7060 (SEQ ID NO: 89); G→A
AAAATGTATCAAATTCTTCGATGCCATAAATTATACAGACTTGATTGGCATTTTTTCTA
ACTTTCATCATGAACCATTCTATTTCTAAATTGATCCATTACAAAATCAACTTTGTGATA
TCATCAATCTCAGTCATAACGAGAAATAATGATAATATAAAGCGACTATCATTTGAATT
TCCTGAATATTCAAGATGTAATTACATCTTTTTTTTAATGTAATCAAAATTTCTTGCCAT
CAATAATTTTTCAACATATGCTTTCATCGACTGCCTTATGCAGATCGTAATGATGACAG
CCA
MARKER 12056 (SEQ ID NO: 90); T→C
ATTGATTAAAAAGAATCAACATTAAATTTTTGATATAGTCGAGAAATCCTTCGTGATAA
TTCTTTTAGAACAATTCTTTACACTAAACTTGTATTTACTTGCTTATTATTTGTCTAAAG
ATACTAACTATTTGTCAGTGGAATTTATGATCTTGGCATTATTGCATATAACGCTTTCC
TAAAATCTGAAATTTTTCAGTATTTTAAAAACTAAGACGATTATTAAATATTACTCAAAG
CTTAGAACTTTGATTATACTAATCAAATCAAAAATTTCATCAGCGATTTTTGTTGTGTC
ATT
MARKER 16261 (SEQ ID NO: 91); T→C
ATTTTTTCCAGCAGAATTGTCATCAAAAATCCCATTTTTGATATCCTCTTCATCGAAAC
TTGCTCCTGAATCCAGAGAACAACGAAGAATGTGTAAATCTATTTCAGTAGCCTGCTC
ATTGTGCAATTCAGCGACTTTATTTCTGTGCTTCAAGCTAACTTCTTCATTATGCCACT
CCTCTTCTCTCGCTATTTTTTCGCTATCTAATTCAAAATCTTCGTCTGAAACGGAATCA
ACTCCTGACGATGTACTCGACACTGATAATATTTTCATGCCGATTTTTCTCTCAAACG
AATCTTT
MARKER 23195 (SEQ ID NO: 92); C→T
GAATGAAGAGCAAAAAAATAGTCACGACCACCTGCAATAAAAACAGCATCTCCGTAA
AAATGATTGAATTGATTCCCGAAATACGAGTTTATCAAATTGAGAATTATGCAAATTAA
TTATCAGCATGCAGATTTACTGATTTTATATCTCTCATACCGAAATTAAGGTGATGTTT
TCCATTTCTTTGTTTCCACAATGTCTTCTTTGTGAATCGTTTTGGATCAACTATTAATC
CGATCGAATCAATCCTCCAAATATGAGTTTATTCAACGTAACAAAACATTGTCCGAGA
TAATCAAA
MARKER 28579 (SEQ ID NO: 93); T→C
TGGAAATTTCGAAATCGAAAGGATGAAGAAAAAGGATCCTTGATCTATACATTAAATA
TCACCATATCAACTAGCATGGCAAGTCAAAGTAATGTTATCATTTAAATAAAAAAGATG
AATAGTAGGACTACAGGTTATATTGTTAAAAGTCGACAAATTTGGAGTAATTGACAGA
GATCAACGATTAAATGTAATGGATGATCTTATCTTCTTTTTTCAACTACGCCAAAATGA
AAATAACAATTGAATTTGTCGAATAAGAAACTAACATTTTGAAAATAAGATTGAACATT
TATAAAT
MARKER 48869 (SEQ ID NO: 94); G→A
GGTTGGATCATTATCGACAGAACTTTAGAAGTTTCTTGATAAGGACGAAAAGAAGCAG
CACCATTGCTGATCTAAACAAGGAAAAAAGACCTTTTTTGGAATATTGAAGTTTTTACT
GATAGGTGCGTGCTGTGTACTGTGGGCATAAGTACAAGCTTCATGCTCCGCAGCGT
GAATACGTGCTGCATGCATACTATGCAGTAAAGGTGCGTGTCGTATTGCTCAATAAG
TGTATAAATTGCTGCTTTTCTTGCATAGTTAAATATTTTGTTTTCATTTTTTCCGCTATT
CAAAATAAAT
MARKER 53021 (SEQ ID NO: 95); G→A
GTTGGGATTTCAGACTCTCACTCGGTGTCGTTTCACAGTGATATCTGAATCGAAGTCA
CAAGCAGGTATGAATGCATAACAACTAATATCCATTGCAGAAACAAGGCAAAACTGA
GAAGCTCGAGCAATATAGCTATAGAAGCTGGTACCACAGATGACATTACATGGTATTT
CCATTTCAGCTTCACAAACATTGTAAATAGCTTGCTTCGATGATTCAATATCTCGTTCT
ACGATATTCTTAAAGTAATTTTTATTTATTTGAAGTATAGATTACATCCATGTTCTATCT
ATCATTTC
MARKER 7986 (SEQ ID NO: 96); G→A
TGTTCTGAACATCTCTTTTTGATTATCTTTTTTAATTCCTCCATTATTTTCGTTTTTTTCG
TTGTGAATTAATATTGTTTGTCTTTGATTCAGATGATATTTTCGGATCGTAAATAGATG
GCATCGGCATAAGCGTATTGAGAAGCATTCAATGGTGCACTCTTGCTTCTTTTTTTTT
TGAAATCTTTCTCGATAATCAAATAAGTGCAGGATGCCAATCATTAACAATTTCGTTCC
ACTTTTTCAGTTCTTATTCTTATAACACCACATCTCATTTGCAATTTTGTCGCCAATGAT
TTT
MARKER 48094 (SEQ ID NO: 97); C→T
TTTTTTCGAGGTCACTCTGGAAAAATAAATCATATTTTAAAAAGACATAAAATAAAAAA
TATGTATATATAAGAAAATTTTTACTCTGAATTTCTTAAGAAAATTCTCGATTCTGTTTT
CCATAAATTCCGGAATATGTTGTCCCTGAATTAAGAATTCGATTCCTTGCACACCATT
ATTTCGTCTAGTTCCTGTGTGAACAATGTAACCTGGAAATGAACACATAAACTGTAAT
ATTTTGAGCTTAAAATAATTATGAGGATGCGAAACTGAAGATATTCATAAATGTTTAAA
AAAAAA
MARKER 6568 (SEQ ID NO: 98); T→C
GTCCATGCATTGCTTTTCGGAAGTTAGTGTAGATTCAGTGAATATTTAATACCAGTCT
CTTTCTAATTCAAAAGAGCCTCCCATTTCTTTTTTCAGTTTCAGTCTCTGAATCAGAGC
GTGTAATCTACCACTCCATTGCCGAAAACAGCTCGATGTATTTCCTGCTACGTAGTGT
TTAGAATTGGCGTATGCCACTTGCTCATTATTCGCGCATGAAGTGTAACTGTGAATAG
AATGATACTACTGTTAGAAGAGAATGCGTTCACTTTATTTAACATTATACTGATTCATT
TCTTCTTT
MARKER 17022 (SEQ ID NO: 99); C→T
AGTGAACGAGAAAAAACAGAAGAAGAGATAGCACATCAAGATCGTGAGAAATTAATT
AGACAAGAAAAAGCTCGTCTTACACAAATATATCAGGTTTTCTTTTTCTTGCTTTCGAA
AGTTATTTGAATTATCTCATTTCTTTGAATTTTATAAGAAATAATTTAATTTTTTTTTGAA
ATTTTGCCTATTGAGCTCTAAATTTTGTAAAAAGTTTTCTAGGATGATGTTAGCAAAGC
AAAAAAGAAATCCAAAAGTGATGGTAACAAACAGGAAGATTTTATAGTGAGGTACGAT
AATACG
MARKER 55751 A (SEQ ID NO: 100); A→G
TAGACAATATCATCCTTCCTTTTTTTTTGCTCAATTTCTCTGCTCATTGCTTTGATGATA
ATGGTAGGTGGTATAATGAAACGAATAGATAATTGATGTTCGCAAACATTTGCTGTTA
AATTTCAGTAAAGAAATTGACCTTTTTGCTTTGTGTTGGATGTTTAGCTTCATTTTCTT
CTTGTTCATTGTCATATTCATTCTCTCAAAACTTCTTGCTTAGCGATGCTAATATAAAT
ACTGGAAGAATGCCTTTGCTTTGTTTTAGTTGTAAATCATCACCAAGGTATTTTTTTGC
AAAAT
MARKER 55751 B (SEQ ID NO: 101); A→G
AAGATGAAACTAAAAAAAATTATTTCGAAAAAAAGAAAATAAAATTAATGAAATAAAAG
CAAAAATGAACAAACCGTATTAATTTTAAACAATAAACAATATCGAAATCGAAAAATGG
ACTATTATTGATGAACTATATTTTCAAAATGTGAAAGGTCAAAGTTTGTTTCAATTATG
ATAAATACAATTTAAAATAAGATTAAGCTAACAAATAAGTTGAGCAAATTGATGAAACA
AACAAATCAGAATATATTACAGAAAATGATATAACATGAAAATATATTAGACCAATTAT
TTTTA
MARKER 15893 (SEQ ID NO: 102); T→C
TTGAAGTTTTCAGATAAACTTTGATAAAAAATTGTTCTATGAATTCTCAAATTTCAATTA
GTGATACTTATTTCGAAGGTAATTATGCCTGATTGAATCTTCAATATCAACAAAATGAA
AATTTTAGTATGATTGTTAACTCATACACCTCTAATTAAAGGTATTTTCTTTATCCCATG
AAATGAAAATTTATTAAGAACTTAGAAAGCTACGGTATGCCTTTGATGCAAAAGAAAG
ATTCATTTTCATTAAATCATGTTTAAAAAAAAGAGCAAAGAGCAAAAGGTGATGAAAGT
TTTT
MARKER 25462 (SEQ ID NO: 103); C→T
TTCTATACGAAATATTTGTCTGCCATAAATCTACTCAGGAACTCGATACATCAAAACAT
AAGTACGCTTGCTCTTTATTTTTCGTTTGAAAAATAAATAGATCATTTTCGCACTTACA
TTTCAATTTCAATTGCTTTATTCATATCTTTCTGTTTTTACTTACTGGTATTTAACAGTC
GTTGTTCACAATTTAATGATCTATGAAACACCATTTAATTGTATTTGGACTAACTTTTC
GACAAGCAAAAGATTAAAATTGTCTTCAGATACAGTTATAAATTTACATTGAAGATAAA
TGAA
MARKER 33494 (SEQ ID NO: 104); A→C
TAACGATCTGTATATCAATGGAATAATATTCAGTTCATGTTGTACTCGATATGAGATAG
AATTACAATTTTGGAACAAGATAATCTCAACAGCTATTTTCAAGAATAGTTAAATTAGG
ATACCATTCAAAGAAACTTTAAAAAATGATTTCCATACATTAATGCTTTTTGTGTTTTCG
CTCTCGACCAGAATCCAGGAATTGTCCATTATCATCAATTTGATTAACTTTTATCTTTA
TTCTAATTCTTCAACATTTCTCTAATTGATATTAGTTTCAATATTTTAATAAGTAAAAATTTA
MARKER 17935 (SEQ ID NO: 105); T→C
ATAATGTGTTATTGATCAAAGGATTTTTAGTTACCTACCAGATGGAAAAAAAGCAAGTT
TACGAAAACAGAAGTTAGCATCAACTTTCATCCATGGTTACACCGTATATAATCCAAT
CGACTCATACTTTATGTTGATCTGATTTTATAGCAGATAACTAGTTACCTTGCTCAGCA
GCAGCTAAATCCTTTCTATTTGCTTAATAACAGAAATATTTTTCATTAACAAAGAAATTA
TACTCCGTGTTTGACATTTCATTTTAATTTCGTTCCAAAAATGAAAAAAGCTTCGTCCG
GAAAT
MARKER 48561 (SEQ ID NO: 106); C→T
ATTATTTTGTAGTTTTTCATTTTTTAGTTCAATTTTCCTTTGCTTATTTTAAATATGCCAT
TCTTTATTCAGACTCATAGCGAATGCATATGTTCATTAATTTTTTTAGTTACAGTTACAA
ATTCTCAATTTCTCTTTAATCATTTTTTTTTCCAAAAATAGTCTGAGCACTCAACCATTC
ATTCAACAATTGCAGCTTTTTTTATTGGAGCCTTGTCAAATTATCAATTCGTTTCCATG
TTTATTATTGAAATAATAAACGGTATTTAGGATAACGAAGTTCGCTTAGCTTCTTTGACT
MARKER 42003 (SEQ ID NO: 107); T→G
AAAAATTCAGGTAATGAGATCAGTAATTTTTTTTGGTCACTTTGCTGTTTCTTATCAGC
TCATTGTTATCCATATCAAATGAGCGAAAGTGTGTATCACATATTGGCAGAGTGTAAT
CTATGAAGATTTTGCGTATCAAAGTAATTATGAGAGAACTGATAATTTTATTTTAAAGT
AGTAGAAAACTCGAATTAAGCTAATAAATAATCGGTTGATATCCATGAAATGAATTACT
AATGAAATGGATAATTGAGTAATAACAAATGATATTCATGAAGAAAGGCAGGTTTTTTT
TAATAG
MARKER 29566 (SEQ ID NO: 108); C→T
TATACTTAAAACAAGAAATACAATTAATGCCAATAGCAGAGTGAAACTTCTGAAAAATA
ATGAGTTGAAACTGGTAAAATTAACATTTTATTAGAAATTTCAGAAACTTATGACTCCT
CATGGCACTATCACAAAATGTTTGAAAAAAATTGACAGCTCGCGTCGATTGCAAAAAT
CATGATTCCTGATATTTAGTATCGAACATGTGACAAATAATATAAAGACCTAACCATAA
AGCACTGAAACAACTCGCGGAAACAAAAAATTAATTTGCATAAACACGGAATACGATC
AGAAAAT
MARKER 33868 (SEQ ID NO: 109); G→A
GAATTTTTTTAGAAGGCTTGAAGTCGAGAATATTAGAGACTATATCGAAGACTTAAATA
ATCCTGGTAATCTTCTGTATGAATCAAAATTACCTCGAACAGAACCATTCAGCACATC
ACGAGATAATTCATGGAATGAAACTAGCCAATCAGAGCGTTGTAAAAGAAGAAAGTTA
TGAAATGACCTTAAAATCAATTTAAAGCATGTCCTCGCCATATAAGCGTTGAAAAGTT
AGGATAGAATCAATTATCAAAAAAATATGTTAACTAGATCTTATCAATCAAAACATCAG
AAGGAAAA

In another example, genetic markers from D. immitis include the sequences below (SEQ ID NOs: 110-127), where the underlined nucleotides (i.e., the polymorphic sites) indicate the SNP nucleotide position within the fragment that correlates with resistance to MLs (i.e., the alternative nucleotide). Those markers were identified after genotype frequencies comparison between susceptible individuals and confirmed ML resistant individuals. In these sequences, the underlined nucleotide at the SNP position is generally different than the nucleotide found at this position in organisms that are susceptible to MLs (wild-type). In the sequences below, the nucleotide at the SNP position in the indicated sequence correlates with resistance to MLs. In the heading for each sequence, the nucleotide change from wild-type to the alternative nucleotide (alternative nucleotide correlates with ML resistance) at the polymorphic site is shown.


