Great research starts with great data.

Learn More
More >
Patent Analysis of

Analytical method for increasing susceptibility of molecular targeted therapy in hepatocellular carcinoma

Updated Time 12 June 2019

Patent Registration Data

Publication Number

US10017823

Application Number

US14/765304

Application Date

16 April 2014

Publication Date

10 July 2018

Current Assignee

CBS BIOSCIENCE, CO., LTD

Original Assignee (Applicant)

CBS BIOSCIENCE, CO., LTD

International Classification

C12Q1/68,C12Q1/6886

Cooperative Classification

C12Q1/6886,C12Q2600/158,C12Q2600/106

Inventor

PARK, JIN-YOUNG,MOON, YOUNG-HO,KWON, JUNG-HEE

Patent Images

This patent contains figures and images illustrating the invention and its embodiment.

US10017823 Analytical increasing susceptibility 1 US10017823 Analytical increasing susceptibility 2 US10017823 Analytical increasing susceptibility 3
See all images <>

Abstract

Provided herein is an analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment by analyzing the mRNA expression of FGFR1, optionally along with the mRNA expressions of other biomarkers (i.e., VEGFR2, PDGFRβ, c-KIT, c-RAF, EGFR, and/or mTOR) to select a patient having susceptibility to sorafenib treatment and a patient having resistance to sorafenib treatment before employing molecular targeted therapy with sorafenib.

Read more

Claims

1. An analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, comprising(i′) measuring mRNA expression levels of the genes of SEQ ID NOs: 1 to 7 in both the hepatocellular carcinoma tissues and normal tissues isolated from the body of the hepatocellular carcinoma patient by performing real-time reverse transcriptase-polymerase chain reaction with primer sets for amplifying the genes of SEQ ID NOs: 1 to 7, wherein the primer sets are: a forward primer comprising SEQ ID NO: 32 and a reverse primer comprising SEQ ID No: 33 for amplifying SEQ ID NO: 1, a forward primer comprising SEQ ID NO: 26 and a reverse primer comprising SEQ ID No: 27 for amplifying SEQ ID NO: 2, a forward primer comprising SEQ ID NO: 29 and a reverse primer comprising SEQ ID No: 30 for amplifying SEQ ID NO: 3, a forward primer comprising SEQ ID NO: 41 and a reverse primer comprising SEQ ID No: 42 for amplifying SEQ ID NO: 4, a forward primer comprising SEQ ID NO: 38 and a reverse primer comprising SEQ ID No: 39 for amplifying SEQ ID NO: 5, a forward primer comprising SEQ ID NO: 23 and a reverse primer comprising SEQ ID No: 24 for amplifying SEQ ID NO: 6, and a forward primer comprising SEQ ID NO: 35 and a reverse primer comprising SEQ ID No: 36 for amplifying SEQ ID NO: 7,(ii′) measuring the ratio between the mRNA expression levels of the genes of SEQ ID NOs: 1 to 7 in the hepatocellular carcinoma tissues and the mRNA expression levels of the genes of SEQ ID NOs: 1 to 7 in the normal tissues, and(iii′) determining whether the patient has susceptibility or resistance to sorafenib treatment, wherein if (1) each ratio of the mRNA expression levels of the genes of SEQ ID NOs: 1 to 5 in hepatocellular carcinoma tissues to the mRNA expression levels of the genes of SEQ ID NOs: 1 to 5 in normal tissues is more than 2; and (2) each ratio of the mRNA expression levels of the genes of SEQ ID NOs: 6 to 7 in hepatocellular carcinoma tissues to the mRNA expression levels of the genes of SEQ ID NOs: 6 to 7 in normal tissues is less than 2, the patient is determined as a patient having susceptibility to sorafenib treatment, and wherein if (1) each ratio of mRNA expression levels of the genes of SEQ ID NOs: 1 to 5 in hepatocellular carcinoma tissues to the mRNA expression levels of the genes of SEQ ID NOs: 1 to 5 in normal tissues is less than 2; and (2) each ratio of the mRNA expression levels of the genes of SEQ ID NOs: 6 to 7 in hepatocellular carcinoma tissues to the mRNA expression levels of the genes of SEQ ID NOs: 6 to 7 in normal tissues is more than 2, the patient is determined as a patient having resistance to sorafenib treatment.

2. An analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, comprising(i′″) measuring mRNA expression levels of the genes of SEQ ID NOs: 1 to 7 in the hepatocellular carcinoma tissues isolated from the body of the hepatocellular carcinoma patient by performing real-time reverse transcriptase-polymerase chain reaction with primer sets for amplifying the genes of SEQ ID NOs: 1 to 7, and then calculating the respective 2−ΔCT level of the genes of SEQ ID NOs: 1 to 7, wherein the primer sets are a forward primer comprising SEQ ID NO: 32 and a reverse primer comprising SEQ ID No: 33 for amplifying SEQ ID NO: 1, a forward primer comprising SEQ ID NO: 26 and a reverse primer comprising SEQ ID No: 27 for amplifying SEQ ID NO: 2, a forward primer comprising SEQ ID NO: 29 and a reverse primer comprising SEQ ID No: 30 for amplifying SEQ ID NO: 3, a forward primer comprising SEQ ID NO: 41 and a reverse primer comprising SEQ ID No: 42 for amplifying SEQ ID NO: 4, a forward primer comprising SEQ ID NO: 38 and a reverse primer comprising SEQ ID No: 39 for amplifying SEQ ID NO: 5, a forward primer comprising SEQ ID NO: 23 and a reverse primer comprising SEQ ID No: 24 for amplifying SEQ ID NO: 6, and a forward primer comprising SEQ ID NO: 35 and a reverse primer comprising SEQ ID No: 36 for amplifying SEQ ID NO: 7,(ii′″) calculating the sum of respective 2−ΔCT level of the genes of SEQ ID NOs: 1 to 7, and(iii′″) determining whether the patient has susceptibility or resistance to sorafenib treatment, wherein the sum is more than 0.0758, the patient is determined as a patient having susceptibility to sorafenib treatment, and wherein the sum is less than 0.0758, the patient is determined as a patient having resistance to sorafenib treatment.