MARKER 31307 (SEQ ID NO: 110); A→G
ATATGATAATAGTGAAACAATTCCATCACAATAAATATTATCGATTAGGAGATAAATTA
ACATTGATGCCTCAATTTTGGTCAACAATATATATTTGCTATTAGCATTTTTATTAAATC
GTTTTTATCTGACTTGACATAAATTGAAATAGAAAAAATTGAATCTGTTCCTTGTTAGA
TTTTCTTCTAAAAATTCTTGAAATACAAATAATTTCTTAAATTTCAATATTTCTACATAAT
GTATTGCGACAAAAATGCTAATGATTGGCTTATTATTATTTCGAATAATTTTTTAATCAAA
MARKER 26225 (SEQ ID NO: 111); A→G
AGCTCGAAGATCGGACAAAATTTGTTCAGCTTGTTGCCTTGAGGCTTTAGTCTGAAAA
GACACTTAAAAGTATAAACAAATTATATTCAAAAAATCTTATTTTGCATTTGCGTCTTAA
TTTTTGCTTTTTGCAAAGTTTTTTCCGAGCAAGTTTTTCTATCTTCGAAAAGATTATATC
AATTAAAATTTCAATTTAAGCAATCATTGCCTCTTCGAGTTTCTGTTTCAGCAAATAAA
TATCACCACCACGACGCTGTCGGAAGAAAGAAACGCCTTTCCCAATTTCTCGTCTCA
ACTTTT
MARKER 47722 B (SEQ ID NO: 112); A→G
TAAGAAAGCTGGGAGATTTTCCAAAAACACTATTTCCCACGATTTGTTGTTTTCTATGA
TCAATTCTTAATCAAACTCTGAAATTCTCAAATTTTCGATTTCTATCCAACTTCTACATA
TTTTTTTAGAAAATTCATATTTAGCAAAGCTGAGTGTAGAAATAATTCATACTTGCAATT
CATTTTTCTTAAATTTTCGAATTTCTTAAAAAAGTATTTCAAATTACCTACCAATTTTGA
TTGGAAAATTCGTGGATGCTAAAAATTCAAATCAAAATAGTTAAACAGTATTCCTAATTGT
MARKER 58162 B (SEQ ID NO: 113); T→C
AATTTAAAAAACACATCGACATTTTGCGGTACGGTAATGATTGTTTACAGTAACTAAAT
GTGTCCTACGGTAGTAATACTCGTGTACGTAATGAATGAGTATAGTGACCGGATATTT
CCTTCACTAGTAGGCAATATTAAGAAGTATTTTCATTTTCATATTCTATCTAAAATAAAC
CGATAAAATGGTTTTTGAATTATTACTTTTTCATTGTTATTTTTTGATCCTAAATTGTAA
AATACTGTAATAATTTAGCTAATTTCTATGATTCTATTCAATATGCTTAAATTAAAATTC
TAA
MARKER 17709 (SEQ ID NO: 114); T→C
TCGTATTTGTTGTATGTAATATAGAAATATTGTTTAAATTCAATATGTAGAAAAAATTTC
TANNNNNNNNNNAATTAATTACATATTAACTCGTATTTGTTGTATGTAATATAGAAATA
TTGTTTAAATTCAATATGTAGAAAAAATTTCCATAATAAAGACGAACAGCATTTATAATT
ATCAATGATAAGTTGAAATTAATTCATCAATGATAAGTTGAAATTAATTTATTTGAAATA
ATTTCTTTGAAATTCGAATATAGACGAGAATTTTTTTTTTTTTGCTAATCGTTTATCAAAT
MARKER 47141 (SEQ ID NO: 115); T→C
TCTAGCAATATAAATTACAAGAATATGCCGTCCAAGTATTTCAGAATTTATTATTAATTT
GGATAATAATACATTGTAAATACTGCGTATTCTGGATTATTATGCACTGCATAATAACA
TGCAATTTCGTCTACATATCGCGAATAAACGCCAAAAGATTTCTCGATAAAAGAAAAT
ATAAGAATTCGTAAATGAATGTTGTGTCAGAGATATGTGTTAATTCATAAGTCAAGATG
TTGTAAATCGATCCATATTAGTAATCATATTTACGTGCTCGTAAATAAAAGCGGTGATT
CTTGT
MARKER 48750 A (SEQ ID NO: 116); A→G
ATCGAAAAAAGATGATCTGATGACGGAAGGCGAAATGTCTGCAGAAGCTAAGATGAC
GGAAGAAAAAAGTGAAGAAATGAAAGAAGAAGCTGGTAAAACTCAGAAGGAATGTAA
AACTGGAGAATCGAAAAAAGATGATCTGATGACGGAGGGCGAAATGTCTAAAGAAGC
TAAGATGTCGGAAGAAAAAAGTGAAGAAATGAAAGAAGAAGCTGATAAAACTCAGAA
GGAATGTAAAACGGAAGAATCGAAAAAAGACGATCTGACGACAGAAGGCGAAAAATC
TGAAGTAGATGAGCC
MARKER 63962 (SEQ ID NO: 117); A→G
ACTAATGATAAGAAACGGAGCCGACGATTTTAGGAAATGAATAATAACGACATTGACA
ACCATTGTTAGAAAATTGATAGTACTGATAATAAAAGCTAGTTATAGAAAATTGATAAT
AATAATAAAATTGCTGGTAGCAAATGTCTAGAAGTGATAATAAAATTAATGATAGCAAA
TGGATTAGCAATGATAATTAAACTGATGATAGCGAATGGATTAGTAATGATAATAAAAT
TGATGATAGCAAATGACTAATAATGGTAATAAAAGTTAATGCTAGTGATAACTTGTATT
TTAAGT
MARKER 6372 (SEQ ID NO: 118); A→G
ACAGTTTATAGTTACAATATTCTCCGGTGACTAACTGTATTTTACAACTTATAATTATA
GATTACAAAATATATTATAGTAGTTTTATAATTACAGTATTCTTAAGTGAATAACTATAC
TTTACAGCTTACAGTTACAGTAGTTTTCTATGTTTTTGAATATTAATTTTACATGGTTTT
TCCTAGTTTCAGTTTCAAAATTTTCAGATATTTTATGTGTTAAAGCAAATTATATTCGAG
ATATAAAAAGTACTGGTCATATCTTACAATTCTCATCCTTCTATATTGGAAAGAATTGAGT
MARKER 15611 (SEQ ID NO: 119); T4C
GTATTGGGACCGCGTATCGGGAAATCTGAAAGAAGTCTTTAACAGTATTTTAAATGAA
TAATTCAAATCGTTACTTCTTAATATATTAATTTATGCGTATATATGCAGTACATAGCAT
TGCTTAAATTCTTATTTTTCCGCGGTTAAAACCCTATGTAAGATAAGGGAGGTGATTG
TATCTGCGCCGTACTCCTTGTTTTAATCTACCTGCTTGTTGTATATCCTCCACATATTG
TAACTGCAGCTTCACATTTGCATATATAGTAAGGGCATCGTTGTCTCCAGAAGAGATA
TATTATC
MARKER 46432 (SEQ ID NO: 120); T→A
GCTGCCCGAATGTTACAATTAGGACGAAAGTAAAAGTAGTTGACTGTAGGTATGACG
ATAAAGGAAAAATTTGTATCTTAAGACTTTACAATTTCTAAATATTACGTGTTTTATCGT
GCTAACATCACGAATTCCATATTCACAAAAAAAATTTTGTAGAACTCCATCTGGTTTGG
ATGAATTTGCTACAGTTGAACTGGATGATGGAACGAAATTGCAAACATCTCTTATTGT
TAGTATTTTCTAAATTCTGTGAAATTTTGCAACGGCATTCATGTTTAATTATTAATTTGG
AGAAAG
MARKER 29594 (SEQ ID NO: 121); T→A
AAATAAGCAAATCCGAAAGTATTACATATACGGACTAAATATTGCCATTCATTCGGGA
GTATACCATTGCAACCATTGGTATTTCATTTGATCGAGAAAACTAGTTTTTGTAGTTTG
GGATAAAGAGAAATGGAGAGAGGAACTTTCATGATCAATTTCTTTACGTACTGAAATT
CATTTCTATGGATGTTCTTTTTCTATTTCATTCTCCTCAGCAAATACAGTCCGAACAGT
CATCAAATAAGTCTAAAAGGCATGAATAATATAAACATCAGCAACTTTTTAAATGAATG
CTTATTA
MARKER 26784 (SEQ ID NO: 122); G→C
ATTTCTATAAACATCTCTTGCATTGATTAATTTAACATGTTGCAATAAATATTTCTTACT
TTTGAATGTATCATTTACTAGAAAAAACTTCAATCGAGGAAATAAGTTTTAAAATAAATT
CATATTTGAATTCATGTCAGTTCAAAAATTCTATTACTATAATACATGTCTCTTGGTTGT
ATCTTTTTTTCTTTTGAAATAATACAATCAAACGGTTTCCTAAATTTTCATAGACATCAT
ATTTTAAAAAAAAATGCATTTGAAAATTTTCGAAAATCAATGAACTTAATTGATGAAAAA
MARKER 51661 (SEQ ID NO: 123); C→G
GCATGTGTATGTAGTATTTCTTTGTAAACAACATATCTAATCTGTCTGTCCCTTTAACA
TTATAGAATAGTCAGTTAGTCCGCTATTTATTTTAATAACAAAATATCTCACTTAACTTC
CATTTCTTTCCTAAATAATTTTGTTTCGCTAGATCTTTCCTATAATTTTCAAATTTTCAA
AAATGAATTAATCTTTTATTTATATATGTGTATGTATGTGTATGTATGTATGTGTACGTT
GCATATATGTATATGTATGTGTGTATGTGTGTATATGTATATGTATATGTGTGTATGTGTG
MARKER 7819 (SEQ ID NO: 124); G→C
TATGCATAATGTGCGACCAGCCAATAATGTCTTCAAACCATAATTATGCAGAAATAAA
TTTTTTCCAGAAATAATTTTTTTTTTTTTACATATACTTCCGATCTGTGAGAAAATACAT
TTGAAGTGAAGTGTGAAGCAATGCTACTTTTTCAAACAACATTGTGAAAATGGATTAA
AACGCACCAATGGAGCAAGAGATCGTAAGTTTCGTTCCGCATGTCCTGTGGCAACGT
GTAAACCATCCGTTAACGATATATGATGTAAAAGCCGACACACCCAAATTAAAATCCA
TTATAAACA
MARKER 26704 (SEQ ID NO: 125); G→C
AAATGGATCGTATTCACTTCGTAAGAACTTAGTGAACGAAAAATCAAACCATCACAAT
AACTTTACTTTTTTTCTTTTTTTACTAAACACACTATCCTATGAAAACAAAATGTCCAAA
TAGATTCATATGATAATGAACTGTGAAGTTATCCAATCTATCAGTTCTCGAAGAGGGA
ATAAATAAAAACATTAAGCAACCCACCGATCTTCGCTGACCATCTCCTTCTTCATTAG
CAAGAAGCAAATCTTGTGGTGATATTTCTGCAACCATCTGCAAAATAAAGCACGAAAA
ATTAAGGA
MARKER 14329 (SEQ ID NO: 126); C→A
TTTGATATGCAATCAACTAACCAAATCAGAATTCAATGCATTCTGATAAATTTCTTCAA
TATCGTGCATCAATTCGACATCATATTTTGACAGTGATGCTACCTTTTTAGCCGTATTT
CGGAAAAATATGAATTCAACCAGCTGCGTCCCAAAATTTAAGGCTGTAGCAAGTCCA
GCAACAACCAGCCCTACAACTGAAAATTCTAAAAACTGGTTCACGTGCTTATCATTAA
TAATTTCAACACTATCACTATCTCCACATGAACTTGATCGATTATAATTTAGTAGAACT
GAAAAAAA
MARKER 56169 (SEQ ID NO: 127); T→G
ACAAATTCGTTTTAATATTGGATTACATTGAAATTGCTGAAATAAAGTGGAAATATTGA
AAAGCATTTTACAATATTTGTTAACAACATTATATTTAAAGAATATACACCTTGGTTTAA
ATGGTAAAATAATCTCAAGAATTTTCATTAGGTTAATTTTTTTTTATTTATTTATATTCAC
AAAAAATTGTAAAAGAAAACAAAAACAACAATAATAACGGTGACAACAACAACAATAAT
AATAACAAAACTATTTGTTGTGATTTTGCAGCATTGATGTAGTGGGGATCTTTTGGAGCGA

The genotype frequencies for each SNP (SEQ ID NOs: 110-127) at the polymorphic sites are shown in FIG. 29 (Table 1). In one analysis, genotype differences of susceptible individuals were compared with confirmed resistant individuals. In a 45 second analysis, genotype differences of susceptible individuals were compared with grouped confirmed resistant and LOE individuals.

Kits and Methods

In embodiments of the invention, probes of the invention may be provided to a user as a kit. A kit of the invention may contain one or more probes of the invention. For example, a kit may comprise a probe capable of determining the genotype of a nematode at a SNP position in one of the fragments disclosed herein. The kit may further comprise one or more reagents, buffers, packaging materials, instructions for using the kit and containers for holding the components of the kit.

A probe of the invention may be one or more molecules that are capable of binding to, or associating with, the nucleic acid sample to determine the genotype of the nematode at one or more specific positions (e.g., polymorphic site) in the fragments disclosed herein. For example, probes may be used to determine whether a wild-type or alternative nucleotide is present at the SNP position of one or more of the fragments disclosed herein. An example probe may be a nucleic acid molecule or oligonucleotide. Example probes may contain a label or labels. Example labels may include radioactive labels, enzymatic labels and/or fluorescent labels.

An oligonucleotide used as a probe or primer may comprise any size, shape and composition that is suitable for use in the context of the invention. Preferably, an oligonucleotide of the invention may comprise DNA, RNA, synthetic nucleotides, non-natural nucleotides, altered nucleotides, or combinations of one or more thereof. In one embodiment, an oligonucleotide of the invention may comprise locked nucleic acids and/or peptide nucleic acids.

In embodiments of the invention, an oligonucleotide may comprise a sequence of at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, or more nucleotides.

In embodiments of the invention, an oligonucleotide may encompass, without limitation, a primer or more than one primer, e.g. a primer pair, such as a forward primer and a reverse primer.

A primer may be an oligonucleotide that may be used to initiate DNA replication. Typically, a primer is a short oligonucleotide that may be about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100 or more nucleotides.

A primer may be used as part of an approach to detect the genotype of a nematode at a specific location of a gene. For example, a primer may be useful in amplifying DNA such as by PCR, RT-PCR and qRT PCR, for subsequent analysis, such as by Southern blot, sequencing, HRM (high resolution melt) or SSCP (single strand conformational polymorphism).

As used herein, an “aptamer” may be a nucleic acid or a peptide molecule that binds to a specific molecular target. For example, in solution, a chain of nucleotides may form intramolecular interactions that fold the aptamer into a complex three-dimensional shape. The shape of that aptamer allows it to bind tightly against the surface of its target molecule. Because of the diversity of molecular shapes that exists for nucleotide and amino acid sequences, aptamers may be obtained for a wide array of molecular targets, including, but not limited to, nucleic acid molecules, enzymes, membrane proteins, viral proteins, cytokines, growth factors, and immunoglobulins.

A probe of the invention may be prepared according to standard techniques known to a skilled person. For example, a probe may be produced synthetically, recombinantly or may be isolated from a natural source. In one embodiment, the source may be a biological source, for example, from a microorganism (e.g. a bacteria or a virus), an animal (e.g. a mouse, a rat, a rabbit, a goat, or a human), or a plant.

In the context of the invention, “a probe” may mean one probe or more than one probe. One or more types of probes may be simultaneously used in methods of the invention. Probe design and production are known in the art. Generally, a probe may be produced recombinantly, synthetically, or isolated from a natural source, e.g. from a cell, an animal or a plant. However, a skilled person would appreciate that probe production may depend on the type of probe at issue. A preferred probe may be a nucleic acid molecule (e.g. a primer), with or without a fluoroflor or dye. A probe may be linear or in the form of a hairpin, with a fluoroflor, with or without a quencher or another fluoroflor (e.g. for FRET analysis). It could also be an antibody that specifically recognizes the DNA (or protein) sequence. Another probe could be based on a RNA molecule. What would be preferred may depend on technical considerations, stability, cost, ease of use, etc.

In embodiments of the invention, probes of the invention may be provided to a user as a kit. A kit of the invention may contain one or more probes of the invention.

Uses of the Methods and the Kits

Methods of the invention and kits to carry out the methods may have research, medical and industrial applications. The invention finds broad application in the management of heartworms in infected animals and in detecting ML resistant D. immitis nematodes in an area. Representative, non-limiting applications of the invention may include the detection, quantification and/or diagnosis of the existence of individuals or populations of D. immitis that are not susceptible to normal doses of ML for prophylaxis or therapy. In one embodiment, the ability to detect and quantify nucleic acid molecules of the invention is valuable insofar as it will instruct a practicing veterinarian to alter chemotherapeutic regimens for animals infected with D. immitis nematodes that have decreased responsiveness to MLs. Identification of ML resistant D. immitis nematodes may instruct a veterinarian to switch from ML therapy alone to therapy that may include an alternative agent or alternative agents, such as an adulticide (e.g. arsenic based drugs), diethylcarbamazine, antibiotics such as tetracycline, and combinations of one or more thereof in order to achieve cure and/or to minimize the spread of the resistant strain. Alternatively, a veterinarian may adjust the dosage of a ML and/or treatment regimen using a ML in the treatment of an animal infected with a ML resistant nematode. Typical recommended dose rates for ML preventatives include, for example, 6 μg/kg for ivermectin; 500 mg/kg for milbemycin oxime; 3 μg/kg (monthly) moxidectin; and 6 mg/kg for selamectin. A veterinarian may also combine one or more of the treatment approaches and therapies noted above in any combination suitable to treat an animal infected with a Dirofilaria spp. nematode, e.g. a ML resistant D. immitis nematode. For example, a veterinarian may treat such an animal with an adulticide, such as an arsenic based drug, and then follow up with a microfilaricide, such as a ML or diethylcarbamazine.

In one instance, an arsenic based drug may be used to treat an animal infected with a ML resistant D. immitis nematode. An arsenic based drug may include, but is not limited to, melarsomine dihydrochloride. Melarsomine dihydrochloride may be used, for example, at a dose of 2.5 mg/kg, twice, 24 hours apart. This may be repeated in 4 months depending on the response to the first treatment and the condition, age, and use of the animal. However, a skilled person would understand that the dosage may vary depending on the severity of the infection. For example, an infected animal such as a dog with severe (class 3) disease may receive one dose and allowed to recover for a few months before receiving the complete set of 2 doses.

In another instance, diethylcarbamazine may be used to treat an animal infected with a ML resistant D. immitis nematode. Diethylcarbamazine may be used, for example, at a dose of 25 to 50 mg per pound of an animal. The duration of administration may depend on the condition being treated, response to the medication and the development of any adverse effects.

In another instance, an antibiotic may be used to treat an animal infected with a ML resistant D. immitis nematode. Said antibiotic may include, but is not limited to, tetracycline. A tetracycline, such as doxycycline, which targets the Wolbachia endosymbionts in D. immitis may be used, for example, at a dose of 10 mg/kg/day for 40 days.

In a further instance, another anthelminthic agent may be used. Such other anthelminthic agent may include, but is not limited to, acaciasides. An acaciaside may be used, for example, at a dose of 10 mg/kg/day for 7 days.