Read more

Claim Tree

  • 1
    1. An analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, comprising(i′) measuring mRNA expression levels of the genes of SEQ ID NOs: 1 to 7 in both the hepatocellular carcinoma tissues and normal tissues isolated from the body of the hepatocellular carcinoma patient by performing real-time reverse transcriptase-polymerase chain reaction with primer sets for amplifying the genes of SEQ ID NOs: 1 to 7, wherein the primer sets are: a forward primer comprising SEQ ID NO: 32 and a reverse primer comprising SEQ ID No: 33 for amplifying SEQ ID NO: 1, a forward primer comprising SEQ ID NO: 26 and a reverse primer comprising SEQ ID No: 27 for amplifying SEQ ID NO: 2, a forward primer comprising SEQ ID NO: 29 and a reverse primer comprising SEQ ID No: 30 for amplifying SEQ ID NO: 3, a forward primer comprising SEQ ID NO: 41 and a reverse primer comprising SEQ ID No: 42 for amplifying SEQ ID NO: 4, a forward primer comprising SEQ ID NO: 38 and a reverse primer comprising SEQ ID No: 39 for amplifying SEQ ID NO: 5, a forward primer comprising SEQ ID NO: 23 and a reverse primer comprising SEQ ID No: 24 for amplifying SEQ ID NO: 6, and a forward primer comprising SEQ ID NO: 35 and a reverse primer comprising SEQ ID No: 36 for amplifying SEQ ID NO: 7,(ii′) measuring the ratio between the mRNA expression levels of the genes of SEQ ID NOs: 1 to 7 in the hepatocellular carcinoma tissues and the mRNA expression levels of the genes of SEQ ID NOs: 1 to 7 in the normal tissues, and(iii′) determining whether the patient has susceptibility or resistance to sorafenib treatment, wherein if
    • (1) each ratio of the mRNA expression levels of the genes of SEQ ID NOs: 1 to 5 in hepatocellular carcinoma tissues to the mRNA expression levels of the genes of SEQ ID NOs: 1 to 5 in normal tissues is more than 2; and
    • (2) each ratio of the mRNA expression levels of the genes of SEQ ID NOs: 6 to 7 in hepatocellular carcinoma tissues to the mRNA expression levels of the genes of SEQ ID NOs: 6 to 7 in normal tissues is less than 2, the patient is determined as a patient having susceptibility to sorafenib treatment, and wherein if (1) each ratio of mRNA expression levels of the genes of SEQ ID NOs: 1 to 5 in hepatocellular carcinoma tissues to the mRNA expression levels of the genes of SEQ ID NOs: 1 to 5 in normal tissues is less than 2; and (2) each ratio of the mRNA expression levels of the genes of SEQ ID NOs: 6 to 7 in hepatocellular carcinoma tissues to the mRNA expression levels of the genes of SEQ ID NOs: 6 to 7 in normal tissues is more than 2, the patient is determined as a patient having resistance to sorafenib treatment.
  • 2
    2. An analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, comprising
    • (i′″) measuring mRNA expression levels of the genes of SEQ ID NOs: 1 to 7 in the hepatocellular carcinoma tissues isolated from the body of the hepatocellular carcinoma patient by performing real-time reverse transcriptase-polymerase chain reaction with primer sets for amplifying the genes of SEQ ID NOs: 1 to 7, and then calculating the respective 2−ΔCT level of the genes of SEQ ID NOs: 1 to 7, wherein the primer sets are a forward primer comprising SEQ ID NO: 32 and a reverse primer comprising SEQ ID No: 33 for amplifying SEQ ID NO: 1, a forward primer comprising SEQ ID NO: 26 and a reverse primer comprising SEQ ID No: 27 for amplifying SEQ ID NO: 2, a forward primer comprising SEQ ID NO: 29 and a reverse primer comprising SEQ ID No: 30 for amplifying SEQ ID NO: 3, a forward primer comprising SEQ ID NO: 41 and a reverse primer comprising SEQ ID No: 42 for amplifying SEQ ID NO: 4, a forward primer comprising SEQ ID NO: 38 and a reverse primer comprising SEQ ID No: 39 for amplifying SEQ ID NO: 5, a forward primer comprising SEQ ID NO: 23 and a reverse primer comprising SEQ ID No: 24 for amplifying SEQ ID NO: 6, and a forward primer comprising SEQ ID NO: 35 and a reverse primer comprising SEQ ID No: 36 for amplifying SEQ ID NO: 7,(ii′″) calculating the sum of respective 2−ΔCT level of the genes of SEQ ID NOs: 1 to 7, and(iii′″) determining whether the patient has susceptibility or resistance to sorafenib treatment, wherein the sum is more than 0.0758, the patient is determined as a patient having susceptibility to sorafenib treatment, and wherein the sum is less than 0.0758, the patient is determined as a patient having resistance to sorafenib treatment.
See all independent claims <>

Description

“The Sequence Listing submitted in text format (.txt) filed on Jul. 31, 2015, named “SequenceListing.TXT”, created on Jul. 6, 2015, 57.4 KB), is incorporated herein by reference.”

TECHNICAL FIELD

The present invention relates to an analytical method for increasing susceptibility of molecular targeted therapy in hepatocellular carcinoma. More specifically, the present invention relates to an analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment.

BACKGROUND ART

Hepatocellular carcinoma (HCC) is the most common primary liver malignancy. HCC is the sixth most common cancer and the third most common cause of cancer mortality in the world (Yang J D, et al., (2010) Nat Rev Gastroenterol Hepatol 7: 314 448-458). Many molecular targeted drugs have entered clinical trials as palliative and adjuvant treatments for HCC (Villanueva A, et al., (2011) Gastroenterology 140: 316 1410-1426). The multikinase inhibitor sorafenib was approved for the first-line therapy in advanced HCC as a result of a statistically significant but modest improvement of overall survival and time to progression in two randomized controlled trials (Llovet J M, et al., (2008) N Engl J Med 359: 378-390 and Cheng A L, et al., (2009) Lancet Oncol 10: 25-34). Other molecular targeted drugs have been tested in combination with sorafenib or in the adjuvant setting (Zhu A X (2012), Semin Oncol 39: 493-502. and Huynh H (2010) Biochem Pharmacol 80: 550-560). However, it is well-known in the art that the benefits of current molecular targeted agents including sorafenib are very limited. The response rate in the phase III clinical trial using sorafenib is very low, i.e., only 2.3% to 3.30% (Villanueva A, et al., (2012) Clin Cancer Res 18: 1824-1826).

Biomarkers are increasingly used for diagnosis, prognosis, and therapeutic decision making in diverse cancers, propelling a paradigm shift in the management of cancer. Biomarkers have helped to stratify patients and thus achieve better outcomes from a given drug in the clinic Trastuzumab, a HER2 targeting monoclonal antibody, is effective in metastatic breast cancer patients with 3+ HER2 over-expression assessed by immunohistochemistry (IHC) or HER2 gene amplification (Vogel C L, et al., (2002) J Clin Oncol 20: 719-726). Also, patients with non-small cell lung cancer harboring activating mutations within the kinase domain of EGFR show impressive clinical responses to the EGFR inhibitor gefitinib (Lynch T J, et al., N Engl J Med 350: 2129-2139). This type of molecular classification which stratifies individual tumors into molecular subtypes for which targeted therapy could have potential efficacy is described as actionable molecular subtyping (West L, et al., PLoS One 7: e31906. and Vidwans S J, et al., PLoS One 6: e18257).

DISCLOSURE OF INVENTION

Technical Problem

The present inventors have found that the stratification of HCC patients by cluster analysis of mRNA expression of specific genes, i.e., VEGFR2, PDGFRβ, c-KIT, EGFR, c-RAF, mTOR, and FGFR1, as biomarkers makes it possible to select a patient having susceptibility to the treatment with sorafenib, one of the molecular targeted agents. Especially, it has been newly found that FGFR1 has relationship with susceptibility to sorafenib treatment. Therefore, the analysis on the mRNA expression of FGFR1, optionally along with the mRNA expression of other biomarkers (i.e., VEGFR2, PDGFRβ, c-KIT, c-RAF, EGFR, and/or mTOR), makes it possible to select a patient having susceptibility to sorafenib treatment and a patient having resistance to sorafenib treatment before employing molecular targeted therapy with sorafenib.

Therefore, it is an object of the present invention to provide an analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, which involves using FGFR1 as a biomarker or using VEGFR2, PDGFRβ, c-KIT, c-RAF, EGFR, and/or mTOR along with FGFR1 as biomarkers.

Solution to Problem

In accordance with an aspect of the present invention, there is provided an analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, the method of which comprises: (i) measuring mRNA expression levels of the gene of SEQ ID NO: 1 in both hepatocellular carcinoma tissues and normal tissues, which are externally discharged from the hepatocellular carcinoma patient, and (ii) measuring a ratio between the mRNA expression level of the gene of SEQ ID NO: 1 in the hepatocellular carcinoma tissues and the mRNA expression level of the gene of SEQ ID NO: 1 in the normal tissues.

In an embodiment, there is provided the analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, which comprises: (i′) measuring mRNA expression levels of the gene of SEQ ID NO: 1 and mRNA expression levels of one or more genes selected from the group consisting of SEQ ID NOs: 2 to 7 in both hepatocellular carcinoma tissues and normal tissues, which are externally discharged from the hepatocellular carcinoma patient, and (ii′) measuring the ratio between the mRNA expression level of the gene of SEQ ID NO: 1 in the hepatocellular carcinoma tissues and the mRNA expression level of the gene of SEQ ID NO: 1 in the normal tissues; and a ratio between the mRNA expression levels of one or more genes selected from the group consisting of SEQ ID NOs: 2 to 7 in the hepatocellular carcinoma tissues and the mRNA expression levels of one or more genes selected from the group consisting of SEQ ID NOs: 2 to 7 in the normal tissues.

In another embodiment, there is provided the analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, which comprises: (i″) measuring mRNA expression levels of the genes of SEQ ID NOs: 1, 3, 4, 6, and 7 in both hepatocellular carcinoma tissues and normal tissues, which are externally discharged from the hepatocellular carcinoma patient, and (ii″) measuring the ratio between the mRNA expression level of the genes of SEQ ID NOs: 1, 3, 4, 6, and 7 in the hepatocellular carcinoma tissues and the mRNA expression level of the genes of SEQ ID NOs: 1, 3, 4, 6, and 7 in the normal tissues.

In still another embodiment, there is provided an analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, the method of which comprises: (i′″) measuring mRNA expression levels of the genes of SEQ ID NOs: 1 to 7 in hepatocellular carcinoma tissues, which are externally discharged from the hepatocellular carcinoma patient, and (ii′″) calculating the sum of the mRNA expression levels.

In the analytical method of the present invention, the mRNA expression level may be measured by real-time reverse transcriptase-polymerase chain reaction.

Advantageous Effects of Invention

It has been found by the present invention that the stratification of HCC patients by cluster analysis of mRNA expression of specific genes, i.e., VEGFR2, PDGFRβ, c-KIT, EGFR, c-RAF, mTOR, and FGFR1, as biomarkers makes it possible to select patients having susceptibility to the treatment with sorafenib, one of the molecular targeted agents. In addition, it has been found by the present invention that a patient having susceptibility to sorafenib treatment can be selected by an analysis using only the tumor tissues, the analysis of which involves using the sum of the expression levels of said 7 marker genes. Especially, it has been newly found that FGFR1 has relationship with susceptibility to sorafenib treatment. Therefore, the analysis on the mRNA expression of FGFR1, optionally along with the mRNA expression of other biomarkers (i.e., VEGFR2, PDGFRβ, c-KIT, c-RAF, EGFR, and/or mTOR), makes it possible to select a patient having susceptibility to sorafenib treatment.

BRIEF DESCRIPTION OF DRAWINGS

FIG. 1 shows the frequency of mRNA over-expressions of 4 marker genes (VEGFR2, PDGFRβ, c-KIT, c-RAF), which are known as genes associated with the efficacy of sorafenib, in 130 HCC and matched non-tumor tissues.

FIG. 2 shows the expression levels of marker genes in matched non-tumor tissues and tumor tissues according to BCLC stages (A: Early, B: intermediate, C: Advanced). In FIG. 2, A to G respectively show the expression levels of VEGFR2 (A); PDGFRβ (B); c-KIT (C); c-RAF (D); EGFR (E); mTOR (F); and FGFR1 (G).

FIG. 3 shows the frequency of over-expression in tumor tissues compared to matched non-tumor tissues, through measuring the expression levels of 7 marker genes in tissues derived from paired 130 HCC patients.

FIG. 4 shows the frequency of over-expression in tumor tissues compared to non-tumor tissues according to the BCLC stages, through measuring the expression levels of 7 marker genes in tissues derived from paired 130 HCC patients.

FIG. 5 shows the results of hierarchical clustering analyses according to marker gene expression patterns for clustering the patients.

FIG. 6 shows the relationship between the marker gene expression patterns and the sorafenib efficacies, in the samples derived from 23 sorafenib-administered patients.

FIG. 7 shows the interactive dot diagram of NTBS values obtained from 23 sorafenib-administered patients (A); and the ROC (receiver operating characteristic) curve obtained therefrom (B).

BEST MODE FOR CARRYING OUT THE INVENTION

As used herein, the term “sorafenib” refers to the compound of the following Formula 1, including its pharmaceutically acceptable salt, for example p-toluenesulfonate salt.

The term “patient having susceptibility to sorafenib treatment” refers to a hepatocellular carcinoma patient showing response according to the sorafenib administration (i.e., tumor response). The “tumor response” refers to complete response, partial response, or stable disease according to the RECIST (Response Evaluation Criteria in Solid Tumors) defined in Llovet J M, et al. (2008) Sorafenib in advanced hepatocellular carcinoma. N Engl J Med 359: 378-390.

The term “hepatocellular carcinoma tissues” and “normal tissues” refer to the tissues samples externally discharged, via e.g., biopsy, from the hepatocellular carcinoma tissues and the surrounding non-tumor tissues derived from a hepatocellular carcinoma patient. In clinics, carcinoma tissues and surrounding normal tissues are generally collected from a patient and then tissue examinations thereof are carried out for diagnosing hepatocellular carcinoma and/or establishing therapeutic regimen. Therefore, the term “hepatocellular carcinoma tissues” and “normal tissues” refer to the tissues samples externally discharged from a patient, e.g., for tissue examination in clinics.

In order to improve very low response rate of sorafenib (about 3%), the present inventors carried out analyses on the expression patterns of various target biomarkers in tissue samples derived from HCC patients, including hierarchical clustering analyses. As a result thereof, it has been surprisingly found by the present invention that FGFR1 has relationship with susceptibility to sorafenib treatment, which was not reported in the previous literatures. That is, it has been newly found that a patient showing the mRNA expression level of the FGFR1 gene (the gene of SEQ ID NO: 1) lower in the tumor tissues than in the normal tissues has high resistance to sorafenib treatment, thereby exhibiting significantly low therapeutic efficacy. Therefore, through analyzing a ratio between the mRNA expression of FGFR1 (the gene of SEQ ID NO: 1) in normal tissues and the mRNA expression of FGFR1 (the gene of SEQ ID NO: 1) in hepatocellular carcinoma tissues, patient having susceptibility or resistance to sorafenib treatment can be selected in advance; and thus the response rate to sorafenib treatment can be remarkably increased.

Therefore, the present invention provides an analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, the method of which comprises: (i) measuring mRNA expression levels of the gene of SEQ ID NO: 1 in both hepatocellular carcinoma tissues and normal tissues, which are externally discharged from the hepatocellular carcinoma patient, and (ii) measuring a ratio between the mRNA expression level of the gene of SEQ ID NO: 1 in the hepatocellular carcinoma tissues and the mRNA expression level of the gene of SEQ ID NO: 1 in the normal tissues. In the analytical method of the present invention, if the T/N ratio (tumor/non-tumor ratio) of the mRNA expression level of the gene of SEQ ID NO: 1 in hepatocellular carcinoma tissues to the mRNA expression level of the gene of SEQ ID NO: 1 in normal tissues is more than 2, the patient can be classified to a patient having low resistance to sorafenib treatment, i.e., a patient having high susceptibility to sorafenib treatment.