In another embodiment, the detection of D. immitis nematode populations with the above mentioned genotypes may instruct the use of alternative agents, such as diethylcarbamazine as a prophylactic to protect susceptible animals, e.g. dogs.

In one instance, diethylcarbamazine may be used to prevent an animal from becoming infected with a ML resistant D. immitis nematode. In this regard, diethylcarbamazine may be used, for example, at a dose of 3 mg per pound of an animal once daily.

In another embodiment, a kit of the invention may be useful in as a commercial product in the detection of ML resistant D. immitis nematodes. Such a product may be suitable for use by, without limitation, a veterinarian, a physician, a pet owner, a farmer, a zoo keeper, an epidemiologist, or another consumer in need thereof.

EXAMPLES

The examples are for the purpose of illustrating an example and are not to be construed as illustrating limitations.

Example 1—Susceptible and LOE Populations of D. immitis Parasites Used in the Studies

The various susceptible and LOE populations of D. immitis used in these studies are described below.

  • a. Susceptible isolates from Missouri, USA. Thirty five (35) D. immitis adult specimens were obtained from two dogs originating from an animal pound in Missouri. The history of the dogs prior to the animal pound is not known. The dogs were not subsequently treated. The D. immitis isolates were believed to be susceptible to ML heartworm preventatives.
  • b. Susceptible isolates from Grand Canary, Spain. Seventy-one (71) D. immitis adult specimens were obtained from 12 dogs originating from a shelter on Grand Canary. The dogs were never exposed to ML heartworm preventatives and heartworm prevention is not practiced in this region of Grand Canary.
  • c. Susceptible isolates from Grenada, Wis. Ten (10) D. immitis adult specimens were obtained from 2 dogs originating from Grenada. The dogs were recruited from poor, remote areas of the island where ML heartworm prevention is not practiced.
  • d. Susceptible isolates from Italy. Six (6) D. immitis adult specimens were obtained from the Po Basin in northern Italy. D. immitis seroprevalence in dogs from this area is reported to be approximately 60-70%. ML heartworm preventatives are commonly given to dogs in this area. But, there are no reports of LOE (loss of efficacy) in Italy.
  • e. Loss of efficacy (LOE) isolate case 1. Microfilariae (mf) were isolated from a dog that was previously described (see Bourguinat et al.; WO2011/120165). The dog was a male neutered Labrador mix, born in February, 2006, that weighed approximately 31 kg. He was a rescue dog from New Orleans, La., U.S.A., collected by the Boudreaux Rescue Crew, New Orleans, and subsequently transferred to Canada where he was adopted in January, 2008.

The dog was brought to the Main West Animal Hospital (MWAH) in Welland, Ontario on Jun. 6, 2008 (day 1) for a check-up. Blood collected from the dog tested positive with a heartworm antigen test (PETCHEK® PF; IDEXX Laboratories, Westbrook, Me.) and contained microfilariae of D. immitis. On Jun. 11, 2008 (day 6), initial work-up (bloodwork, thoracic radiographs, physical exam, urinalysis) was performed. Auscultation revealed a mild increase in bronchovesicular sounds in the lungs and a grade III-IV/VI heart murmur. The remainder of the physical exam was unremarkable. Thoracic radiography revealed moderate right-sided heart enlargement and an interstitial lung pattern in the caudodorsal lung field. These examinations indicated a diagnosis of class 2 heartworm disease.

Adulticide treatment was initiated on Jun. 11, 2008 (day 6) with 2.5 mg/kg intramuscular melarsomine dihydrochloride (IMMITICIDE®; Merial Inc.). The treatment was followed by two intramuscular treatments with 2.5 mg/kg melarsomine dihydrochloride on July 9 and July 10 (days 34, 35). Over the following 90 days, in order to eliminate circulating mf, the dog was treated on one occasion with milbemycin oxime (MO) and on two occasions with IVM (see Table 2). On days 159 and 160, four months after the last dose of adulticide, the dog was again treated with 2.5 mg/kg melarsomine dihydrochloride intramuscularly. The subsequent diagnostic testing and microfilaricidal treatments are summarized in Table 2. During the treatment of the dog, several heartworm antigen tests were conducted, including DIROCHEK® (Synbiotics Corporation, San Diego, Calif.) and PETCHEK® PF (IDEXX Laboratories, Westbrook, Me.), which are microwell ELISA tests, and SNAP® PF (IDEXX Laboratories, Westbrook, Me., a membrane format test designed for rapid in-clinic use (see Table 2).

To perform the Knott's test, 9 ml of 2% formalin and 1 ml blood (collected in EDTA) were mixed in a centrifuge tube. Centrifugation was performed in a LW Scientific EZ Swing SK centrifuge at 3000 rpm (604 m/s2) for 5 min. The supernatant fluid was discarded. A drop of 0.1% methylene blue solution was added to the pellet at the bottom of the centrifuge tube, mixed, and a drop of stained mixture examined under the microscope for D. immitis microfilariae. Table 2 indicates when this test was carried out and, when determined, the level of microfilaremia.

The dog was treated as follows. Two days after the last of three doses of melarsomine dihydrochloride in July 2008 (i.e., on day 37), the dog showed transitory signs consistent with death of adult heartworms (elevated rectal temperature, lethargy, cough, increased lung sounds). Beginning on day 41, these signs were managed with prednisone (Apo-Prednisone; Apotex, Toronto, ON, Canada), 1.3 mg/kg bid for 6 days. Following the administration of milbemycin oxime (MO) per os at 0.74 mg/kg on day 74, IVM per os at 50 ug/kg on day 95, and IVM per os at 200 ug/kg (4× the normal microfilaricidal dose rate) on day 125, the dog remained continually microfilaremic. On day 207, six weeks after the second treatment regimen of melarsomine dihydrochloride, on days 159 and 160, a Knott's test was still positive, so the dog was again treated with 200μ/kg IVM per os. One month later, on day 242, a D. immitis antigen test was negative, which confirmed that the dog was free of adult worms. However, the dog was still microfilaremic. Thus, beginning on day 243, the dog was given MO per os at 0.74 mg/kg every 2 weeks on four occasions (see Table 2). Despite this, the dog remained microfilaremic on day 298. It was therefore administered MO per os at 1.1 mg/kg on days 298, 312, 326, 340 and 354. On day 356, blood was collected from the dog and examined: microfilariae were still present, and a D. immitis antigen test was still negative. On day 375, a blood sample was sent to Animal Health Laboratory, University of Guelph (AHLUG): microfilaremia was 6530 mf/ml, and an antigen test was still negative (see Table 2). As a result, beginning on day 384, the dog was administered MO per os at 2.0 mg/kg once daily for 7 days. On day 420, the dog had a microfilaraemia of 355 mf/ml. On day 420, the dog was again treated with MO per os at 2.0 mg/kg, and this was continued once daily for 8 days. Despite this second high-dose regimen, on day 480, while still testing negative with a heartworm antigen test, the dog had a microfilaremia of 1810 mf/ml.

Blood was collected from the dog on day 706 and DNA was isolated from pooled microfilariae.


TABLE 2
Diagnostic testing and treatment history for dog between 2008 and 2009
Antigen test
Adulticide
Microfilariae
Microfilaricide
Name-result
(melarsomine)*
concentration in
drug dosage
Date (day)
(+ve or −ve)
dosage
blood (mf/ml)
(PO)
Comments
2008
June 6 (1)
PetChek +vea
Knott's test +vea
June 11 (6)
2.5 mg/kg
Classified as
Class 2
heartworm
disease
July 9 (34)
2.5 mg/kg
July 10 (35)
2.5 mg/kg
August 18 (74)
MO, 0.74 mg/kg
September 3
Knott's test +vea
(90)
September 8
IVM, 50 μg/kg
(95)
October 6
Knott's test +vea
(123)
October 8
IVM, 200 μg/kg
(125)
November 10
Knott's test +vea
(158)
November 11
2.5 mg/kg
(159)
November 12
2.5 mg/kg
(160)
December 12
MO, 0.74 mg/kg
(190)
December 29
Knott's test +vea
(207)
December 30
IVM, 200 μg/kg
(208)
2009
February 2
SNAP −vea
Knott's test +vea
Interpretation: no
(242)
≥100b
adult heartworms
February 3
MO, 0.74 mg/kg
(243)
February 17
MO, 0.74 mg/kg
(257)
March 3 (271)
Knott's test +vea
MO, 0.74 mg/kg
≥100b
March 17 (285)
MO, 0.74 mg/kg
March 30 (298)
Knott's test +vea
MO, 1.1 mg/kg
≥100b
April 13 (312)
MO, 1.1 mg/kg
April 27 (326)
MO, 1.1 mg/kg
April 28 (327)
Knott's test +vea
May 11 (340)
MO, 1.1 mg/kg
May 25 (354)
MO, 1.1 mg/kg
May 27 (356)
SNAP −vea
Knott's test +vea
No adult
heartworm
June 8 (368)
MO, 1.1 mg/kg
June 15 (375)
DiroChek −vec
Knott's test +vec
No adult
6530
heartworm
June 24 (384)
MO, 2.0 mg/kg
daily for 7 days
July 30 (420)
Knott's test +vec
MO, 2.0 mg/kg
355
daily for 8 days
September 28
PetChek −vea
Knott's test +vec
(480)
1810
2010
May 12 (706)
Microfilariae
collected for DNA
isolation
MO = milbemycin oxime (Interceptor ®);
IVM = ivermectin (Ivomec ® Injection for cattle, sheep and swine, Merial Inc.);
*Adulticide = Immiticide ®;
a= Main West Animal Hospital (i.e. test carried out in house);
b= Idexx Laboratories;
c= Animal Health Laboratory, University of Guelph.
  • f. LOE isolate case 2. Approximately 9000 pooled mf were obtained from a dog from Mechanicsville, Va., that had been treated with INTERCEPTOR® from 2004 to 2008. In May 2008, the dog was heartworm antigen positive and was placed on Heartgard Plus (IVM/PYR) for slow kill treatment. In 2008, the dog was still positive for heartworm antigen and was still microfilaremic. From Dr Blagburn's (Auburn University) in vitro assay: LD95 concentration for susceptible mf produced only a 10.5% kill, and 2×LD95 produced a 13.6% kill of mf.
  • g. LOE isolate case 3. Pooled mf were obtained from low responder mf from an in vitro ivermectin susceptibility assay. The dog was a naturally infected client-owned animal, from Monroe, La., selected because it had been on ML heartworm preventative treatment. The veterinarian was convinced that compliance was not an issue. Patient records indicated that proper amounts of product had been provided to the client, based on numbers and weights of target animals in the household. The dog was microfilaremic despite the fact that it had been under ML heartworm prophylaxis.
  • h. LOE isolate case 4. Pooled mf were obtained from a dog that had the history as described below. This stray dog originated from Haywood County, Tenn., USA, and presented as heartworm antigen positive to a local clinic on Jan. 21, 2011. The dog was neutered on Jan. 26, 2011. On Feb. 1, 2011, doxycycline (200 mg orally twice per day) and prednisone (1 5 mg tablet orally every other day) therapy was initiated and continued for 30 days. On February 2, March 3 and Mar. 4, 2011, an injection of melarsomine dihydrochloride (IMMITICIDE®) (2.5 mg/kg) were given. On February 2, March 3 and Apr. 1, 2011, an oral dose of milbemycin oxime (INTERCEPTOR®) (11.5 mg/tablet) was given. On Apr. 5, 2011, a Knott's test was performed and was positive; ivermectin was administered subcutaneously at a dose of 0.26 mg/kg. On Apr. 11, 2011, Knott's test was again positive; ivermectin was administered subcutaneously at a dose of 0.39 mg/kg. Knott's tests were again performed on both April 19 and 26, 2011 and were both positive. On May 2, 2011, Knott's test was again positive and a blood smear showed microfilariae; Advantage MULTI® (2.5% imidacloprid, 10% moxidectin) was administered to the dog. On May 5, 2011, a blood smear was positive for microfilariae; at this time, microfilariae were collected. The repeated adulticide treatment led to the assumption they the dog was free of adult parasites. On Jun. 11, 2011, 200 mg of diethylcarbamazine was administered to the dog. No side effects of the treatment were noted. Within 7 days, the blood smear showed no mf. The dog was adopted on Aug. 18, 2011 and moved to Massachusetts.
  • i. LOE isolate case 5. Pooled mf were obtained from a dog originating from West Monroe, La., USA. This was a veterinarian's dog. The medical history implied compliant use of milbemycin oxime and there were several negative heartworm antigen tests at annual check-ups, until a positive heartworm antigen test and presence of mf in the blood on Sep. 25, 2008. An in vitro microfilaria sensitivity assay was performed (B. Blagburn laboratory, Auburn University, Alabama) on Nov. 19, 2008. The results of the assay indicated drug-resistant organisms. Mosquitoes were fed on infected blood samples from this original dog. L3 larvae were used to infect a second dog. At the time of infection, the second dog had been under treatment with ivermectin. Thereafter, at weekly intervals, the second dog received 1 dose of 3 μg ivermectin/kg, followed by 11 doses of 6 μg ivermectin/kg, followed by 4 doses of 12 μg ivermectin/kg, followed by 8 doses of 24 μg ivermectin/kg (interrupted for one week after the 4th dose). During the entire period of weekly dosing with ivermectin, the dog was remained positive for mf. Microfilariae were collected at 1 and 2 weeks after the last treatment were used in the analysis.
  • j. LOE isolate case 6. The samples correspond to the second passage of parasite that came from a dog originally from Earle, Ark., USA. The original isolate LOE-6 dog received milbemycin oxime in 2004 and 2005, ivermectin/pyrantel in 2006 and 2007, and ivermectin/praziquantel/pyrantel (IVERHART MAX™) in January 2008 and at the beginning of July 2008. The owner stated that she had been consistent with prophylaxis. This dog tested negative for heartworm antigen at annual check-ups in 2005, 2006 and 2007. This dog was positive for heartworm antigen and microfilaremic at the annual exam on Nov. 4, 2008. Results of the in vitro microfilaria assay (B. Blagburn laboratory, Auburn University, AL) on this dog suggested resistance. Dog-LOE-6, was experimentally infected on Nov. 16, 2009 with L3 larvae derived from mosquitoes fed with blood from the first passage. The first passage dog was experimentally infected on Feb. 24, 2009 with L3 larvae derived from mosquitos fed with blood from a naturally infected dog (the original isolate LOE-6 dog).

Example 2—DNA Isolation from Parasites Used in the Studies

Genomic DNA for the individual adult worms was extracted with DNeasy DNEASY™ kit from Qiagen (Qiagen Inc, Mississauga, Canada). The genomic DNA extraction of individual mf was extracted using QIAAMP® DNA Micro kit from Qiagen. To obtain enough DNA for analysis, the mf DNA was amplified using a REPLI-G® kit from Qiagen which allow amplifying the full genome from a very small amount of DNA. Mf were isolated by filtration through polycarbonate membrane filters from freshly drawn blood.

Example 3—DNA Sequencing, Analysis and Identification of SNPs

The goal was to identify genetic changes (e.g., nucleotide variations) present in LOE heartworm populations that were not present in the susceptible heartworm populations. Nucleotide variations in any of the LOE populations, as compared to a reference genome obtained from the susceptible isolates, would indicate potential SNP markers.

Initially, the genomes from the heartworm populations identified in lettered paragraphs a-h of Example 2 above (susceptible isolates from Missouri, Grand Canary Island, Grenada and Italy; LOE isolates cases 1-4) were sequenced using the HiSeq2000 system from ILLUMINA®. Table 3 shows the number of reads and the number of bases that were sequenced for each population. Not included in Table 3 is information from heartworm populations identified in paragraphs I and j (resistant isolates from LOE cases 5 and 6).


TABLE 3
Read information on isolates used for whole genome sequencing
Number
Isolates
of reads
Number of bases
1 - susceptible
85,097,000
17,019,400,000
2 - susceptible
78,242,862
15,648,572,400
3 - susceptible
80,687,895
16,137,579,000
4 - susceptible
75,515,617
15,103,123,400
5 - LOE-1
82,417,743
16,483,548,600
6 - LOE-2
74,261,369
14,852,273,800
7 - LOE-3
79,894,844
15,978,968,800
8 - LOE-4
75,477,318
15,095,463,600

The data generated from the ML susceptible samples (susceptible isolates from Missouri, Grand Canary Island, Grenada and Italy) were used to assemble the genome which was then used as the reference genome for the project. All of the individual fragments from the 4 susceptible populations were pooled together. Velvet aligner software (http:www.molecularevolution.org/software/genomics/velvet) was used to assemble the genome. Reads were filtered by having the adaptor sequences removed/clipped, if found. Reads were trimmed at Q30 length 32 base pairs. A length of 32 base pairs is the Aligner seed default value and the number of reads was consistent with the default value. Table 4 describes the assembly of the reference genome used for the study.


TABLE 4
Information about the D. immitis genome assembly
Number of contigs
22966
50% of the contigs are longer than
 28928 bp
Length of longest contig
250211 bp
Total bases in contigs
  94611006 (94 Mb)
Number of contigs >1 kb
 6654
Total bases in contigs >1 kb
90045376 bp (90 Mb)

Once the reference heartworm genome was obtained from sequences of the susceptible isolates/populations, then the genomes from the LOE populations were compared to the reference genome, to identify differences and possible SNPs. As part of this analysis, genetic loci containing the potential SNPs were shown not to be significantly different between the individual susceptible populations (i.e., between the susceptible isolates from Missouri, Grand Canary Island, Grenada and Italy), as well as not to be significantly different between the individual LOE populations (LOE 1-4), but were significantly different between the susceptible populations and the LOE populations. To perform this analysis, the software program called PoPoolation2 (Kofler et al. Bioinformatics 27:3435-3436, 2011; http://bioinformatics.oxfordjournals.org/content/27/24/3435) was used. The program required the use of other programs, such as Perl (http://www.perl.org/), R (http://www.r-project.org/), bwa, and Samtools. First, a synchronized file was generated, which contained the nucleotide frequencies for every population at every base in the reference genome, after filtering for base quality, in a concise format. The synchronized file generated with the PoPoolation2 program contained detailed nucleotide count information on loci for each of the populations. P-values were generated with Fisher's exact test for all the possible comparisons between populations. To identify loci associated with ML resistance, p-values needed to be simultaneously not statistically significant (>0.05) within all susceptible samples and within all the LOE samples, and statistically significant (<0.05) between all susceptible versus all LOE samples. Three hundred thirty eight loci met these criteria, including 12 that had a p-value of 10−5. Flanking regions of 1000 bp including each locus that was statistically different between the susceptible and LOE samples were analyzed by Blast (BlastN and BlastX) in NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and in the Broad Institute filarial genome database (http://www.broadinstitute.org/annotation/genome/filarial_worms/Blast.html) to remove loci located in mitochondrial, Wolbachia or C. lupus familiaris DNA. Loci located in reads with very high polymorphism (>2 nucleotides and/or indels) or low coverage (<10×) were removed from further analysis. Nucleotide counts for each locus of interest were analyzed individually for the pooled populations to ensure that the increase or decrease in nucleotide frequency was in the same direction for all the susceptible samples or for all the LOE samples. The loci that best met the criteria were retained for further genotype analysis on individual parasites to assess actual allele frequencies in populations that had been characterized in terms of ML response.

From these analyses, 186 loci were found to be significantly different between the susceptible and LOE samples. As this approach was based on reads and nucleotide frequencies of pooled samples, these loci were further studied (SNP genotyping) using individual (not pooled) populations. For this purpose, SEQUENOM® SNP frequency analysis was used. Table 5, below, shows the origins of the DNA used in this analysis.


TABLE 5
Description of isolates used for Sequenom analysis
State and/or
country of
# Individual
# Individual
From #
origin
adult worm
microfilaria
dogs
Susceptible
samples = 181
isolates
Sus1-Missouri
Missouri isolate,
49
1
USA
Sus2-Missouri
Missouri isolate,
45
1
USA
Grand Canary
Grand Canary,
71
11
Spain
Grenada
Grenada, WI
10
2
Italy
Northern Italy
6
Low responder
samples = 244
Isolates
LOE-1
New Orleans,
56
1
LA, USA, moved
to Ontario,
Canada
LOE-2
Mechanicsville,
35
1
VA, USA
LOE-3
Monroe, LA,
51
1
USA
LOE-5
West Monroe,
54
1
LA, USA
LOE-6
Earle, AR, USA
48
1

SEQUENOM® analysis is based on multiplex PCR and MALDI-TOF mass spectrometry. The SEQUENOM® analysis was used to evaluate the 186 loci using 425 individual samples (5 panels with 36-38 SNPs in each panel). Primer design for each SNP marker was based on a requirement that elongation primers be located in a non-polymorphic region 15 base pairs before or after the SNP of interest. All the genome calls were performed blinded (i.e., the sample origin and dog treatment history was not known during the analysis). A total of 79050 genotypes were analyzed. From the 186 potential loci, 109 were observed to have technical advantages to predict for ML loss of efficacy. The susceptible population carried more than 90% of the wild-type genotype while the LOE population had a significant lower genotype frequency of the wild-type genotype. These 109 loci are disclosed herein as SEQ ID NOs: 1-109.

Example 4—Additional SNPs from Confirmed Resistant Organisms

LOE samples, as described in Example 1, were presumed to be resistant to MLs because of the history of treatment of the dogs with MLs and the continued presence of heartworm organisms. However, despite the history of treatment, an alternative explanation to true ML-resistance of the parasites is owner non-compliance of ML treatment. Therefore, a study was performed under controlled ML treatment conditions, to eliminate the possibility of owner non-compliance in ML treatment, as a possible reason for presence of heartworm organisms in dogs.

Heartworm organisms used in the efficacy studies were derived from one identified as Jd2009 from Earle, Ark., USA. Jd2009 received monthly MO in 2004 and 2005, IVM/pyrantel in 2006 and 2007, and IVM/praziquantel/pyrantel in January 2008 until early July 2008. Jd2009 tested negative for HW antigen in 2005, 2006, and 2007. This dog was heartworm antigen positive and microfilaremic on Apr. 11, 2008 despite a history of compliance with HW preventatives. Mf were obtained from the dog at this time with the consent of the owner and were sent to Auburn University, where the mf were examined for sensitivity to IVM in an in vitro concentration-response assay measuring migration (Blagburn, B., American Heartworm Society-13th Triennial State of the Heartworm Symposium, 2010). These mf were significantly less sensitive to IVM than mf obtained from a dog infected with a laboratory strain of D. immitis that was fully susceptible to the drug. The mf were used at Auburn University to infect mosquitoes to produce L3 that were used to infect dog Jd2009-1, which developed a patent infection. Mf from this dog were shown to be as resistant to ML as mf from Jd2009 in the in vitro migration assay.

L3s derived from mf harvested from Jd2009-1 were used at Auburn University to infect a second dog, Jd2009-2 and the dog was treated monthly with HEARTGARD PLUS® (0.006-0.013 mg/kg IVM) 9 consecutive times. Adult worms were recovered indicating that the Jd2009-2 isolate was resistant to IVM prophylaxis. In a second study, dogs were challenged with Jd2009-2 L3 on day 0 and treated monthly for 5 consecutive months with HEARTGARD PLUS® (0.007-0.009 mg/kg IVM; Study 1b). At necropsy on day 188, efficacy was 71.3%, confirming resistance to IVM prophylaxis in the Jd2009-2 isolate.

In another study, dogs were challenged with L3 on day 180 after PROHEART6® injection. At necropsy on day 150 after infection, efficacy was 21.6%, indicating that the Jd2009-2 was also resistant to the PROHEART6® long acting formulation of MOX, which has a claim for 100% protection for 180 days after treatment.

In another study, the confirmed IVM-resistant isolate Jd2009-2 was used to determine whether the resistance extended to other ML heartworm preventatives. None of the other ML heartworm preventatives (MOX, MO and SEL), given as monthly chemoprophylaxis as recommended, was fully effective, i.e., at least one dog in groups of four to six dogs on these heartworm preventatives became infected with D. immitis following treatment with each of these MLs used as recommended.

DNA from individual organisms from two Jd2009 isolates were used. DNA from individuals from one group, called RES-1, came from 4 dogs from the PROHEART6® study, described above. DNA from individuals from another group, called RES-2, came from 6 dogs from the HEARTGARD PLUS® study, described above.

DNA was isolated from 115 adult worms and 79 mf from the RES-1 and RES-2 populations, as described in Example 2, and were analyzed using SEQUENOM® SNP frequency analysis, as described in Example 3. From this analysis, 18 additional loci (out of the initial 186 loci) were significantly different between the susceptible and RES samples. These loci are disclosed herein as SEQ ID NOs: 110-127.

While example compositions, methods, and so on have been illustrated by description, and while the descriptions are in considerable detail, it is not the intention of the applicants to restrict or in any way limit the scope of the application. It is, of course, not possible to describe every conceivable combination of components or methodologies for purposes of describing the compositions, methods, and so on described herein. Additional advantages and modifications will readily appear to those skilled in the art. Therefore, the disclosure is not limited to the specific details, the representative apparatus, and illustrative examples shown and described. Thus, this application is intended to embrace alterations, modifications, and variations that fall within the scope of the application. Furthermore, the preceding description is not meant to limit the scope of the invention. Rather, the scope of the invention is to be determined by the appended claims and their equivalents.