And also, the present inventors carried out hierarchical clustering analyses on VEGFR2 (the gene of SEQ ID NO: 2), PDGFRβ (the gene of SEQ ID NO: 3), c-KIT (the gene of SEQ ID NO: 4), c-RAF (the gene of SEQ ID NO: 5), EGFR (the gene of SEQ ID NO: 6), and mTOR (the gene of SEQ ID NO: 7), in addition to FGFR1 (the gene of SEQ ID NO: 1). As a result thereof, it has been found that the analyses on such genes along with FGFR1 (the gene of SEQ ID NO: 1) make it possible to select hepatocellular carcinoma patients having susceptibility to sorafenib treatment in higher efficiency. Therefore, in an embodiment, the present invention provides an analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, which comprises: (i′) measuring mRNA expression levels of the gene of SEQ ID NO: 1 and mRNA expression levels of one or more genes selected from the group consisting of SEQ ID NOs: 2 to 7 in both hepatocellular carcinoma tissues and normal tissues, which are externally discharged from the hepatocellular carcinoma patient, and (ii′) measuring the ratio between the mRNA expression level of the gene of SEQ ID NO: 1 in the hepatocellular carcinoma tissues and the mRNA expression level of the gene of SEQ ID NO: 1 in the normal tissues; and a ratio between the mRNA expression levels of one or more genes selected from the group consisting of SEQ ID NOs: 2 to 7 in the hepatocellular carcinoma tissues and the mRNA expression levels of one or more genes selected from the group consisting of SEQ ID NOs: 2 to 7 in the normal tissues. In said embodiment, if (1) the T/N ratio (tumor/non-tumor ratio) of the mRNA expression level of the gene of SEQ ID NO: 1 in hepatocellular carcinoma tissues to the mRNA expression level of the gene of SEQ ID NO: 1 in normal tissues is more than 2; (2) the T/N ratio(s) of the mRNA expression level(s) of one or more genes selected from the group consisting of SEQ ID NOs: 2 to 5 in hepatocellular carcinoma tissues to the mRNA expression level(s) of one or more genes selected from the group consisting of SEQ ID NOs: 2 to 5 in normal tissues is more than 2; and (3) the T/N ratio(s) of the mRNA expression level(s) of one or more genes of SEQ ID NOs: 6 to 7 in hepatocellular carcinoma tissues to the mRNA expression level(s) of one or more genes selected from the group consisting of SEQ ID NOs: 6 to 7 in normal tissues is less than 2, the patient can be classified to a patient having low resistance to sorafenib treatment, i.e., a patient having high susceptibility to sorafenib treatment.

And also, it has been found that the genes of SEQ ID NOs: 3, 4, 6, and 7, among the genes of SEQ ID NOs: 2 to 7, are more preferable as genes for being analyzed in combination with the gene of SEQ ID NO: 1. Therefore, in another embodiment, the present invention provides an analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, which comprises: (i″) measuring mRNA expression levels of the genes of SEQ ID NOs: 1, 3, 4, 6, and 7 in both hepatocellular carcinoma tissues and normal tissues, which are externally discharged from the hepatocellular carcinoma patient, and (ii″) measuring the ratio between the mRNA expression level of the genes of SEQ ID NOs: 3, 4, 6, and 7 in the hepatocellular carcinoma tissues and the mRNA expression level of the genes of SEQ ID NOs: 1, 3, 4, 6, and 7 in the normal tissues. In said embodiment, if (1) the T/N ratio of the mRNA expression level of the gene of SEQ ID NO: 1 in hepatocellular carcinoma tissues to the mRNA expression level of the gene of SEQ ID NO: 1 in normal tissues is more than 2; (2) the T/N ratios of the mRNA expression levels of the genes of SEQ ID NOs: 3 and 4 in hepatocellular carcinoma tissues to the mRNA expression levels of the genes of SEQ ID NOs: 3 and 4 in normal tissues is more than 2; and (3) the T/N ratio of the mRNA expression level of the gene of SEQ ID NO: 6 and 7 in hepatocellular carcinoma tissues to the mRNA expression level of the gene of SEQ ID NO: 6 and 7 in normal tissues is less than 2, the patient can be classified to a patient having low resistance to sorafenib treatment, i.e., a patient having high susceptibility to sorafenib treatment.

In addition, it has been found that a patient having susceptibility to sorafenib treatment can be selected by an analysis using only the tumor tissues, the analysis of which involves using a new parameter, i.e., NTBS (Nexavar Treatment Benefit Score). The NTBS refers to the sum of the expression levels of said 7 marker genes. That is, the NTBS value refers to the sum of each mRNA expression level (2−ΔCT) of the marker genes of SEQ ID NOs: 1 to 7. Therefore, in still another embodiment, the present invention provides an analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment, which comprises: (i′″) measuring mRNA expression levels of the genes of SEQ ID NOs: 1 to 7 in hepatocellular carcinoma tissues, which are externally discharged from the hepatocellular carcinoma patient, and (ii′″) calculating the sum of the mRNA expression levels. In said embodiment, if the sum of all the mRNA expression levels of the genes of SEQ ID NOs: 1 to 7 in hepatocellular carcinoma tissues (i.e., NTBS value) is more than a threshold value (e.g., 0.0758), preferably more than 0.1, the patient can be classified to a patient having susceptibility to sorafenib treatment.

In the analytical method of the present invention, the mRNA expression level may be measured according to conventional methods used in the field of biotechnology, for example, according to real-time reverse transcriptase-polymerase chain reaction (real-time RT-PCR). The real-time RT-PCR may be performed with an appropriate primer set for each gene. The primer set may be a known primer set; or prepared according to conventional methods.

The present invention will be described in further detail with reference to the following examples. These examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

1. Test Methods

(1) Patients, Materials and Methods

Hepatocellular carcinoma (HCC) tissues and corresponding non-cancerous hepatic tissues were obtained with informed consent from 130 patients who had undergone curative resection for primary HCC between 1998 and 2006 at the Ajou and Samsung Medical Centers in South Korea. The study protocol was approved by the Institutional Review Board of each Medical Center. Table 1 summarizes the demographic characteristics of the 130 HCC patients investigated in the current study. The present inventors used BCLC stage and Edmondson and Steiner grade according to the published criteria (Forner A, et al., (2010) Semin Liver Dis 30: 61-74. 346; and Edmondson H A, et al., (1954) Cancer 7: 462-503).


TABLE 1
Charac-
Charac-
Variables
teristics
Number
Variables
teristics
Number
Age
<55 years
80
Child-Pugh
A
126
≥55 years
50
class
B
4
Gender
Male
97
C
0
Female
33
BCLC stage
A
74
HBV
Absent
30
B
39
Present
100
C
17
HCV
Absent
118
Vascular
Absent
57
Present
12
invasion
Present
73
Liver
Absent
69
Tumor number
Single
104
cirrhosis−1
Present
60
Multiple
26
AFP level
<100 ng/mL
75
Tumor size
≤5 cm
93
≥100 ng/mL
55
>5 cm
37
Tumor
I
55
Edmondson
I
18
stage
II
49
grade
II
95
III
25
III
17
IV
1
IV
0
* minus values mean the number of patients without the relevant clinicopathology information

<2> RNA Extraction, cDNA Synthesis, and Real-Time RT-PCR

Total RNAs were extracted from the HCC tissues and the surrounding normal tissues with RNeasy Mini kit (Qiagen, Germany) according to the vendor's instruction. The resulting total RNA extracts were subject to quantitative analysis using Bioanalyzer 2100 (Agilent Technologies, USA). During the extraction, contaminants (i.e., genome DNAs) were removed by treating the RNA extracts with DNase I. Each total RNA (4 μg) was reacted with 2 μl of 1 μM oligo d(T) 18 primer (Genotech, Korea) at 70° C. for 7 minutes and then cooled over ice for 5 minutes. An enzyme mixture [0.1 M DTT (Duchefa, Nethelands) 2 μl, 10× reverse transcriptase buffer 2 μl, 2 mM dNTP 5 μl, 200 U/μl MMLV reverse transcriptase 1 μl, and 40 U/μl RNase inhibitor (Enzynomics, Korea) 1 μl; total 11 μl] was separately prepared. The enzyme mixture was added to the RNA-containing mixture. The resulting mixture was incubated at 42° C. for 90 minutes and then at 80° C. for 10 minutes to inactivate the reverse transcriptase. Diethyl pyrocarbonate (DEPC)-treated water was added to the mixture to obtain a cDNA-containing solution having 400 μl of the final volume. The resulting solution was used for quantitative real time RT-PCR.