<160> NUMBER OF SEQ ID NOS: 127

<210> SEQ ID NO: 1

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 1

aacataaaca tattgaactg aatcctgcaa acagttctct tataacgtga accataacta 60

aatttagaga aaatatgaaa aagaaaaata agttgctttt gctcgtgcac caactctaat 120

acccaggaaa tcaagaagtg ataatgagta atgtcatcat tagattcagt aattggtgac 180

actatcaata ttattattat tatacttaaa aatacgacga ccacttatcg taacttaaag 240

catgcataat acgactgtca tcatattaca tttcttcaag ttcgtattgg acaagtgatt 300

<210> SEQ ID NO: 2

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 2

gacaagcgtt gacgggagag acgatataat aataaagaag gcattgggta tcagaaggca 60

caatccaatt ataaatgcca aggcaaaatg aataaaattt atgctgacga tttgatcaat 120

tacgaagaat ttccgatcgg ctcgaatctt tgtttgtatg tgcactactg ttaacttaat 180

ctttgtttta tatacttttg cgtgtcatat ataatatatt catgtcaact gatacgttat 240

gatgtttttt tgtaaattaa gttgatcgga aacctgaagt ctatttcaaa tttaagaaat 300

<210> SEQ ID NO: 3

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 3

ttttaggaaa atggtgactg tagagagata ttatcggaac gacaaggtcc acttcgaacg 60

ggtcttttat tgtcgacgga ttgtgaacca agttttggca ttcataatga caggtagcta 120

tttttccatc atcccatttt tgtattagtg caagcaagtc atgagtcgaa agaaaatctc 180

aaaagaaaaa aatgaaattt caggttcaaa ggactgcgtc cattattcgc actggttgat 240

gagaacgtac agattccaga gcggcaatgc tgcacagtat cttttgtttc acttctgaat 300

<210> SEQ ID NO: 4

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 4

tcgattaaaa attatcatcg ataaaattct aaaatttatt ttagtaaaat tattattatt 60

ttgatgaata agttaacaaa aaaattttaa taactttttg attcgccaaa aatctaattc 120

gttaaaaagt cgttccaaac agatatcgct tgttcgatga aaatgtccgg ttgttagaaa 180

atcataaatt ggttcaaata attttccaga acgttcgaaa aaatattccc ttgtatcgga 240

taaataacca ttacaatttt ccactcgtgt tgcatgtgtt tctcgacaaa aatcagctaa 300

<210> SEQ ID NO: 5

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 5

tcaacagaaa tcgagattcc aaaaagtttc ctacaaatac ttaattatca atggatattt 60

agttttgtta tctgttatca taagttctgc ttcttacacg attaaaaatg tccaagaatt 120

ttttactatt caaatgaggg aaataaaaaa ccaatgccaa taatatccag aaactacata 180

catctttctt ttttcgaagc tcatctattc cggccgaaaa caatgaagaa cattaaaatt 240

cttaaaagat agtcttagcc ttttccttga ccactatctt aactgtcagc gctaaaatgt 300

<210> SEQ ID NO: 6

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 6

aatagtcgtc tcattacttt ttgactttta taattcgaga atcttatgta gtccttcact 60

ttacccttct tctgtcgaac taagaattac agcattattt tcgaatttaa tgtgtaaaag 120

acaatagcag attttgtaat tttgtgttaa cctcacttta tatttcgctt catatcgtga 180

cagagaatta ctatttcaga gagtattact tgtcaccaga gaatctccag aaagattttt 240

atttacgtcg gaaaatggac aaaaatggtt tcttatcatt agcactgata gctagtttcc 300

<210> SEQ ID NO: 7

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 7

tatctcttgt tgtgtgttct gcattgtatc aaagtgggta aattttgctt tagacgttga 60

cttattgtct tttttaagtt atattctagt ccatgttttt ctctttgcaa atattttttt 120

ccgccgccta tgattcattg ttttgtttgt aactctctat taagttgctt ttagtttgaa 180

ttgtatcaaa atttcaaaca tttaaaatac gcactagcac tattttttct tatctcaatt 240

aagcgaatcc cggaacaaga tttaatcgat ttccgaatca caattaaatc actggaaaac 300

<210> SEQ ID NO: 8

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 8

attttcctta acaaatcatt ttcaaacgaa aaaacattaa aaagtgttaa aataaaatgg 60

tgatattgat aagaaattaa ttcaacctgc atatcaattc ttgtagcggc cattttctta 120

gcaagttcta tagcagctcg atccatatca ccttcttgct ctaatgtcaa ttccggttcc 180

ggaatttttt ttattttgcc attcttcatc ttttttttat tttttactga tatagctata 240

gaccctttct cccgtgcatg cctgtaggcc tgttctgata tacaggcttg tgaaccactg 300

<210> SEQ ID NO: 9

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 9

ttctggggta gttatacgga aaattagaca atgaagagaa tcaaaaaaca tgcgattttc 60

aaacagagga actttggtac ttttgcctcg acttacttta ttttaaaacc catacaaaat 120

aaatgtttca tttgattgat attgtcgtac taataattag agcttcaaca ttaggatttt 180

aataaccttc aatttatttc agaatttaag aaacttacgt atggatggag aaaatataaa 240

gaatggcgat gacaaataag atttgctatg aaaaaactaa tgccacaaga tccgaatgca 300

<210> SEQ ID NO: 10

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 10

tttatgaaca aaaataataa aaattaggat aacagatatc aatttctttt agctataaat 60

atacgcttcg attgaaaaaa gctttcaaat tataattaag gcatacgtta cgatatagac 120

aattaagtcg acattaatta tttgaaatat tttaaatttt tttctctttc tttttttcta 180

ttctcttcca aagtgtcaaa tagttatgaa attgtcagaa gctaaaatga taatattatt 240

caagtttatt acctaatctt ttatcacctc atttcttatc atttatctga aaatctaatc 300

<210> SEQ ID NO: 11

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 11

atgttgaatt tttaatgaaa ctttttcggt gcataagcat tacagatctg taagctgtgc 60

aaaccctgtt tctttgtaaa ttgaaacaaa gatcatttat tgtttccagc gtcgatttga 120

cctggataaa tgtggtacca aaagtagatg acgagaggta agtgcaaaca aaatgcacaa 180

aaatgatttt gatgcactca aatcattttt aagttttgtg caattttcca ttttatagtt 240

tcgtgatcgg ttgttattca tcaacttgat tttgtttgtt ttttgtgact tatatttcat 300

<210> SEQ ID NO: 12

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 12

tttgacactt tcagatacct tacaaactca tctccagcac ccaatttaca atatcgctgc 60

ctaaataaag aatttattcg gatatgagac tgtagttttc attccgtacc aatcatagta 120

gaacagatct atagcatggt gtcctactaa agttgtgact ggctattaag tatgtgggtg 180

tttttacgtg tgcgtgggtg tttgtgcgtg tgtgcgtgtg cgtttctgca catattttcg 240

tgcgcggtgt ctgtgtgtgt ccgtttgtat atgccgagtg tagctgtgtg tatgttcttg 300

<210> SEQ ID NO: 13

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 13

cactcataat atacctgtca acaaactcag aaatctgaat aaaatgacgc aaaaatgaca 60

aaaacatttt atcaaccttt tcttcatcac tcccccgcat ttccaatttt cttccaaact 120

gtttttgtcg tgctacaaag tcatcagcca cttcattttc ttcaagatgg ttcgagacgc 180

cattcttgga ttcacccctt atttcaactg tttccgaagt cccagcagtt gaagctgaac 240

ctagcattta tatcaccacc cgatgtcaaa aaatgacagc ggtcagagaa tacgacttcc 300

<210> SEQ ID NO: 14

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 14

gctaggtcaa cagttggttt atttggactt atacgatatt aaacataata tcgcctcata 60

tacacagaaa tatcaaaaaa acgaacacag ctaaatcgaa gaatacgaac aaatgtttta 120

aaaattatat taaatctttt aatgctctct acaatgtcgt atcttccctt ttgtctgtat 180

ttctcctttc gttccaccac tgctatttct catgcctttg aactatggtt ctcgttgcgt 240

cgaattgtcc tcgaaactgt tgtttctgtc gaattacgtc gaactgctgg actttgtcgg 300

<210> SEQ ID NO: 15

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 15

atatctcact tctgacataa attgaagtgg cactgatttg aatgaaatga taaataaaat 60

aaagacgaca aggtagtgga aaaaaaaaga ggagaaaaca ccgtttagtt ttggatgcaa 120

gctcgaatct gagttttctt gcaaaccgta cactgatcaa ttttcttaca caaacataag 180

aaaaaaagaa gtgattttac tgtagctgta tcgtataatt caaatcatat atatatatgt 240

ttcaataatc tatacattta tgtatatttt tttttgaatg gaacagtgaa tgattttaaa 300

<210> SEQ ID NO: 16

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 16

acaaatgcca tcgggagaga aatatcgttg gcgtactgat cacattggcg gtatcacttc 60

tttgaaaact ccagctggta ttgtgtatca tttcatgcaa tacgctattt ttgatcgaat 120

atgtcgacgg cgtagtgttt cattttccaa cgcatcttac gttgcgtgta tggatgatga 180

cggacaatta ttggaatatc aaacaccgga tcgattgcat tccgtaacct tgaaacgtga 240

catatatggg agagtagtgc aaataacttc agatggcgaa aatattttct tcgaatatgg 300

<210> SEQ ID NO: 17

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 17

ataatatata tttccattga taatattttt catattatgt gatgtttgaa attttctgca 60

attgctacat tccgattaaa aacttttatt atccgtactg gagaattttg cttttttttg 120

acggtttgtt caataagttg tcaatatatt gtctgcctta gtaaaacctt tctaatctat 180

ccgttcgaat tggaagttga aagttcagca tcattctttt agtgaggtgt ttaagttgtt 240

caatagatat tatttagaac gatctcaatt aaaatcttct gaatgatttt atgtttttat 300

<210> SEQ ID NO: 18

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 18

gcagcacatt gcacacagta aactgcaaac tgaattaaga gatattgggt tgaattattt 60

ctaatttaaa aggatataat aaatgacttt gatgattgtt gattttaagg tatctcggaa 120

gactccatca gtctcagtgc tctagcaatc gctataggta ctaaaagaaa agaaaagatg 180

tctcgttatt cactttgaaa tgtacatatc aaatcatttt gtcgtatgaa attaagtata 240

ttatgtctaa tcgtatcatt cgaaatgaat ttactgtcac tgttagaact atttaggcag 300

<210> SEQ ID NO: 19

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 19

agagttcaat cgccaagttg ttctttttct cgctcgcaga gatcaaaacg gtgttggcta 60

tacactcatt catcaggctg tgatagacat ctcttagaat ttcagtgctt ttctggatga 120

aaacattatt tctcaaacat gacacttaag gacaatagtg cgtgacttct ttgttaacgt 180

acacgagaaa acaaaacaga tgatgcttgt tatcttggtg ataaatgtgt attcagaata 240

atgttatata tctttgcgtg acaaatatca tttcgttata cttcggatac gcctttttat 300

<210> SEQ ID NO: 20

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 20

aactttactt gaactttttt ggtgttcaat tttgaatatt ataccaacca ttcagaagac 60

tgtatataga aatgaacctt caagaattaa tcgaaatttt tattaaaatc ttttatttga 120

atatttcatt atttaaactc attactattt gcagtatatt attagatcta atgtagaaaa 180

aaaaatcaga tggcaaaaat aatatcatag gtttgttttt aaaattcatt gcaaaattca 240

gtgcgccgtt ccagtcgctc gtaattaccc tatccctgag ctttacaaaa agaatgcttt 300

<210> SEQ ID NO: 21

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 21

aggtatctag atagcataat aaattactac acaaaccgat ggaaacgcaa gtttggcgtt 60

gcgtgttgat acaaaatatt agagccaagg atggtatcac atgtaaaact gcaattttgc 120

tatttgttta aagcaaataa gaaataaata tttcgttctt attctttaat ttatttcatc 180

agatggcttt gttataccat aattgtaaat ctgtcatatc ttaattgcgc aatagcccaa 240

gattcttgta tattcttaca tttcacaatt tattttctta tttctagttt tagaattata 300

<210> SEQ ID NO: 22

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 22

aatagctact cacagcttaa gttaactaat ggattcttga atttatttaa gcgtgtagtt 60

aagcgattaa tatgatggat gcccagaatc gctttgtctt atagttttgt ctcgacagaa 120

aggatgcatt gttgtcttga atttgttcaa gggaaaatta aataggtttc tttcaatgac 180

tcctattaaa tttttttgaa tttaggcttg cattgcgtgt tctgatccac tattagcacg 240

tacgggtatc gcagtgccat gtgatgcagc actatgcaaa aaccacctcc atgtcacttg 300

<210> SEQ ID NO: 23

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 23

tctgttgtaa gtttcacaat ccagttaatt taagctcagc ttatttgaaa ttttcaacaa 60

aattacgaaa attactttct cggttcattt ttttcaacca ccaaatattt agcataattg 120

gcctgaaatc gtcaaagttt acaaactttt gttcagcaat cttctcttac tcttacaata 180

aacatgatta acttgtcgtc ataccaatct cgtttatagc aaattctttt caaaaaaaca 240

ttgctacaaa ttttatatcg catcatttca acacgcataa ttatttttca tatatgaaaa 300

<210> SEQ ID NO: 24

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 24

ttcacaatcc agttaattta agctcagctt atttgaaatt ttcaacaaaa ttacgaaaat 60

tactttctcg gttcattttt ttcaaccacc aaatatttag cataattggc ctgaaatcgt 120

caaagtttac aaacttttat tcagcaatct cctcttactc ttacaataaa catgattaac 180

ttgtcgtcat accaatctcg tttatagcaa attcttttca aaaaaacatt gctacaaatt 240

ttatatcgca tcatttcaac acgcataatt atttttcata tatgaaaaac catattataa 300

<210> SEQ ID NO: 25

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 25

attaactctg aacccaaaga ctgttggtta aaataaagat ctattttagt tatacatcta 60

acattaaagg ttttcgtacg gaaacaagta ggtttgataa ttttcatgta actgtaaaga 120

acacctgtga aagggatcag taaaatttgg gggatgtagc acggaaatat gaagctgagt 180

gttttgtacc caaaagtttt tcaaatctgc gaaataacga gaggtgtaat gatcgttttt 240

aaccaaattt tttgattcta atccttccca cagttttgaa attcagtaag catttctttt 300

<210> SEQ ID NO: 26

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 26

ttgcaacaaa tcaataataa aagacttgcg gctaacaata tatttgattc ttttttaccg 60

ttattattat gacaggtaat aatagtatta caagcatatt tgtaggtgtc aattttttca 120

attcaaattt tcttaattca ttatttcttc ctttccttaa taaatagtct ttccatttaa 180

gaattaactt tttgaaatct ttaatgagaa gacacaaaag attccggata attttgcatc 240

atcttttcta tttcgcgtta gtattttatg ttttcaacag atttttatga tttaactata 300

<210> SEQ ID NO: 27

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 27

gataaaatgg gttcttgtca agctcatttg gcatatcttc gtcttctata tttatatcct 60

ttaatatctt ctcttttttc aaattttcct tcccgacgtt ttccatatcg acctctttct 120

tcataaattt atcttcctca tttgcctcat tttttgactt ttcatccgtt tcatccttat 180

ttttcttttt ttcatctcct attttacctt ttcctttatc aacttctatc ttaactttct 240

caatgttttt tttattttct ttcatctttt tgttttcttc tattgacata ctataacaaa 300

<210> SEQ ID NO: 28

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 28

ttttacgaac aattatttca taaaagattc gtatttttga ttagttttta agaatttttt 60

tttattattt ttagccaaca aatatatttt tcaaaattgt taaatttgaa attataaatt 120

tcaactaaaa aaaagcaaaa agctaagcca atagaaataa catacatgtg taatataaaa 180

tataaagtat tcgaaatgaa aatcaaagtt tcataacaaa aaacaaaaaa tattctaacc 240

ttttagattt catcaaaact tcactaaaaa gttaaattta aattttcaaa ttgttataca 300

<210> SEQ ID NO: 29

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 29

cgaacaatta tttcataaaa gattcgtatt tttgattagt ttttaagaat ttttttttat 60

tatttttagc caacaaatat atttttcaaa attgttaaat ttgaaattat aaatttcaac 120

taaaaaaaag caaaaagcta agccattaga gataacatac atgtgtaata taaaatataa 180

agtattcgaa atgaaaatca aagtttcata acaaaaaaca aaaaatattc taacctttta 240

gatttcatca aaacttcact aaaaagttaa atttaaattt tcaaattgtt atacaatgat 300

<210> SEQ ID NO: 30

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 30

tcaaagacaa aatgaagaac ttaacaaaaa aaaggccaat aaataaaggc tatttcgtga 60

aaaatctaaa aaaaaaaaga tctgttcctt tcgaatcaag tgattcttcc tactacattc 120

gtgttgtaat tcttacttgt atacagtccc cagtttttcg acgataaaaa acatttcgat 180

aagtgagttt gaattaattg aattttaaaa gatcataaaa ataaaatcaa aataaaaaga 240

ccaaaattaa gtctgataat tccagaaaac acaataataa atatacaaat aataaaaact 300

<210> SEQ ID NO: 31

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 31

aaataattca ctaatttctc atcatcaaat tatttcgtac aatcgataaa tcaacgatta 60

taatagcgaa gagaatgaaa attaatgtgg tgcacagtat acggacccca tatacaatgt 120

tcaacagaga tgaacatttt ttttctatta aagttttctg ttcggcgaaa gaaagacact 180

ttctaacgat gctttcctcc caactcccct tgcaatgata gaggatgcag ccaagattcg 240

tcgactcaag cagcatcact caaccggcca tcacttcggg acctttttcc ctgcctttta 300

<210> SEQ ID NO: 32

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 32

cattgcgaat gaccgctatg gaatatcaat tagcagatat taatcgtgaa ttaagcacat 60

tggtggaatt tttacgacca aatcgaattt caaaaaatgc tacacttgca acatcagcaa 120

ccattgcaac atataacagt acttcgatgc gtaatgtaaa aaagaaatgt aatgcatctg 180

aaagctgaaa attcatctga tatattgaag caaaaggtaa gattattttt aagatatcat 240

tcttgatgct ctcataattt ctacatcaaa tttaatcaaa cgattcattt atgttcattt 300

<210> SEQ ID NO: 33

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 33

ttcttgttgt acctatcata gatgataact taagtaccaa tagcaatagt gcaacgatgc 60

aaggattctg attaatgatt ataaaagttt aaccaatctt cttcattcct tctaatcaag 120

agaaaaaaaa atgagaacat ttttatgaca tttgaagaaa ggcaatttat cgctgaaaat 180

tctactgcga tatggaagta tcagatagag aaaataaata ttaaaatatg gatttcatac 240

gaaaaatgat aaaagataat aatttacatt ttggtgcttt actgatatga ttggagtatt 300

<210> SEQ ID NO: 34

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 34

cgatattttt tggacgaatc aaaccttttt gggaaatcat ttgatgtcac aagcatggtt 60

tgagaaattt ttttccgaat tagttctgct aaaaatactc caaatgagtc tagtggaatt 120

aagctaagca ccttaagtaa gttgagaaaa acgtttccat ttgactaaca aggctagtat 180

atcgacatga gacagaaatg gttattactt cactcacttc atgaagcgaa tacgaaatat 240

ctgttcactt tagtttcaat ctactatttt accaataaac gtgttctttt ccggataaat 300

<210> SEQ ID NO: 35

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 35

tcttaattga ttttcttaac tcgaaacact tgtcttgatt actgtgctgt actttatctt 60

attaaattaa ataatttcca tgaccacttc ataccattga ccatcaaact ttgatgaagt 120

ttatgtgtga agtgccaaac aatcattcat cccttcagtt taacttattg ctggtcaaat 180

tcataaaaat gcaaattatc aagcagatag taattcagtg aacgtagcgt attctcgaaa 240

tttctttcct tgtatttacc ttatatagaa caacgtatat ttgtagcata tattcaatat 300

<210> SEQ ID NO: 36

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 36

tttctgagtt tgcgttacag cgccaaatct tcacggagat agataaaata cttatcgtga 60

aattttggcg ccatgattta aaaaacacgg agataaaaat aaaatgctta tcggtgataa 120

tttagcgcca taatatgaat gaattgaaaa aacaatttga gtagaaacat gacatagagt 180

tttcgttttc tggctacgaa aatggatgaa tttttctgga atcgaattca gtcaaagaaa 240

taggaacgtt gttactaaat gatcgaaaag ctttctaaaa ttaaatttat gacgtctaag 300

<210> SEQ ID NO: 37

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 37

atctaaatct tcgttttata gtggtaagac ttccatttgc tgcattcttg caaattaagc 60

tgttgaaaat actttttttt ttgatagatt tccaatttaa tcatattata agaagaatta 120

atttcgaata gaatttttaa atcatttaaa ctttaagttt taaaactaat ataagttatg 180

cagatttcgc gaaaaagtct catttgttaa ttcaattatt ccaaaatgta ataattttat 240

aaattcaaat ttaaactact actaacttct gaagtcagga gccagtagca acaacgtaat 300

<210> SEQ ID NO: 38

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 38

aactttacat ttatattcaa ttttttttta ttttgtttgt ttttagaaat ttgaaaatgg 60

gtactaatca gtgtcatttg cagcctctta gaccctcttt ataacgaccg attcgatgaa 120

atacgtcatc aatatgccag tttattgttc gggtggagaa tgttttcaaa agttgctgaa 180

gtgatgaagt atagtgagaa tgcaccttat tcagcaccat taagaagtaa atttttgctt 240

tggaatttga caaagacaaa gcaggaagtt gacaacgatg ttctgatgaa acggtttcga 300

<210> SEQ ID NO: 39

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 39

gtctattttg gctgtcttct aataattcat tttgtaacct tttgaaatat gataaatgta 60

gaaatttttt cttcctggtc tataatagtt taataatgtg ttgtagtaat agttttggtg 120

ccgttgaaat atttcaatga tatgctatcg caaaattagg aattcaaatc aaggttacaa 180

gataattcaa aaacaaacaa cgtaaaaatg aaataatttc ttcttcttac ttaccaacag 240

gcatatcatc atcatcctca aattcatgac tatatttaac attgtcatat ttgaataatc 300

<210> SEQ ID NO: 40

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 40

cgacgcaaaa atctttcaaa ttgtcaccca gttctctaag tgattccaat gatgttggta 60

aacattctgc atgatgtacc gggtaatgaa ctaccaagtt gttttttgct tttaatacaa 120

ctcgcaaaga ttctgaaaac catgaaatta agaaagatta aaataatctg aactcttttt 180

ttcatttttc cttgaactta gcaatatact gagttggata aaatttagaa acgaaatttc 240

gcaaatttat tcagtaaatt caggaaaact cggtttcggt attctaaata taaatagata 300

<210> SEQ ID NO: 41

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 41

gtttctttgg tttatctcag taagatttgg gcggaaattt cagttatact tttcatttcc 60

atgtgctgtt ttaaatttct tccatattag tataattttc aaataattgt agcgtcactg 120

gtttatttaa ggataacagg ttggactgca gtggctgaga agtgtcttgc cggtcaattg 180

tttgttggtg atcaacttgt acgagttact gatatcgaca tatataatac acggcaaatt 240

ccattcgttt tcagtactgc atcaaaaacg ggattatcgg tactttgtaa atcgcagtat 300

<210> SEQ ID NO: 42

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 42

gacccctgct cacaaggcag ttcccacaga caatcacaca tctaatcaca cacatcaact 60

catccgacgt aggctatcaa taaggaaaat tgcattgctt tatcgtctaa ctgtaataaa 120

catctacata atgaaattat ttcgccacta tgacaactaa tatcgcccaa tgcaaatatt 180

tgtctcagag ttattccctt ttaacagctg ttgaacgaat agataggacg tcatgtggat 240

gatctacttg tttcaaaggt tgaggtaaca catgaaacac atgaaaacgg taatttaaaa 300

<210> SEQ ID NO: 43

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 43

aaagaatggt cagcaagatg tggaaaatcg attactatag ttgaagtatg aatcgaagag 60

gtttttttaa attctaagag aacgaataat cggcaaagag aaagttgagt aaccttattt 120

tgccttgttt tcagtcaatt tataatatgc ggttaattgt gttaaagaaa gtacaaggta 180

tgaaatctaa gccaagaaat aagagaaaac agctaatgat tatttctgca ttttttcttt 240

ttcgacacaa acttggaacc agaatcaatt gaactagtaa tcagattttg attattgctt 300

<210> SEQ ID NO: 44

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 44

ttagattttg ctgaagcatt gttggttaga tcgatgaaaa tataattatg agagattttg 60

ttgaaattca gcaacaaaat tattattcat gtcttcatgc tgtcagtttt gtttttattt 120

cttctttgac atcggttata tttttgtctt ccaacaatat aaaaaaaaaa ttataatcaa 180

ttggtaatca aattaaaact ctaattgtta gctccctaaa tcagctttaa aaaaataatt 240

gcttaattgg tatttgctac tattagcaaa ctgaaactat ccttttctcg aatggtgaac 300

<210> SEQ ID NO: 45

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 45

atgagctgat atttgatatg catattaaaa atagggtaaa ttacattaag ttagatatcg 60

ttcggataaa ttaattagaa aaaatgttta ccaattagat cgcaatgatg taaaatttca 120

cgtattttta ttcttaagat ttatttgcaa aattcaaaaa tatgtcttat gaaaaataat 180

atttctgtgt aagaacaagg gaccgattca cttgatttat tcgcaaacaa tcgaaattca 240

aaattagtaa ttttaaatat tgctttattc aaaccatacc aataataatt tgagagattt 300

<210> SEQ ID NO: 46

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 46

attgattgat tcaaataaga aatttaaatt atttcccctt tttttcaaaa gatttaacaa 60

atattattta tttgatctcc tcgttcgttc ttatcttttt gattatcaat ccatcctcct 120

ccatcatata gctaatttat tttttgcatc gtaaatcaat tgatgtatga ttgatttctt 180

gattataaaa agttagaaga attgaattgc ttaaatttaa ttattgataa tgaaatatta 240

ttatatttca aaatgatacg aagaaatatg acgatgataa gagaaaatat gatatttatc 300

<210> SEQ ID NO: 47

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 47

tacgataagt tattttattt tacacatctc catccttgac tagtgtccgt gccgactgtc 60

ggacttgaac cgacaaccta ctaattacaa gtcagttgct ctacccaatt gagctaagcc 120

ggccatctag aatgtgcgac cccgtcgtgg tacatcttct ataatcgttt ggtattcagg 180

actctcttct ttcgtgggtg gaggatcttg atacagttga ctattaaaaa tagggccttt 240

gttagtctgt tacaactcat agacaaaggc gacaatttta gcttacatct tacgttatgc 300

<210> SEQ ID NO: 48

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 48

atggtagaaa attatatgaa aaaatatcat actaaaaata taacagattg ttataaggta 60

tggtttaaga atttacaaca attgattatt tatgataaaa aaaaaaaaag taaatcagtg 120

aatcattaag atagttatga taagcagttt gtattcggta aagcgaatga ttagaggaat 180

tatgggacga aacgtctata acctattctc aaacttttaa tgagtatgac gtgtcttgct 240

tgcttaaaat tatttcaatg atcatttcac tttaccagta tgatcatgat tagacttgaa 300

<210> SEQ ID NO: 49

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 49

ttagtatcga tattatcaca aatgatatca ctttcatcaa tactggatac gattttatta 60

gtatcataat tttgtggctc gcattccgaa agttttacac gtagaagatt aacctgcaat 120

atgatttatt ttatcatttt cgaatatcca actttgaaat aattcgaaaa tgttgaaaaa 180

ttttgaaaaa ttgttaacaa aatattacaa aaatatcaaa tgaaattaaa taactgtcca 240

tttcaaaaaa agaagaaaaa ttatgaaatt accaattaaa aacaggactt attaattaaa 300

<210> SEQ ID NO: 50

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 50

tgtggaaata aagtacaatt aattgctgtt cgcttaataa tattattttc attcttggct 60

ttttttttct ttccccgtga tattataaaa tatagttttt taattttaac aaatcgtcat 120

aattatttaa aaaatactga ggtgagtaaa tgtaattggt tgctggaaaa aaagtgggtg 180

atgagaggtg aatgaaagca gaatagttta tgattgcatc aaatttcctc cttaatctgt 240

gattaaaatc aaacaaaacc cgaaaagttt cttcttcgcc tttttcttct ctttgtttca 300

<210> SEQ ID NO: 51

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 51

cgaaatccgc cgcgtgcatt actttgcgct tgttgattac gacgcatttg ttcgtcgttg 60

ataaccttat caatcatcat acgtccgtta cgtatgcaat caacatcgcc agttaggctg 120

aaatcaaatg gatggcgatg atatcaaaaa caaaaataag gagtatttgc tgaatcattt 180

ctttttctgt attattatca aaattttctc ctttccattg tttccttctt aatcaagtga 240

atgctcattt cattttgaaa taatccaacg taataattcc ccatattccc aattactttc 300

<210> SEQ ID NO: 52

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 52

agaaatatta aactttgaaa agatgtgaca tgttctgtaa caaaagccca aaatttcgac 60

tgctgcggct tgaagtaaaa ttttggaata tgctacatca gtagtgcaac agatggttcg 120

ataaatagtg gtaagtgatg ggaatcctag gaatagatgg gaattgtatt tcagatataa 180

atttgatgca tattttcata gttgattata tctacgatca cacgttgaat attctaaaag 240

caaactgtaa ttaactaatt gaatttgaaa atttccaaga attaaaattg gtaacaaaaa 300

<210> SEQ ID NO: 53

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 53

attgtcagga atgagaagca agttttggat acttaaggga tgaatggaac acatacatgg 60

cagaaaatgt tagtaatcaa accatttaaa ttacttagcc actatgctaa actttctaga 120

agtatggttg aacgtttaaa aaccttcgca aaaattgtat tagattatct taatcttccc 180

tacatcaaaa cagagaattt ttgttctacg acgtgagtct gcatgtatta aggaagttcg 240

tatcatgacg taaatatcct gagtgattat tgaattcaga aaatgagctt tttcatttgg 300

<210> SEQ ID NO: 54

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 54

atatgagtgt tacatgtgta cgttacatgt aaatattata tgttatatgt aaaaatgtca 60

tgtatagcat ctattcacgt gtacgtacac gtgtatatac atatacattg atacttaata 120

cgtatacgca tgaatgaaca gatattatat atttacgtac actagactca catgtacctc 180

tgtatacgca tacatgtaca gatatatgtt tgacatacgt aaattcatat atgcttttat 240

ttatgcttat attaattgtc acatacatgc cttatatttt cgttgttata aacacataaa 300

<210> SEQ ID NO: 55

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 55

gaaaataaaa ttagctgaaa atatatgcga ggtaaagcac acagaagaat taacttaagg 60

taatatattg taagaatttt tatattcggc gcacctaata atttttagac cgcatatgcc 120

cagtatttga aactggtagc gctgttcgta cttgctgttg tccatgttat gtatatgata 180

ccattcctaa atacttttgc ggctgtggtt tccagtgttg atgtgactgg tatgatgcct 240

aacactggat ccttccatct gcggcatttt gttgaaattc ttattgatgt gagctgttta 300

<210> SEQ ID NO: 56

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 56

caactgtgaa tcataaacat tacttaaatt aatgaagcta gttaacgaca aatatatttt 60

tttatgtatc agtgctatca tataacataa aaacttactt tcattaataa atgagctcaa 120

atattgactt ttgtccaaaa tgctcaaaat gtcgtcataa tatttgaaat gaagataatt 180

tcacgctttt cgaagcctcc tctcacgtct tttaatcttc ttttcttctt cttgctctaa 240

tggttctgcg aaaaaccacg gtgcaataat cactttccat aatttataca gtacataagc 300

<210> SEQ ID NO: 57

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 57

ctgcttaact cttttcattt ttcagagaat cttctctaaa attgtgaatt gatccaaacc 60

aaagaatatg gataatgtga ttcgaattcc tggaatttag attttgagag ttttgaagtt 120

tttaaagaga ttgaatttct gtgaccttct ggtatatttg atgtcatttc gggatgcgta 180

tttttgccga aaatttttgg cctcactgca atcttgttaa aagtcaaaaa aattcaatcg 240

tagaatttcg ggtttacctg atattactgg aaatctctga tctttgttct agattgctgt 300

<210> SEQ ID NO: 58

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 58

ataaagaatt tgcaactctg tatacctttt tgcagtgcaa aagcggatga attcttcact 60

gcagtgtgac agattccttt gataaaattg cttcgttctt atgtaaactt ggaaattctc 120

ggtagttatg cttttgctag ttgaaaatgt tctgctcttg taaaacatgc aaaaagagat 180

tatctttgtt ctattatgga aagattcttt tgaaattttg acgactgaga agacaaattt 240

tatcccaact tgtcatctgc aataaaaatt tttcctgacc tgtttcttaa ccttccaagt 300

<210> SEQ ID NO: 59

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 59

aaaatcaaat caatatgatc agataactca tacttatctt actgaaaatt cctcattcaa 60

gggaaataaa taattgcaat tcttgattcc gatcatggat gattttcaag caaattacca 120

atgatatcta tcgataacga ttacagcata cagctataac ttattattga ttgaattgat 180

gaaaataatt ttaccagaaa tttatcaatg tttatctcat tgcagtatac gatgtttagt 240

gtgacaacac tttttcttgg aataattgtg cataaatcat tgattgcatt tagtattgga 300

<210> SEQ ID NO: 60

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 60

tcctgcccac attctttcta ctttagataa tcaacaggag ttagttgaaa gagaagacta 60

ggaacagttg caacttctga atctttctga ctttctttcg ttttgtaaat tatttatttg 120

tataaattta aaattcgaag agaaataatc caaggtccaa cttctttttc tgttagttct 180

tgcgaatgct ccatcaaaat gcaaaaatat gattagaatt ctgatggaaa ttaacaaaat 240

cgattagata agaaaagtac aaaacagaaa ctaacttttt ctcccatttt catattatag 300

<210> SEQ ID NO: 61

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 61

tcattgcttt aatacttttt aacgagaatt ttctcgatca aaataagatc tgcaattgat 60

atacgtcaat aagcgaacat tagctgtatt acacgctaat attcacatat gatgaacgtt 120

gtaagcgtca tacatcaaca tatatccatc cgataaataa tgaccactac acattgctac 180

caaccatcct atcccgccac tatttgaaat gaactgagaa ggagttatcg acacaggctt 240

cctagcaacc aaacaaaaga cgagacagat gaatagatag acagacagac gaacatacaa 300

<210> SEQ ID NO: 62

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 62

agattctggt tattattgta tttctgattt atttaatccc aacttaaaga ttcattggct 60

attgtttagc atctatatca attttataaa taaatagtaa tacctgatga aaagcaataa 120

ataattagat gcaaatttta attagataca gtttgatgga aaacattgaa gccatgtaca 180

actaatttat gcatgttgaa ttatgcatgc ataattaatt tatgcatgac agcaagtttg 240

gtataaaatt aattttgtat gaagataaaa ttttataaat aatgataata atgctggtaa 300

<210> SEQ ID NO: 63

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 63

attattgaaa agaataatgt agctaattag ttgaagctgt taaaagtaaa gctaaaaaga 60

tgatggaaat tattcgtata aacattcttt gtaaacaaac agtcatttct gtgaataaac 120

aattataatt ataaacaata cttttcaaga caataaaaaa attaggaagc attgttgtga 180

taatcaatag ttgatagact gtcaatgtat ttttatcagt cgtgctgctt tttttccctt 240

tcttgactca tttattttat tatttattga tagaatgtca atattctagt catttgttat 300

<210> SEQ ID NO: 64

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 64

atcttaactt gctttaaaca aataaattaa aacagcccaa tgttccaaga aaaaaagata 60

agttaaaagt ggggtgtcca aaaatttatg aattgaattg gacagttatt cagatcctga 120

aaatacgctt ctctgatcac tgcaaatatt cccgataaat aagtgaacat taggttaatc 180

ttaattttcc cttaactttc cttagccttt tttaaatttt tggattattc aagcattttt 240

attgcggtat cgtttttgta aaaaaaaaag tataattcaa cattcaggct cgacgttatg 300

<210> SEQ ID NO: 65

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 65

aattaataaa aagaaaggaa tacgataaaa tatctatttt ttgaaactaa tcaaacatat 60

tcctcactgc tcaccggata gttgctttct aattttacat taagaaatat attttttttt 120

ttcaataagg aaagttatgc agactaggag aattctactc tgaagaagag ataagcatgt 180

tagaattatt aaaatctatg gaaatatcct taaaagaatg cctatagtag ctctgatttc 240

gaaaaaaaaa gcaaaaaaca aaataacaaa ttctgctcaa ttgaaataaa aaactttcct 300

<210> SEQ ID NO: 66

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 66

taaaatatct attttttgaa actaatcaaa catattcctc actgctcacc ggatagttgc 60

tttctaattt tacattaaga aatatatttt tttttttcaa taaggaaagt tatgcagact 120

aggagcattc tactctgaag aagagataag tatgttagaa ttattaaaat ctatggaaat 180

atccttaaaa gaatgcctat agtagctctg atttcgaaaa aaaaagcaaa aaacaaaata 240

acaaattctg ctcaattgaa ataaaaaact ttccttcaac ttccagcatc actgctgtga 300

<210> SEQ ID NO: 67

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 67

aactgctaaa aaattgaaac tagtgttaga ttgataagtg ggcagattaa aaccaattgt 60

gttattggcc cgttaattag tgactctgaa tagctatggc gaatcgtata gtgttgtacc 120

gacgacgtat ctatcaaatg tctgccttgt taaatttcga tgatagttta tgtgcctatt 180

atagttgtaa cgagtaacgg agaataaggt ttcgactccg gagagggagc ctgagttgcc 240

acattcaagg aaggaagcag tcgcgaagat tacccactct tagaatgagg aaagagtgac 300

<210> SEQ ID NO: 68

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 68

gaaaactaag aagtaagtga aatttctaag ttctttccca gaaaggttag atccaatatt 60

tgttttcatt ttagcatttt tatccaatga aaaatgtgcc caataaatac ttgtatatag 120

tattgcattt aaaaacttca gaaagcacaa tgagatctaa gctcagaaat atgacgaata 180

ccaatccttt tcctagtctt accgcttctt aacttttgtg tcgctttata aaaattaaaa 240

ataaaaagtt gaacaatggg aattacatca ttttcatctg aatggtttat ttcctattct 300

<210> SEQ ID NO: 69

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (36)..(45)

<223> OTHER INFORMATION: n is a, c, g, or t

<400> SEQENCE: 69

cttccctagc tatgcctttt cgtcacttaa gcttcnnnnn nnnnntctag ctacgtatcg 60

ttatcattta tgcttcttta gctacgtttc tccatcattt atgcttccta agctacgtat 120

cttcatcact tacgcttccc tagctatgtc ctttcgtcac ttaagcttct ttggctgcgt 180

gtcttcatca ttaatcttct ttagctacgt atcgttatca tttacgcttc cttagctacg 240

tctttccatc atttatgctt cccaagctac gtattttcat catttatgct tccttagata 300

<210> SEQ ID NO: 70

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 70

gatcttaaaa ttctatgaaa cttcttctgc atggtattgt ttccaacaga atataatgac 60

aatagcaaca gtattggtta tataaaaata ttgactgcag caggattata tttcaagttc 120

ttttaatttc atttatttat tctttcattt acttttactg tttttatgtt tttcttcttt 180

aaaaaatatg atttctctca ctgttctctt tcatctatct atatttattt gataattgct 240

tatatgataa ctagctaaag ggaaataaac tttcagtcat catagcttca ttttagtaaa 300

<210> SEQ ID NO: 71

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 71

ctatactaat cagtccacta tccattttta ggttgcaaaa gttgcaatga cggtttgatt 60

tcatcctcca atgcaatttt gagtctcaat ctcgagagat agatcgatcg cttttagctt 120

gatttagctt ggttaatgtt gtgagggata ttgggcagaa attctgtcaa gcgttactta 180

atgaaatagt aaatgatcac tgatatttat tgttaatgat acttgagctc tctagattat 240

gaactggaag gttttcgata gaaataatcg atacatatat tagaatcgac ttcttttttc 300

<210> SEQ ID NO: 72

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 72

tcatcttttt cacatttcat ttaatcatca ttttatcaat tcctattttt aaacaaattc 60

ttttcaaata ttctctcttt ccttctcttt ttgttttccg cttattcatt ctaatgatga 120

acagatgtag aaaatttgca ttctattgct cactacaatt ttgagtagaa tatatttaat 180

tatttgattc gagacagatg gttatagcct ttagcttcag cttctcgttc aaattaagta 240

cttgtgacct ttccaagtac cattaaagct ttcctgcgtt tcctaattag aaaaaaaagg 300

<210> SEQ ID NO: 73

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 73

gcattttaag ttaaaagtat cacgctgcat gacacctcac gtttgctatc tcaaattgag 60

taggttagaa tctttttttg gctactattc aaatattaat aataaattgc tgcaaacaga 120

tttcacaccg gaaaaaaatt aaatttttct agcaatgttt taactccctt attaaatatt 180

tatagaaaat cgactactta aaaagaattg actaacattt ctgaatctct gcagagattt 240

atagatggat tagcatccta caagttttta tctttttgct atatttccat tattttttta 300

<210> SEQ ID NO: 74

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 74

gataagacgt cttattttgt aataattcaa aaattaatta atatagaagt aagatcttga 60

taataattaa tatgctcaaa tttcttaatg agaatatgtt caggatgaag atgaagtgaa 120

agaaattgat agattgagga agcaattgct aattgaaaca gaacagctcg tttccaattc 180

tcttaaagat ttactgaaga aaatttatta tccacttgaa gaagctattg atctcaaaat 240

tcatcagaaa ttaattcaac aaattgctgc cttgttgaag tgtattagta tcttggataa 300

<210> SEQ ID NO: 75

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 75

accgcaaaat acctaaaaat ttctataaca acgattaaca cggcctcgaa ctggaagcat 60

attaatccat gcgtggctca aacttcaatc ataaagacaa gatctagaga tcaacacaaa 120

atggtgaatt gttaccctat cgttgctaaa gtttgagaga aaaaagtgct aaatcaagta 180

gtacaccaaa tttagttaat attaagaaat caatttagta ctgaatttaa acaaatgaaa 240

ttttacgata aaataaaaaa gtacctgatc aaacagcgtc ctcccgttat tcccattgct 300

<210> SEQ ID NO: 76

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 76

tataagacta gtaaacagat cgtaatataa taaatatcga ttttatttta aattttcgaa 60

aacttccaaa tctatcgata tgaaattaaa gatcaatttt taatttccat aatatattta 120

gattctatcc caacatcact catctttatg tcaacttatt taattctctt attaacatta 180

tatttcttgt ttacaatgat aaattttatc aattttctaa tatgatagaa catcttcatc 240

atctgaagat atgcttttct catctttgta acaattcgta tcgcttctga ttttactttc 300

<210> SEQ ID NO: 77

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 77

gttttattat tgcttattga atagtgataa taacactttg atatgatatt gttttgttgc 60

gatcattgta ttgattataa ccttaattaa acgaggatat tatgggaaat gtatttatta 120

caaaattaaa tatgaaaggt tgaagtcttg acgaaacttt caaacacatt tctcgaattt 180

tctctgcaaa aatatcgtta cgatttttgg aaattatgaa gtccaagaat tcaatcgaga 240

gttcgccatg tcactttggc tagtttcgtt tgtttttaat atttcaatca aaagtcaatt 300

<210> SEQ ID NO: 78

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 78

ccttggatat tgttcttgac atcgttgatc agaaggtcac cgtagtgttc ggtgagcgag 60

atggaattgg actcaggttt attctccgtt tttttcatgt ttttgaattt tagagagaaa 120

ataatgtttg tctgaatggt tagcaaacta attagttttt aagttatcag gaactcgaag 180

tatcttcttt tgcacttctt taaccttttt catcaaattt tttaacagta acaagatttt 240

tttgagaatt ttcaaaatat ttttgacttc tgatgatatt tgatgagaaa accatcactg 300

<210> SEQ ID NO: 79

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 79

agagtattat tatacatgat gatgatgatg atgatgatga tgatgatgat gatgatatga 60

tgatgatgat gatgatgatg atatgatgat gatgatgata atgataatga tgatgatgat 120

gattaattgc ttatttttaa tgattgataa ctttaaaaga aatcattgaa atttgatcga 180

ataaaaattt tcttaaaaaa agcatttgct atttatatag taaacctata aaaaattact 240

tatttttatt actaatattc atttgattgt atgaaagaga agagaaaaaa aacctttgca 300

<210> SEQ ID NO: 80

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 80

tggtatcaca gcactgggtt taatttcaac aatcggttga cgatcttttc gggatatgcc 60

tatacccaga aatgaacgta tgccaaacga tggtatgttt gatgcaacag acgacgtcaa 120

cttaaaatgt gttttttttt caaaaattca atatttttag tttaaaattg cacgtcagta 180

aaaattaatt cataataaat ctctttgatt tcttcgttct cctttttttt cagaaaaaat 240

tgaaatttta catacctgat ttccaagagc atataaagca tcacttaaag cattctgcga 300

<210> SEQ ID NO: 81

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (263)..(272)