Real-time RT-PCR was carried out as described previously (Kwon J H, et al., (2010) Clin Cancer Res 16: 350 5511-5521). Briefly, the each cDNA sample was subject to real time RT-PCR on the gene marker, using PRISM 7900HT (Applied Biosystems, USA) according to the vendor's instruction. Real-time RT-PCR was performed with a solution (10 μl in total) containing 2× TaqMan Gene Expression Master Mix (Applied Biosystems, USA) 5 μl, 5 μM sense primer 1 μl, 5 μM antisense primer 1 μl, 1 μM probe (Genotech, Korea) 1 μl, cDNA 2 μl (in case of the control group, the same volume of water). After the initial denaturation at 95° C. for 10 minutes, the amplification was carried out in the cycle of denaturation at 95° C. for 15 seconds and extension at 60° C. for 1 minute. The primers and probes were prepared using Primer Express 3.0 (Applied Biosystems, USA) and then labeled with FAM and TAMRA at the 5′ end and 3′ end, respectively. The expressions of each marker gene were measured in triplicate and then normalized to 5 reference genes (B2M, GAPDH, HMBS, HPRT1, and SDHA) by subtracting the average values of the mRNA levels of the reference genes. The CTs (number of cycles for attaining to the threshold) of each marker gene were measured. From the ΔCT values (CT of the marker gene—average CT of reference genes), the mRNA expression levels thereof were calculated as 2−ΔCT. The primers and probes of each marker gene are shown in Table 2 below.


TABLE 2
Gene
Sequence
SEQ ID
B2M
F
CATTCGGGCCGAGATGTCT
 8
R
CTCCAGGCCAGAAAGAGAGAGTAG
 9
P
CCGTGGCCTTAGCTGTGCTCGC
10
GAPDH
F
CACATGGCCTCCAAGGAGTAA
11
R
TGAGGGTCTCTCTCTTCCTCTTGT
12
P
CTGGACCACCAGCCCCAGCAAG
13
HMBS
F
CCAGGGATTTGCCTCACCTT
14
R
AAAGAGATGAAGCCCCCACAT
15
P
CCTTGATGACTGCCTTGCCTCCTCAG
16
HPRT1
F
GCTCGAGATGTGATGAAGGAGAT
17
R
CCAGCAGGTCAGCAAAGAATT
18
P
CCATCACATTGTAGCCCTCTGTGTGCTC
19
SDHA
F
CACCTAGTGGCTGGGAGCTT
20
R
GCCCAGTTTTATCATCTCACAAGA
21
P
TGGCACTTACCTTTGTCCCTTGCTTCA
22
EGFR
F
GAAGGAGCTGCCCATGAGAA
23
R
GACTATGTCCCGCCACTGGAT
24
P
AAATCCTGCATGGCGCCGTGC
25
VEGFR2
F
CACCACTCAAACGCTGACATGTA
26
R
CCAACTGCCAATACCAGTGGAT
27
P
TATGCCATTCCTCCCCCGCATCA
28
PDGFRβ
F
AGCGCTGGCGAAATCG
29
R
TTCACGCGAACCAGTGTCA
30
P
CTGTCCACGCGCAACGTGTCG
31
FGFR1
F
CACGGGACATTCACCACATC
32
R
GGGTGCCATCCACTTCACA
33
P
ACTATAAAAAGACAACCAACGGCCGACTGC
34
mTOR
F
AGGCCGCATTGTCTCTATCAA
35
R
GCAGTAAATGCAGGTAGTCATCCA
36
P
TGCAATCCAGCTGTTTGGCGCC
37
C-RAF
F
GAGGTCGACATCCACACCTAATG
38
R
TCGAATTGCATCCTCAATCATC
39
P
CCACATGGTCAGCACCACCCTGC
40
C-KIT
F
CAGATTTCAGAGAGCACCAATCA
41
R
AATGGTCTACCACGGGCTTCT
42
P
TTACTCCAACTTAGCAAACTGCAGCCCCAA
43

<3> Calculation of NTBS (Nexavar Treatment Benefit Score)

In order to evaluate whether a patient having susceptibility to sorafenib treatment can be selected using only the tumor tissues, we introduce a new parameter, i.e., NTBS (Nexavar Treatment Benefit Score), based on the expression levels of 7 marker genes in the tumor tissues. The NTBS value was calculated by the following formula:

NTBS=GVEGFR2+GPDGFRβ+Gc-KIT+Gc-RAF+GEGFR+GmTOR+GFGFR1

In the above formula, GVEGFR2, GPDGFRβ, Gc-KIT, Gc-RAF, GEGFR, GmTOR, and GFGFR1 refer to the mRNA expression levels (2−ΔCT) of the corresponding marker genes in the tumor tissues, respectively.

<4> Statistical Analysis

Statistical analyses in this study were carried out with the open source statistical programming environment R. 2−ΔCT values of each gene were shown in box and whisker plot and the difference between tumor and non-tumor tissues was evaluated for significance using Student's t-test. The relationship of gene expression with clinicopathologic variables was evaluated using χ2 and Fisher's exact tests. Up-regulated, unchanged, or down-regulated gene expression was evaluated using the fold difference of 2−ΔCT values between the tumors and the surrounding non-tumor tissues. Hierarchical clustering analyses of the T/N ratios (tumor/non-tumor) of 2−ΔCT values were performed for patient stratification.

2. Test Results

(1) Frequency of mRNA Over-Expressions of the Marker Genes Associated with the Efficacy of Sorafenib

In many kinds of cancer, the expressions of marker genes have been shown to be aberrantly regulated. The present inventors therefore investigated mRNA over-expressions for 4 marker genes (i.e., VEGFR2, PDGFRβ, c-KIT and c-RAF, which are known as genes associated with the efficacy of sorafenib) in 130 HCC and matched non-tumor tissues. The results are shown in FIG. 1. We considered at least twofold higher expression level (2−ΔCT) of each marker gene in tumor tissues than that in non-tumor tissues as over-expression thereof.

As shown in FIG. 1, 80.0% of the patients showed over-expression of at least one marker gene among the 4 marker genes. 21.54% of the patients showed over-expression of only one marker gene; 23.1% of the patients showed over-expression of two marker genes; 18.5% of the patients showed over-expression of three marker genes; and 16.9% of the patients showed over-expression of all the four marker genes. The results thereof suggest that the efficacy of sorafenib cannot be determined based on only over-expressions of said marker genes that are previously known as genes associated with the efficacy of sorafenib. Therefore, the present inventors performed analyses on expressions of various marker genes in addition to said marker genes (VEGFR2, PDGFRβ, c-KIT, c-RAF); and hierarchical clustering analyses thereof. As a result thereof, we confirmed that the additional 3 marker genes (EGFR, mTOR, FGFR1) as well as said marker genes (VEGFR2, PDGFRβ, c-KIT, c-RAF) need to be analyzed for clustering the patients showing different efficacy and safety profiles to sorafenib treatment (data not shown).

(2) Characterization of 7 Marker Gene Expressions

The expression levels (2−ΔCT) of 7 marker genes were analyzed in non-tumor tissues (NT) and tumor tissues (T) according to the Box-Whisker plot method. The expression levels of the marker genes at each BCLC stage (A: Early, B: intermediate, C: Advanced) were also analyzed in non-tumor tissues and tumor tissues (T). The difference of each marker gene expression between in tumor and in non-tumor tissues was evaluated for significance using Student's t-test and P values of <0.05 were considered statistically significant. The results thereof are shown in FIG. 2 In the FIG. 2, A to G respectively show the expression levels of VEGFR2 (A); PDGFRβ (B); c-KIT (C); c-RAF (D); EGFR (E); mTOR (F); and FGFR1 (G).