<223> OTHER INFORMATION: n is a, c, g, or t

<400> SEQENCE: 81

tccttttcat gatttgtagc taaccaataa gatgtgtata tgttcatata tttactctcc 60

cctgactctt ttacactctc attctctcat ttgttcattt agataagtaa tatgcgcctt 120

tctcttcctg attctctcaa tctttcatcc cttcatctcc tcaatctttc tcccattctc 180

tcaatctttc ctgcattgca ttcattgatg aaacacgata gtattaataa gcataatttg 240

ataaattgaa ataatttttt ttnnnnnnnn nntcattctc tcaatctttc ctgcattgca 300

<210> SEQ ID NO: 82

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 82

tttgaattaa caaaatatta acaattacaa ctatttcgga atttaattta agaataattt 60

aattaatcaa tttcctattt tgtattttaa aaattaccac aataattatg taatttttgg 120

gatatttgaa actttgaaaa aagtggtatt gtatttgaga ataaattaat taatgtaatt 180

cttgctgctc atcgttccat aacttacaaa tatttctcgg tattttattt gagataattc 240

ttatcatttc ttccatagct ttcaatatat ttataactta tttgtaatca ctcttatcac 300

<210> SEQ ID NO: 83

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 83

ttgagatatc aaatcaagcg ttgcatattt atagtacact ggtgtagctg aaatcgcgaa 60

gagaacacga aaatcagaga agtcaatggt tcctttgtgt tggatttcac atgaaagcat 120

ccttatgttg tacatgcgtg attacaatat gatacaagat gtaagctaaa aattgtttta 180

tctttgtcta tgagatgtag ttcatactct ataataaagt cccaaccctt aattctcata 240

ttcacaaccg tatcagaatc caacaccaaa ccattataaa gaatgttctt cgtcgaggcg 300

<210> SEQ ID NO: 84

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 84

ccactatcgc ttacactttc tttatcctgt tcttcttcat ctttcgtttt ggactttatt 60

ttactgtcag gtgacaagca aagtaacgat gttggacttt gcgaagatgt ggatggtacg 120

ctagaaaaaa aatgaggatt ggttaatatg tctaattatt acatcgcttt tttttaaatc 180

ttttctaaaa ttaaactgaa taatcaactt atttgctatt cagtttatct tattttttat 240

caacaaaatt cgaggaaaca aatcgcttat cagaataatt gttttgatca acaaataaag 300

<210> SEQ ID NO: 85

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 85

caatcccaca aattcagtgt gtcggcgggt cagcgaaggg aaagtttgaa ccgagggtat 60

gtacaaattg tgataatttt gtgatgacgt agtaaatttc atagttttgc atgctttaat 120

gttgatagtc gcacaatcct acgttgatta aatttagcta ttagatatcc tactaaatta 180

tgttgttcat aatttttgtt tttaaaatgc tccacttata ttttcaggtt gtgcagtgct 240

acaatagggg ttatgacggc aatgatgtcc aatgggagtg taaagcggaa atgagcaatc 300

<210> SEQ ID NO: 86

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 86

tcagataaat tgtatttgat gttaattcaa agaagaaaaa aataatcagt agaatatgaa 60

tcgaataata ttcatacaac cagtttattc attattattc acttttaacg tctaaatgac 120

gtagctacgc tttttttctc gctttcaagc ctttactgac caagattaat gtacattctg 180

ttgaacaaga ttaatcgaca ttctatcgat caagatcaag cttttactga tcaagattaa 240

taatgacatt cttctgttga tcaagattaa tcgacattcc attgatcaag attaatcgac 300

<210> SEQ ID NO: 87

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 87

ctctctaaaa cctattggtc actaaacttg cactgactaa aaactattgg tcatcagact 60

tgtgattcat tgaaaagacc gttagccgct aaaattatga ttcactaaaa aaaatctatt 120

gatcattaaa tctgtaatca ttgagaaact acaatcattg gtcattaagt ttgtgctctc 180

taaaacctat tggtcattaa actgactaaa aactattggt cactgaacct agagtctatt 240

aaaaaaaaaa tcattgtatc aataaattta ttgtttacta tcaaatccat tgattactga 300

<210> SEQ ID NO: 88

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 88

tctaaaacct attggtcact aaacttgcac tgactaaaaa ctattggtca tcagacttgt 60

gattcattga aaagaccgtt agccgctaaa attatgattc actaaaaaaa atctattgat 120

cattaaatct gtaatcattg agaaactgca ttcattggtc attaagtttg tgctctctaa 180

aacctattgg tcattaaact gactaaaaac tattggtcac tgaacctaga gtctattaaa 240

aaaaaaatca ttgtatcaat aaatttattg tttactatca aatccattga ttactgaata 300

<210> SEQ ID NO: 89

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 89

aaaatgtatc aaattcttcg atgccataaa ttatacagac ttgattggca ttttttctaa 60

ctttcatcat gaaccattct atttctaaat tgatccatta caaaatcaac tttgtgatat 120

catcaatctc agtcataacg agaaataatg ataatataaa gcgactatca tttgaatttc 180

ctgaatattc aagatgtaat tacatctttt ttttaatgta atcaaaattt cttgccatca 240

ataatttttc aacatatgct ttcatcgact gccttatgca gatcgtaatg atgacagcca 300

<210> SEQ ID NO: 90

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 90

attgattaaa aagaatcaac attaaatttt tgatatagtc gagaaatcct tcgtgataat 60

tcttttagaa caattcttta cactaaactt gtatttactt gcttattatt tgtctaaaga 120

tactaactat ttgtcagtgg aatttatgat cttggcatta ttgcatataa cgctttccta 180

aaatctgaaa tttttcagta ttttaaaaac taagacgatt attaaatatt actcaaagct 240

tagaactttg attatactaa tcaaatcaaa aatttcatca gcgatttttg ttgtgtcatt 300

<210> SEQ ID NO: 91

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 91

attttttcca gcagaattgt catcaaaaat cccatttttg atatcctctt catcgaaact 60

tgctcctgaa tccagagaac aacgaagaat gtgtaaatct atttcagtag cctgctcatt 120

gtgcaattca gcgactttat ttctgtgctt caagctaact tcttcattat gccactcctc 180

ttctctcgct attttttcgc tatctaattc aaaatcttcg tctgaaacgg aatcaactcc 240

tgacgatgta ctcgacactg ataatatttt catgccgatt tttctctcaa acgaatcttt 300

<210> SEQ ID NO: 92

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 92

gaatgaagag caaaaaaata gtcacgacca cctgcaataa aaacagcatc tccgtaaaaa 60

tgattgaatt gattcccgaa atacgagttt atcaaattga gaattatgca aattaattat 120

cagcatgcag atttactgat tttatatctc tcataccgaa attaaggtga tgttttccat 180

ttctttgttt ccacaatgtc ttctttgtga atcgttttgg atcaactatt aatccgatcg 240

aatcaatcct ccaaatatga gtttattcaa cgtaacaaaa cattgtccga gataatcaaa 300

<210> SEQ ID NO: 93

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 93

tggaaatttc gaaatcgaaa ggatgaagaa aaaggatcct tgatctatac attaaatatc 60

accatatcaa ctagcatggc aagtcaaagt aatgttatca tttaaataaa aaagatgaat 120

agtaggacta caggttatat tgttaaaagt cgacaaattt ggagtaattg acagagatca 180

acgattaaat gtaatggatg atcttatctt cttttttcaa ctacgccaaa atgaaaataa 240

caattgaatt tgtcgaataa gaaactaaca ttttgaaaat aagattgaac atttataaat 300

<210> SEQ ID NO: 94

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 94

ggttggatca ttatcgacag aactttagaa gtttcttgat aaggacgaaa agaagcagca 60

ccattgctga tctaaacaag gaaaaaagac cttttttgga atattgaagt ttttactgat 120

aggtgcgtgc tgtgtactgt gggcataagt acaagcttca tgctccgcag cgtgaatacg 180

tgctgcatgc atactatgca gtaaaggtgc gtgtcgtatt gctcaataag tgtataaatt 240

gctgcttttc ttgcatagtt aaatattttg ttttcatttt ttccgctatt caaaataaat 300

<210> SEQ ID NO: 95

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 95

gttgggattt cagactctca ctcggtgtcg tttcacagtg atatctgaat cgaagtcaca 60

agcaggtatg aatgcataac aactaatatc cattgcagaa acaaggcaaa actgagaagc 120

tcgagcaata tagctataga agctggtacc acagatgaca ttacatggta tttccatttc 180

agcttcacaa acattgtaaa tagcttgctt cgatgattca atatctcgtt ctacgatatt 240

cttaaagtaa tttttattta tttgaagtat agattacatc catgttctat ctatcatttc 300

<210> SEQ ID NO: 96

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 96

tgttctgaac atctcttttt gattatcttt tttaattcct ccattatttt cgtttttttc 60

gttgtgaatt aatattgttt gtctttgatt cagatgatat tttcggatcg taaatagatg 120

gcatcggcat aagcgtattg agaagcattc aatggtgcac tcttgcttct tttttttttg 180

aaatctttct cgataatcaa ataagtgcag gatgccaatc attaacaatt tcgttccact 240

ttttcagttc ttattcttat aacaccacat ctcatttgca attttgtcgc caatgatttt 300

<210> SEQ ID NO: 97

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 97

ttttttcgag gtcactctgg aaaaataaat catattttaa aaagacataa aataaaaaat 60

atgtatatat aagaaaattt ttactctgaa tttcttaaga aaattctcga ttctgttttc 120

cataaattcc ggaatatgtt gtccctgaat taagaattcg attccttgca caccattatt 180

tcgtctagtt cctgtgtgaa caatgtaacc tggaaatgaa cacataaact gtaatatttt 240

gagcttaaaa taattatgag gatgcgaaac tgaagatatt cataaatgtt taaaaaaaaa 300

<210> SEQ ID NO: 98

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 98

gtccatgcat tgcttttcgg aagttagtgt agattcagtg aatatttaat accagtctct 60

ttctaattca aaagagcctc ccatttcttt tttcagtttc agtctctgaa tcagagcgtg 120

taatctacca ctccattgcc gaaaacagct cgatgtattt cctgctacgt agtgtttaga 180

attggcgtat gccacttgct cattattcgc gcatgaagtg taactgtgaa tagaatgata 240

ctactgttag aagagaatgc gttcacttta tttaacatta tactgattca tttcttcttt 300

<210> SEQ ID NO: 99

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 99

agtgaacgag aaaaaacaga agaagagata gcacatcaag atcgtgagaa attaattaga 60

caagaaaaag ctcgtcttac acaaatatat caggttttct ttttcttgct ttcgaaagtt 120

atttgaatta tctcatttct ttgaatttta taagaaataa tttaattttt ttttgaaatt 180

ttgcctattg agctctaaat tttgtaaaaa gttttctagg atgatgttag caaagcaaaa 240

aagaaatcca aaagtgatgg taacaaacag gaagatttta tagtgaggta cgataatacg 300

<210> SEQ ID NO: 100

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 100

tagacaatat catccttcct ttttttttgc tcaatttctc tgctcattgc tttgatgata 60

atggtaggtg gtataatgaa acgaatagat aattgatgtt cgcaaacatt tgctgttaaa 120

tttcagtaaa gaaattgacc tttttgcttt gtgttggatg tttagcttca ttttcttctt 180

gttcattgtc atattcattc tctcaaaact tcttgcttag cgatgctaat ataaatactg 240

gaagaatgcc tttgctttgt tttagttgta aatcatcacc aaggtatttt tttgcaaaat 300

<210> SEQ ID NO: 101

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 101

aagatgaaac taaaaaaaat tatttcgaaa aaaagaaaat aaaattaatg aaataaaagc 60

aaaaatgaac aaaccgtatt aattttaaac aataaacaat atcgaaatcg aaaaatggac 120

tattattgat gaactatatt ttcaaaatgt gaaaggtcaa agtttgtttc aattatgata 180

aatacaattt aaaataagat taagctaaca aataagttga gcaaattgat gaaacaaaca 240

aatcagaata tattacagaa aatgatataa catgaaaata tattagacca attattttta 300

<210> SEQ ID NO: 102

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 102

ttgaagtttt cagataaact ttgataaaaa attgttctat gaattctcaa atttcaatta 60

gtgatactta tttcgaaggt aattatgcct gattgaatct tcaatatcaa caaaatgaaa 120

attttagtat gattgttaac tcatacacct ctaattaaag gtattttctt tatcccatga 180

aatgaaaatt tattaagaac ttagaaagct acggtatgcc tttgatgcaa aagaaagatt 240

cattttcatt aaatcatgtt taaaaaaaag agcaaagagc aaaaggtgat gaaagttttt 300

<210> SEQ ID NO: 103

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 103

ttctatacga aatatttgtc tgccataaat ctactcagga actcgataca tcaaaacata 60

agtacgcttg ctctttattt ttcgtttgaa aaataaatag atcattttcg cacttacatt 120

tcaatttcaa ttgctttatt catatctttc tgtttttact tactggtatt taacagtcgt 180

tgttcacaat ttaatgatct atgaaacacc atttaattgt atttggacta acttttcgac 240

aagcaaaaga ttaaaattgt cttcagatac agttataaat ttacattgaa gataaatgaa 300

<210> SEQ ID NO: 104

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 104

taacgatctg tatatcaatg gaataatatt cagttcatgt tgtactcgat atgagataga 60

attacaattt tggaacaaga taatctcaac agctattttc aagaatagtt aaattaggat 120

accattcaaa gaaactttaa aaaatgattt ccatacatta atgctttttg tgttttcgct 180

ctcgaccaga atccaggaat tgtccattat catcaatttg attaactttt atctttattc 240

taattcttca acatttctct aattgatatt agtttcaata ttttaataag taaaaattta 300

<210> SEQ ID NO: 105

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 105

ataatgtgtt attgatcaaa ggatttttag ttacctacca gatggaaaaa aagcaagttt 60

acgaaaacag aagttagcat caactttcat ccatggttac accgtatata atccaatcga 120

ctcatacttt atgttgatct gattttatag cagataacta gttaccttgc tcagcagcag 180

ctaaatcctt tctatttgct taataacaga aatatttttc attaacaaag aaattatact 240

ccgtgtttga catttcattt taatttcgtt ccaaaaatga aaaaagcttc gtccggaaat 300

<210> SEQ ID NO: 106

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 106

attattttgt agtttttcat tttttagttc aattttcctt tgcttatttt aaatatgcca 60

ttctttattc agactcatag cgaatgcata tgttcattaa tttttttagt tacagttaca 120

aattctcaat ttctctttaa tcattttttt ttccaaaaat agtctgagca ctcaaccatt 180

cattcaacaa ttgcagcttt ttttattgga gccttgtcaa attatcaatt cgtttccatg 240

tttattattg aaataataaa cggtatttag gataacgaag ttcgcttagc ttctttgact 300

<210> SEQ ID NO: 107

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 107

aaaaattcag gtaatgagat cagtaatttt ttttggtcac tttgctgttt cttatcagct 60

cattgttatc catatcaaat gagcgaaagt gtgtatcaca tattggcaga gtgtaatcta 120

tgaagatttt gcgtatcaaa gtaattatga gagaactgat aattttattt taaagtagta 180

gaaaactcga attaagctaa taaataatcg gttgatatcc atgaaatgaa ttactaatga 240

aatggataat tgagtaataa caaatgatat tcatgaagaa aggcaggttt tttttaatag 300

<210> SEQ ID NO: 108

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 108

tatacttaaa acaagaaata caattaatgc caatagcaga gtgaaacttc tgaaaaataa 60

tgagttgaaa ctggtaaaat taacatttta ttagaaattt cagaaactta tgactcctca 120

tggcactatc acaaaatgtt tgaaaaaaat tgacagctcg cgtcgattgc aaaaatcatg 180

attcctgata tttagtatcg aacatgtgac aaataatata aagacctaac cataaagcac 240

tgaaacaact cgcggaaaca aaaaattaat ttgcataaac acggaatacg atcagaaaat 300

<210> SEQ ID NO: 109

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 109

gaattttttt agaaggcttg aagtcgagaa tattagagac tatatcgaag acttaaataa 60

tcctggtaat cttctgtatg aatcaaaatt acctcgaaca gaaccattca gcacatcacg 120

agataattca tggaatgaaa ctagccaatc agagcgttgt aaaagaagaa agttatgaaa 180

tgaccttaaa atcaatttaa agcatgtcct cgccatataa gcgttgaaaa gttaggatag 240

aatcaattat caaaaaaata tgttaactag atcttatcaa tcaaaacatc agaaggaaaa 300

<210> SEQ ID NO: 110

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 110

atatgataat agtgaaacaa ttccatcaca ataaatatta tcgattagga gataaattaa 60

cattgatgcc tcaattttgg tcaacaatat atatttgcta ttagcatttt tattaaatcg 120

tttttatctg acttgacata aattgaaata gaaaaaattg aatctgttcc ttgttagatt 180

ttcttctaaa aattcttgaa atacaaataa tttcttaaat ttcaatattt ctacataatg 240

tattgcgaca aaaatgctaa tgattggctt attattattt cgaataattt tttaatcaaa 300

<210> SEQ ID NO: 111

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 111

agctcgaaga tcggacaaaa tttgttcagc ttgttgcctt gaggctttag tctgaaaaga 60

cacttaaaag tataaacaaa ttatattcaa aaaatcttat tttgcatttg cgtcttaatt 120