In case of VEGFR2 (FIG. 2A), the expression was up-regulated in all patients' tumor tissues compared to non-tumor tissues, but the difference thereof was statistically insignificant. However, the expression level was significantly higher in BCLC stage A patients' tumor tissues. The expression levels were also higher in BCLC stage B and C patients' tumor tissues, but each difference thereof was statistically insignificant.

In case of PDGFRβ (FIG. 2B), the expression was significantly higher in all patients' tumor tissues, as well as all BCLC stage A, B and C patients' tumor tissues, compared to non-tumor tissues.

In case of c-KIT (FIG. 2C), the expression was significantly higher in all patients' tumor tissues, as well as BCLC stage A and B patients' tumor tissues, in comparison to non-tumor tissues. The expression level was higher in BCLC stage C patients' tumor tissues compared to non-tumor tissues, but the difference thereof was statistically insignificant.

In case of c-RAF (FIG. 2D), the expression was significantly higher in all patients' tumor tissues, as well as all BCLC stage A, B and C patients' tumor tissues, compared to non-tumor tissues.

In case of EGFR (FIG. 2E), the expression level was significantly higher in all patients' tumor tissues compared to non-tumor tissues. However, the expression level was significantly higher only in BCLC stage A patients' tumor tissues. The expression level was also higher in BCLC stage B patients' tumor tissues, but the difference thereof was statistically insignificant. The expression level was even lower in BCLC stage C patients' tumor tissues, but the difference thereof was also statistically insignificant.

In case of mTOR (FIG. 2F), the expression was significantly higher in all patients' tumor tissues, as well as all BCLC stage A, B and C patients' tumor tissues, compared to non-tumor tissues.

In case of FGFR1 (FIG. 2G), the expression was even lower in all patients' tumor tissues, as well as all BCLC stage A, B and C patients' tumor tissues, compared to non-tumor tissues, but the differences thereof were statistically insignificant.

(3) Characterization of the Frequency of 7 Marker Gene Expressions

The present inventors measured the expression levels of 7 marker genes in the tumor tissues and the surrounding non-tumor tissues derived from 130 HCC patients and then investigated the frequency of over-expression in tumor tissues compared to non-tumor tissues. The results thereof are shown in FIG. 3. In FIG. 3, the red color shows the patients having at least twofold higher expression in tumor tissues compared to non-tumor tissues; the green color shows the patients having at least twofold lower expression in tumor tissues compared to non-tumor tissues; the black color shows the patients having expression higher or lower less than two times in tumor tissues compared to non-tumor tissues, i.e., the patients who were considered to have no significant difference. EGFR mRNA levels were up-regulated in 35.4% of the tumors and unchanged in 47.7% of the tumors. VEGFR2 was up-regulated, unchanged, and down-regulated in 42.3%, 39.2%, and 18.5% of the tumors, respectively. PDGFRβ was up-regulated in tumors at a high rate (61.5%). While patients with unchanged and down-regulated expression of FGFR1 were 40% and 35.4%, respectively, only 24.6% of the patients showed up-regulation of FGFR1 in the tumors. mTOR was found to be up-regulated in half of the tumors.

In addition, we measured the expression levels of 7 marker genes in the tumor tissues and the surrounding non-tumor tissues derived from 130 HCC patients and then examined the frequency of over-expression in tumor tissues compared to non-tumor tissues, according to the BCLC stages. The results thereof are shown in FIG. 4. In FIG. 4, the red color shows the patients having at least twofold higher expression in tumor tissues compared to non-tumor tissues; the green color shows the patients having at least twofold lower expression in tumor tissues compared to non-tumor tissues; the black color shows the patients having expression higher or lower less than two times in tumor tissues compared to non-tumor tissues, i.e., the patients who were considered to have no significant difference. Up-regulation of EGFR was observed in 41.9% of the tumors at BCLC stage A but the proportion decreased by 17.6% at later stages and down-regulation of EGFR was prominently found in advanced stage tumors (35.3%). The stage association of VEGFR2 up-regulation was similar to that of EGFR. Up-regulation of PDGFRβ was observed in 66.2%, 51.3%, and 64.7% of the tumors at BCLC stages A, B, and C, respectively. FGFR1 levels were up-regulated in about 20% of the tumors irrespective of stage. mTOR was up-regulated in about half of the tumors in all the stages.

(4) Association of Clinical Characteristics with Marker Gene Expression

To gain further insight into the gene expression of biomarkers in HCC, the relationships between mRNA levels of the genes and clinicopathologic features were investigated. High mRNA expression of EGFR was correlated with the BCLC stage (P=0.049, Tables 3 and 4). The degree of tumor differentiation (Edmondson grade) was significantly associated with expression of both EGFR and VEGFR2 (P=0.003 and 0.004, respectively), which showed that well-differentiated HCC tended to express EGFR and VEGFR2 at high levels. EGFR was significantly over-expressed in single tumors (P=0.001).


TABLE 3
EGFR
VEGFR2
PDGFRβ
Low
High
p
Low
High
p
Low
High
p
(n = 22)
(n = 46)
Value
(n = 24)
(n = 55)
Value
(n = 15)
(n = 80)
Value
Age
 <55 years
15
24
0.324
18
30
0.144
9
51
0.988
≥55 years
7
22
6
25
6
29
Gender
Male
17
33
0.849
16
40
0.783
10
60
0.53
Female
5
13
8
15
5
20
HBV
Absent
4
14
0.437
3
18
0.111
2
21
0.348
Present
18
32
21
37
13
59
HCV
Absent
19
41
0.707
22
47
0.715
14
72
1
Present
3
5
2
8
1
8
Liver
Absent
12
26
0.991
14
33
0.985
7
46
0.587
cirrhosis
Present
10
19
10
21
8
33
Tumor stage
I-II
15
40
0.098
18
43
0.985
14
64
0.293
III-IV
7
6
6
12
1
16
Child-Pugh
A
22
44
1
22
53
0.581
15
77
1
class
B
0
2
2
2
0
3
BCLC stage
A
10
31
0.049
14
34
0.614
10
49
0.844
B
6
12
6
16
4
20
C
6
3
4
5
1
11
AFP level
 <100 ng/ml
10
29
0.267
11
39
0.061
9
49
0.844
≥100 ng/ml
12
17
13
16
6
31
Vascular
Absent
7
22
0.324
7
29
0.091
8
34
0.623
invasion
Present
15
24
17
26
7
46
Tumor
Single
11
41
0.001
18
47
0.338
13
67
1
number
Multiple
11
5
6
8
2
13
Tumor size
≤5 cm
15
35
0.691
17
40
0.92
11
61
0.754
 >5 cm
7
11
7
15
4
19
Edmondson
I
0
14
0.003
0
15
0.004
2
12
1
grade
II-III
22
32
24
40
13
68