tttgcttttt gcaaagtttt ttccgagcaa gtttttctat cttcgaaaag attatatcaa 180

ttaaaatttc aatttaagca atcattgcct cttcgagttt ctgtttcagc aaataaatat 240

caccaccacg acgctgtcgg aagaaagaaa cgcctttccc aatttctcgt ctcaactttt 300

<210> SEQ ID NO: 112

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 112

taagaaagct gggagatttt ccaaaaacac tatttcccac gatttgttgt tttctatgat 60

caattcttaa tcaaactctg aaattctcaa attttcgatt tctatccaac ttctacatat 120

ttttttagaa aattcatatt tagcaaagct gagtgtagaa ataattcata cttgcaattc 180

atttttctta aattttcgaa tttcttaaaa aagtatttca aattacctac caattttgat 240

tggaaaattc gtggatgcta aaaattcaaa tcaaaatagt taaacagtat tcctaattgt 300

<210> SEQ ID NO: 113

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 113

aatttaaaaa acacatcgac attttgcggt acggtaatga ttgtttacag taactaaatg 60

tgtcctacgg tagtaatact cgtgtacgta atgaatgagt atagtgaccg gatatttcct 120

tcactagtag gcaatattaa gaagtatttt cattttcata ttctatctaa aataaaccga 180

taaaatggtt tttgaattat tactttttca ttgttatttt ttgatcctaa attgtaaaat 240

actgtaataa tttagctaat ttctatgatt ctattcaata tgcttaaatt aaaattctaa 300

<210> SEQ ID NO: 114

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (63)..(72)

<223> OTHER INFORMATION: n is a, c, g, or t

<400> SEQENCE: 114

tcgtatttgt tgtatgtaat atagaaatat tgtttaaatt caatatgtag aaaaaatttc 60

tannnnnnnn nnaattaatt acatattaac tcgtatttgt tgtatgtaat atagaaatat 120

tgtttaaatt caatatgtag aaaaaatttc cataataaag acgaacagca tttataatta 180

tcaatgataa gttgaaatta attcatcaat gataagttga aattaattta tttgaaataa 240

tttctttgaa attcgaatat agacgagaat tttttttttt ttgctaatcg tttatcaaat 300

<210> SEQ ID NO: 115

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 115

tctagcaata taaattacaa gaatatgccg tccaagtatt tcagaattta ttattaattt 60

ggataataat acattgtaaa tactgcgtat tctggattat tatgcactgc ataataacat 120

gcaatttcgt ctacatatcg cgaataaacg ccaaaagatt tctcgataaa agaaaatata 180

agaattcgta aatgaatgtt gtgtcagaga tatgtgttaa ttcataagtc aagatgttgt 240

aaatcgatcc atattagtaa tcatatttac gtgctcgtaa ataaaagcgg tgattcttgt 300

<210> SEQ ID NO: 116

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 116

atcgaaaaaa gatgatctga tgacggaagg cgaaatgtct gcagaagcta agatgacgga 60

agaaaaaagt gaagaaatga aagaagaagc tggtaaaact cagaaggaat gtaaaactgg 120

agaatcgaaa aaagatgatc tgatgacgga gggcgaaatg tctaaagaag ctaagatgtc 180

ggaagaaaaa agtgaagaaa tgaaagaaga agctgataaa actcagaagg aatgtaaaac 240

ggaagaatcg aaaaaagacg atctgacgac agaaggcgaa aaatctgaag tagatgagcc 300

<210> SEQ ID NO: 117

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 117

actaatgata agaaacggag ccgacgattt taggaaatga ataataacga cattgacaac 60

cattgttaga aaattgatag tactgataat aaaagctagt tatagaaaat tgataataat 120

aataaaattg ctggtagcaa atgtctagaa gtgataataa aattaatgat agcaaatgga 180

ttagcaatga taattaaact gatgatagcg aatggattag taatgataat aaaattgatg 240

atagcaaatg actaataatg gtaataaaag ttaatgctag tgataacttg tattttaagt 300

<210> SEQ ID NO: 118

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 118

acagtttata gttacaatat tctccggtga ctaactgtat tttacaactt ataattatag 60

attacaaaat atattatagt agttttataa ttacagtatt cttaagtgaa taactatact 120

ttacagctta cagttacagt agttttctat gtttttgaat attaatttta catggttttt 180

cctagtttca gtttcaaaat tttcagatat tttatgtgtt aaagcaaatt atattcgaga 240

tataaaaagt actggtcata tcttacaatt ctcatccttc tatattggaa agaattgagt 300

<210> SEQ ID NO: 119

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 119

gtattgggac cgcgtatcgg gaaatctgaa agaagtcttt aacagtattt taaatgaata 60

attcaaatcg ttacttctta atatattaat ttatgcgtat atatgcagta catagcattg 120

cttaaattct tatttttccg cggttaaaac cctatgtaag ataagggagg tgattgtatc 180

tgcgccgtac tccttgtttt aatctacctg cttgttgtat atcctccaca tattgtaact 240

gcagcttcac atttgcatat atagtaaggg catcgttgtc tccagaagag atatattatc 300

<210> SEQ ID NO: 120

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 120

gctgcccgaa tgttacaatt aggacgaaag taaaagtagt tgactgtagg tatgacgata 60

aaggaaaaat ttgtatctta agactttaca atttctaaat attacgtgtt ttatcgtgct 120

aacatcacga attccatatt cacaaaaaaa attttgtaga actccatctg gtttggatga 180

atttgctaca gttgaactgg atgatggaac gaaattgcaa acatctctta ttgttagtat 240

tttctaaatt ctgtgaaatt ttgcaacggc attcatgttt aattattaat ttggagaaag 300

<210> SEQ ID NO: 121

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 121

aaataagcaa atccgaaagt attacatata cggactaaat attgccattc attcgggagt 60

ataccattgc aaccattggt atttcatttg atcgagaaaa ctagtttttg tagtttggga 120

taaagagaaa tggagagagg aactttcatg atcaatttct ttacgtactg aaattcattt 180

ctatggatgt tctttttcta tttcattctc ctcagcaaat acagtccgaa cagtcatcaa 240

ataagtctaa aaggcatgaa taatataaac atcagcaact ttttaaatga atgcttatta 300

<210> SEQ ID NO: 122

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 122

atttctataa acatctcttg cattgattaa tttaacatgt tgcaataaat atttcttact 60

tttgaatgta tcatttacta gaaaaaactt caatcgagga aataagtttt aaaataaatt 120

catatttgaa ttcatgtcag ttcaaaaatt ctattactat aatacatgtc tcttggttgt 180

atcttttttt cttttgaaat aatacaatca aacggtttcc taaattttca tagacatcat 240

attttaaaaa aaaatgcatt tgaaaatttt cgaaaatcaa tgaacttaat tgatgaaaaa 300

<210> SEQ ID NO: 123

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 123

gcatgtgtat gtagtatttc tttgtaaaca acatatctaa tctgtctgtc cctttaacat 60

tatagaatag tcagttagtc cgctatttat tttaataaca aaatatctca cttaacttcc 120

atttctttcc taaataattt tgtttcgcta gatctttcct ataattttca aattttcaaa 180

aatgaattaa tcttttattt atatatgtgt atgtatgtgt atgtatgtat gtgtacgttg 240

catatatgta tatgtatgtg tgtatgtgtg tatatgtata tgtatatgtg tgtatgtgtg 300

<210> SEQ ID NO: 124

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 124

tatgcataat gtgcgaccag ccaataatgt cttcaaacca taattatgca gaaataaatt 60

ttttccagaa ataatttttt tttttttaca tatacttccg atctgtgaga aaatacattt 120

gaagtgaagt gtgaagcaat gctacttttt caaacaacat tgtgaaaatg gattaaaacg 180

caccaatgga gcaagagatc gtaagtttcg ttccgcatgt cctgtggcaa cgtgtaaacc 240

atccgttaac gatatatgat gtaaaagccg acacacccaa attaaaatcc attataaaca 300

<210> SEQ ID NO: 125

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 125

aaatggatcg tattcacttc gtaagaactt agtgaacgaa aaatcaaacc atcacaataa 60

ctttactttt tttctttttt tactaaacac actatcctat gaaaacaaaa tgtccaaata 120

gattcatatg ataatgaact gtgaagttat ccaatctatc agttctcgaa gagggaataa 180

ataaaaacat taagcaaccc accgatcttc gctgaccatc tccttcttca ttagcaagaa 240

gcaaatcttg tggtgatatt tctgcaacca tctgcaaaat aaagcacgaa aaattaagga 300

<210> SEQ ID NO: 126

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 126

tttgatatgc aatcaactaa ccaaatcaga attcaatgca ttctgataaa tttcttcaat 60

atcgtgcatc aattcgacat catattttga cagtgatgct acctttttag ccgtatttcg 120

gaaaaatatg aattcaacca gctgcgtccc aaaatttaag gctgtagcaa gtccagcaac 180

aaccagccct acaactgaaa attctaaaaa ctggttcacg tgcttatcat taataatttc 240

aacactatca ctatctccac atgaacttga tcgattataa tttagtagaa ctgaaaaaaa 300

<210> SEQ ID NO: 127

<211> LENGTH: 300

<212> TYPE: DNA

<213> ORGANISM: Dirofilaria immitis

<400> SEQENCE: 127

acaaattcgt tttaatattg gattacattg aaattgctga aataaagtgg aaatattgaa 60

aagcatttta caatatttgt taacaacatt atatttaaag aatatacacc ttggtttaaa 120

tggtaaaata atctcaagaa ttttcattag gttaattttt ttttatttat ttatattcac 180

aaaaaattgt aaaagaaaac aaaaacaaca ataataacgg tgacaacaac aacaataata 240

ataacaaaac tatttgttgt gattttgcag cattgatgta gtggggatct tttggagcga 300

Read more
PatSnap Solutions

Great research starts with great data.

Use the most comprehensive innovation intelligence platform to maximise ROI on research.

Learn More

Patent Valuation

$

Reveal the value <>

9.2/100 Score

Market Attractiveness

It shows from an IP point of view how many competitors are active and innovations are made in the different technical fields of the company. On a company level, the market attractiveness is often also an indicator of how diversified a company is. Here we look into the commercial relevance of the market.

64.0/100 Score

Market Coverage

It shows the sizes of the market that is covered with the IP and in how many countries the IP guarantees protection. It reflects a market size that is potentially addressable with the invented technology/formulation with a legal protection which also includes a freedom to operate. Here we look into the size of the impacted market.

70.66/100 Score

Technology Quality

It shows the degree of innovation that can be derived from a company’s IP. Here we look into ease of detection, ability to design around and significance of the patented feature to the product/service.

44.0/100 Score

Assignee Score

It takes the R&D behavior of the company itself into account that results in IP. During the invention phase, larger companies are considered to assign a higher R&D budget on a certain technology field, these companies have a better influence on their market, on what is marketable and what might lead to a standard.

19.93/100 Score

Legal Score

It shows the legal strength of IP in terms of its degree of protecting effect. Here we look into claim scope, claim breadth, claim quality, stability and priority.

Citation

Patents Cited in This Cited by
Title Current Assignee Application Date Publication Date
Macrocyclic lactone resistance marker for dirofilaria immitis NOVARTIS AG,THE ROYAL INSTITUTION FOR THE ADVANCEMENT OF LEARNING/MCGILL UNIVERSITY,PRICHARD, ROGER,BOURGUINAT, CATHERINE,GEARY, TIMOTHY 30 March 2011 06 October 2011
See full citation <>

More like this

Title Current Assignee Application Date Publication Date
Methods for predicting an antibody response to interfer on therapy in multiple sclerosis patients MAX-PLANCK-GESELLSCHAFT ZUR FÖRDERUNG DER WISSENSCHAFTEN E.V. 21 April 2010 26 October 2011
Sarcocystis neuronadiagnostic primer and its use in methods of equine protozoal myeloencephalitis diagnosis KENTUCKY, UNIVERSITY OF, RESEARCH FOUNDATION 14 February 1995 29 August 2000
Use of galiella lactone INSTITUT FUR BIOTECHNOLOGIE UND WIRKSTOFF-FORSCHUNG E.V. 29 June 2001 28 January 2003
Genomic marker for meat tenderness INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE,APIS GENE,BERNARD, CARINE,CASSAR-MALEK, ISABELLE,HOCQUETTE, JEAN-FRANÇOIS 12 September 2007 20 March 2008
Derivative of inula lineariifolia lactone a SHANXI ZHENDONG LEADING BIOTECHNOLOGY CO., LTD. 31 August 2016 09 March 2017
Method for determining the susceptibility to stoke by analysing the ins gene UNIVERSITY COLLEGE LONDON,CHARLES, IAN, GEORGE,LIU, LIZHI,XU, WEIMING 29 June 2001 10 January 2002
Antimicrobial proteins SYNGENTA PARTICIPATIONS AG 20 December 1996 05 June 2001
Compositions of parasitic helminth PLA2 nucleic acid molecules and uses thereof COLORADO STATE UNIVERSITY RESEARCH FOUNDATION,HESKA CORPORATION 07 September 1999 06 January 2004
A method for predicting athletic performance potential UNIVERSITY COLLEGE DUBLIN - NATIONAL UNIVERSITY OF IRELAND, DUBLIN,HILL, EMMELINE,MCHUGH, DAVID,ORR, NICK,GU, JINGJING 11 September 2009 18 March 2010
Methods for fermentative production of massoia lactone TEMASEK LIFE SCIENCES LABORATORY LIMITED 16 August 2016 23 February 2017
Methods for analyzing animal products PIG IMPROVEMENT COMPANY UK LIMITED 27 May 1998 08 March 2000
Compositions comprising adjuvant, macrolide and proteinaceous antigen and methods of use thereof ZOETIS W LLC 29 September 2010 15 August 2012
Dairy cattle breeding for improved milk production traits in cattle WISCONSIN ALUMNI RESEARCH FOUNDATION 13 July 2005 01 March 2011
Genes useful for diagnosing and monitoring inflammation related disorders XDX, INC. 10 December 2009 15 April 2010
商業的肥育場の去勢ウシ及び若雌ウシにおけるレプチン遺伝子中のマーカーと屠体特性との間の連関 メリアル リミテッド 02 March 2006 25 September 2008
Methods for Identification of Merle Gene MERLOGEN, LLC 16 August 2006 18 September 2008
Parasitic nematode transglutaminase, nucleic acid molecules and uses thereof HESKA CORPORATION 04 December 1997 07 May 2002
Diagnosis of dementia with lewy bodies FUNDACIÓ INSTITUT D'INVESTIGACIÓ EN CIÈNCIES DE LA SALUT GERMANS TRIAS I PUJOL,UNIVERSITAT AUTÒNOMA DE BARCELONA 06 May 2016 17 November 2016
Dirofilaria immitis Gp29 proteins and uses thereof HESKA CORPORATION 05 June 1995 08 April 1997
Dirofilaria and brugia thioredoxin peroxidase type-2 proteins and uses thereof HESKA CORPORATION AND COLORADO STATE UNIVERSITY RESEARCH FOUNDATION 04 August 2000 05 March 2002
See all similar patents <>

More Patents & Intellectual Property

PatSnap Solutions

PatSnap solutions are used by R&D teams, legal and IP professionals, those in business intelligence and strategic planning roles and by research staff at academic institutions globally.

PatSnap Solutions
Search & Analyze
The widest range of IP search tools makes getting the right answers and asking the right questions easier than ever. One click analysis extracts meaningful information on competitors and technology trends from IP data.
Business Intelligence
Gain powerful insights into future technology changes, market shifts and competitor strategies.
Workflow
Manage IP-related processes across multiple teams and departments with integrated collaboration and workflow tools.
Contact Sales
Clsoe
US10000811 Markers predict macrocyclic lactone 1 US10000811 Markers predict macrocyclic lactone 2 US10000811 Markers predict macrocyclic lactone 3