TABLE 4
FGFR1
mTOR
Low
High
Low
High
(n =
(n =
p
(n =
(n =
p
46)
32)
Value
12)
65)
Value
Age
 <55 years
26
24
0.152
8
41
1
≥55 years
20
8
4
24
Gender
Male
35
21
0.451
9
44
0.744
Female
11
11
3
21
HBV
Absent
7
3
0.513
0
13
0.201
Present
39
29
12
52
HCV
Absent
41
31
0.392
12
60
1
Present
5
1
0
5
Liver
Absent
21
18
0.403
5
34
0.717
cirrhosis
Present
25
13
7
31
Tumor stage
I-II
40
26
0.536
12
50
0.109
III-IV
6
6
0
15
Child-Pugh
A
45
32
1
12
64
1
class
B
1
0
0
1
BCLC stage
A
27
20
0.7
8
35
0.456
B
15
8
4
20
C
4
4
0
10
AFP level
 <100 ng/ml
24
21
0.342
7
39
1
≥100 ng/ml
22
11
5
26
Vascular
Absent
17
14
0.713
6
28
0.899
invasion
Present
29
18
6
37
Tumor
Single
38
26
0.884
11
52
0.684
number
Multiple
8
6
1
13
Tumor size
≤5 cm
32
24
0.788
9
46
1
 >5 cm
14
8
3
19
Edmondson
I
4
6
0.302
1
12
0.679
grade
II-III
42
26
11
53

(5) Hierarchical Clustering Analysis

The present inventors carried out a hierarchical clustering analysis for clustering the patients. The results thereof are shown in FIG. 5. The expression levels of each marker gene (2−ΔCT) were calculated as a ratio of the expression level of the marker gene in tumor tissues to the expression level of the marker gene in non-tumor tissues (i.e., tumor/non-tumor). In FIG. 5, the red color shows the patients having at least fourfold higher expression in tumor tissues compared to non-tumor tissues; the dark red color shows the patients having at least twofold higher expression in tumor tissues compared to non-tumor tissues; the black color shows the patients having expression higher or lower less than two times in tumor tissues compared to non-tumor tissues, i.e., the patients having no significant difference between the expression levels; the dark green color shows the patients having at least twofold lower expression in tumor tissues compared to non-tumor tissues; and the green color shows the patients having at least fourfold lower expression in tumor tissues compared to non-tumor tissues. In the BCLC stage which means a hepatocellular carcinoma stage, A shows an early-HCC (blue color); B shows an intermediate-HCC (green color); and C shows an advanced-HCC (red color). In FIG. 5, the row means individual target molecules; and the column means the 130 individual patents. The patients were primarily categorized according to the BCLC stages and then clustered according to the expression ratios (tumor/non-tumor) of the target molecules.

As shown in FIG. 5, it can be seen that the 130 patients can be classified into a certain cluster according to the BCLC stages and the marker genes. That is, the patients over-expressing all the 7 marker genes in the BCLC stage A can be classified into the ‘Patient Group aI’; the patients over-expressing the 5 marker genes (VEGFR2, PDGFRβ, c-KIT, c-RAF and FGFR1) but down-expressing the 2 genes (EGFR and mTOR) in the BCLC stage A can be classified into the ‘Patient Group aII’; and the patients down-expressing all the 7 marker genes in the BCLC stage A can be classified into the ‘Patient Group aIII’. Patients of the BCLC stages B and C can be classified according to the same manners as in the BCLC stage A. Therefore, through the hierarchical cluster analysis, it can be expected that patients showing different biomarker expressions will result in different efficacy and safety profiles to a molecular targeted agent, e.g., sorafenib.

(6) Susceptibility Assay in Sorafenib-Administered Patients

In the samples derived from 23 sorafenib-administered patients, we analyzed the relationship between the 7 marker gene expression patterns and the sorafenib efficacies. From the hierarchical clustering analysis results of FIG. 5, clustering without primary classification according to BCLC stages was performed according to expression ratio (tumor/non-tumor) of the target molecules; and then the 23 sorafenib-administered patients (i to xxiii) were correspondingly arranged thereto (FIG. 6). Among the 23 sorafenib-administered patients, only the patients “viii, x, xi” were susceptible to the sorafenib treatment, i.e. showed partial response according to RECIST (Response Evaluation Criteria in Solid Tumors) which is defined in Llovet J M, et al. (2008) Sorafenib in advanced hepatocellular carcinoma. N Engl J Med 359: 378-390. The remaining 20 patients were not susceptible to the sorafenib treatment.

When the 23 sorafenib-administered patients' susceptible/unsusceptible responses were correspondingly arranged to the hierarchical clustering analysis results, it can be seen that the patients down-expressing mRNA of the FGFR1 gene (the gene of SEQ ID NO: 1) (i.e., patients i to vii, ix, and xii to xxiii) in the tumor tissues were not susceptible to the sorafenib treatment. Therefore, if the expression level of mRNA of the FGFR1 gene is higher in the HCC tumor tissues than the expression level thereof in the normal tissues [i.e., when the T/N (tumor/non-tumor) ratio of the FGFR1 gene is more than 2], the patient can be classified to a patient having low resistance to sorafenib treatment, i.e., a patient having high susceptibility to sorafenib treatment. Since there is no report regarding the relationship between sorafenib and the FGFR1 gene, these results are very surprising

And also, the analyses on mRNA expression of VEGFR2 (the gene of SEQ ID NO: 2), PDGFRβ (the gene of SEQ ID NO: 3), c-KIT (the gene of SEQ ID NO: 4), and c-RAF (the gene of SEQ ID NO: 5) which are known as target genes of sorafenib; and/or EGFR (the gene of SEQ ID NO: 6) and mTOR (the gene of SEQ ID NO: 7) which are known as resistant genes to sorafenib, in combination with mRNA expression of the FGFR1 gene, make it possible to more efficiently select the patients having susceptibility to sorafenib treatment. For example, if (1) the T/N ratio of the FGFR1 gene is more than 2; (2) the T/N ratio(s) of one or more genes selected from the group consisting of VEGFR2, PDGFRβ, c-KIT, and c-RAF is (are) more than 2; and (3) the T/N ratio(s) of one or more genes selected from the group consisting of EGFR and mTOR is (are) less than 2, the patient can be classified to a patient having low resistance to sorafenib treatment, i.e., a patient having high susceptibility to sorafenib treatment.

From the results of FIG. 6, it can be also seen that PDGFRβ (the gene of SEQ ID NO: 3), c-KIT (the gene of SEQ ID NO: 4), EGFR (the gene of SEQ ID NO: 6), and mTOR (the gene of SEQ ID NO: 7) among them are more preferable as genes for analyzing in combination with the FGFR1 gene. Therefore, for example, if (1) the T/N ratio of the FGFR1 gene is more than 2; (2) the T/N ratios of PDGFRβ and c-KIT are more than 2; and (3) the T/N ratio of EGFR and mTOR is less than 2, the patient can be classified to a patient having low resistance to sorafenib treatment, i.e., a patient having high susceptibility to sorafenib treatment.

(7) Susceptibility Assay Based on NTBS Values in Sorafenib-Administered Patients

The present inventors also evaluated whether a patient having susceptibility to sorafenib treatment can be selected using only the tumor tissues. We calculated the NTBS value based on the mRNA expression levels of 7 marker genes in each 23 sorafenib-administered patients' tumor tissues. The results thereof are shown in FIG. 7 (A) and Table 5 below.


TABLE 5
HCC patients
NTBS
i
0.001851
ii
0.001784
iii
0.029121
iv
0.002138
v
0.059301
vi
0.033066
vii
0.018625
viii
0.1735
ix
0.003082
x
0.11626
xi
0.1144
xii
0.027969
xiii
−0.00073
xiv
0.047356
xv
0.07577
xvi
0.029827
xvii
−0.00108
xviii
0.003726
xix
0.029899
xx
0.00343
xxi
0.028935
xxii
0.027161
xxiii
−0.00165

In FIG. 7 (A), S refers to the NTBS values obtained from the patients susceptible to the sorafenib treatment (i.e. patients viii, x, and xi); and R refers to the NTBS values obtained from the patients not susceptible to the sorafenib treatment (i.e. patients i to vii, ix, and xii to xxiii). The ROC (receiver operating characteristic) curve obtained from the NTBS values is shown in FIG. 7 (B). The threshold value calculated from the analysis of ROC curve was 0.0758. From the above results, it can be seen that a patient having susceptibility to sorafenib treatment can be selected using the parameter, i.e., NTBS. That is, if the NTBS value is more than the threshold value (i.e., 0.0758), preferably more than 0.1, the patient can be classified to a patient having susceptibility to sorafenib treatment.

<160> NUMBER OF SEQ ID NOS: 43

<210> SEQ ID NO: 1

<211> LENGTH: 5895

<212> TYPE: DNA

<213> ORGANISM: homo sapiens

<400> SEQENCE: 1

agatgcaggg gcgcaaacgc caaaggagac caggctgtag gaagagaagg gcagagcgcc 60

ggacagctcg gcccgctccc cgtcctttgg ggccgcggct ggggaactac aaggcccagc 120

aggcagctgc agggggcgga ggcggaggag ggaccagcgc gggtgggagt gagagagcga 180

gccctcgcgc cccgccggcg catagcgctc ggagcgctct tgcggccaca ggcgcggcgt 240

cctcggcggc gggcggcagc tagcgggagc cgggacgccg gtgcagccgc agcgcgcgga 300

ggaacccggg tgtgccggga gctgggcggc cacgtccgga cgggaccgag acccctcgta 360

gcgcattgcg gcgacctcgc cttccccggc cgcgagcgcg ccgctgcttg aaaagccgcg 420

gaacccaagg acttttctcc ggtccgagct cggggcgccc cgcagggcgc acggtacccg 480

tgctgcagtc gggcacgccg cggcgccggg gcctccgcag ggcgatggag cccggtctgc 540

aaggaaagtg aggcgccgcc gctgcgttct ggaggagggg ggcacaaggt ctggagaccc 600

cgggtggcgg acgggagccc tccccccgcc ccgcctccgg ggcaccagct ccggctccat 660

tgttcccgcc cgggctggag gcgccgagca ccgagcgccg ccgggagtcg agcgccggcc 720

gcggagctct tgcgaccccg ccaggacccg aacagagccc gggggcggcg ggccggagcc 780

ggggacgcgg gcacacgccc gctcgcacaa gccacggcgg actctcccga ggcggaacct 840

ccacgccgag cgagggtcag tttgaaaagg aggatcgagc tcactgtgga gtatccatgg 900

agatgtggag ccttgtcacc aacctctaac tgcagaactg ggatgtggag ctggaagtgc 960

ctcctcttct gggctgtgct ggtcacagcc acactctgca ccgctaggcc gtccccgacc 1020

ttgcctgaac aagcccagcc ctggggagcc cctgtggaag tggagtcctt cctggtccac 1080

cccggtgacc tgctgcagct tcgctgtcgg ctgcgggacg atgtgcagag catcaactgg 1140

ctgcgggacg gggtgcagct ggcggaaagc aaccgcaccc gcatcacagg ggaggaggtg 1200

gaggtgcagg actccgtgcc cgcagactcc ggcctctatg cttgcgtaac cagcagcccc 1260

tcgggcagtg acaccaccta cttctccgtc aatgtttcag atgctctccc ctcctcggag 1320

gatgatgatg atgatgatga ctcctcttca gaggagaaag aaacagataa caccaaacca 1380

aaccgtatgc ccgtagctcc atattggaca tccccagaaa agatggaaaa gaaattgcat 1440

gcagtgccgg ctgccaagac agtgaagttc aaatgccctt ccagtgggac cccaaacccc 1500

acactgcgct ggttgaaaaa tggcaaagaa ttcaaacctg accacagaat tggaggctac 1560

aaggtccgtt atgccacctg gagcatcata atggactctg tggtgccctc tgacaagggc 1620

aactacacct gcattgtgga gaatgagtac ggcagcatca accacacata ccagctggat 1680

gtcgtggagc ggtcccctca ccggcccatc ctgcaagcag ggttgcccgc caacaaaaca 1740

gtggccctgg gtagcaacgt ggagttcatg tgtaaggtgt acagtgaccc gcagccgcac 1800

atccagtggc taaagcacat cgaggtgaat gggagcaaga ttggcccaga caacctgcct 1860

tatgtccaga tcttgaagac tgctggagtt aataccaccg acaaagagat ggaggtgctt 1920

cacttaagaa atgtctcctt tgaggacgca ggggagtata cgtgcttggc gggtaactct 1980

atcggactct cccatcactc tgcatggttg accgttctgg aagccctgga agagaggccg 2040

gcagtgatga cctcgcccct gtacctggag atcatcatct attgcacagg ggccttcctc 2100

atctcctgca tggtggggtc ggtcatcgtc tacaagatga agagtggtac caagaagagt 2160

gacttccaca gccagatggc tgtgcacaag ctggccaaga gcatccctct gcgcagacag 2220

gtgtctgctg actccagtgc atccatgaac tctggggttc ttctggttcg gccatcacgg 2280

ctctcctcca gtgggactcc catgctagca ggggtctctg agtatgagct tcccgaagac 2340

cctcgctggg agctgcctcg ggacagactg gtcttaggca aacccctggg agagggctgc 2400

tttgggcagg tggtgttggc agaggctatc gggctggaca aggacaaacc caaccgtgtg 2460

accaaagtgg ctgtgaagat gttgaagtcg gacgcaacag agaaagactt gtcagacctg 2520

atctcagaaa tggagatgat gaagatgatc gggaagcata agaatatcat caacctgctg 2580

ggggcctgca cgcaggatgg tcccttgtat gtcatcgtgg agtatgcctc caagggcaac 2640

ctgcgggagt acctgcaggc ccggaggccc ccagggctgg aatactgcta caaccccagc 2700

cacaacccag aggagcagct ctcctccaag gacctggtgt cctgcgccta ccaggtggcc 2760

cgaggcatgg agtatctggc ctccaagaag tgcatacacc gagacctggc agccaggaat 2820

gtcctggtga cagaggacaa tgtgatgaag atagcagact ttggcctcgc acgggacatt 2880

caccacatcg actactataa aaagacaacc aacggccgac tgcctgtgaa gtggatggca 2940

cccgaggcat tatttgaccg gatctacacc caccagagtg atgtgtggtc tttcggggtg 3000

ctcctgtggg agatcttcac tctgggcggc tccccatacc ccggtgtgcc tgtggaggaa 3060

cttttcaagc tgctgaagga gggtcaccgc atggacaagc ccagtaactg caccaacgag 3120

ctgtacatga tgatgcggga ctgctggcat gcagtgccct cacagagacc caccttcaag 3180

cagctggtgg aagacctgga ccgcatcgtg gccttgacct ccaaccagga gtacctggac 3240

ctgtccatgc ccctggacca gtactccccc agctttcccg acacccggag ctctacgtgc 3300

tcctcagggg aggattccgt cttctctcat gagccgctgc ccgaggagcc ctgcctgccc 3360

cgacacccag cccagcttgc caatggcgga ctcaaacgcc gctgactgcc acccacacgc 3420

cctccccaga ctccaccgtc agctgtaacc ctcacccaca gcccctgctg ggcccaccac 3480

ctgtccgtcc ctgtcccctt tcctgctggc aggagccggc tgcctaccag gggccttcct 3540

gtgtggcctg ccttcacccc actcagctca cctctccctc cacctcctct ccacctgctg 3600

gtgagaggtg caaagaggca gatctttgct gccagccact tcatcccctc ccagatgttg 3660

gaccaacacc cctccctgcc accaggcact gcctggaggg cagggagtgg gagccaatga 3720

acaggcatgc aagtgagagc ttcctgagct ttctcctgtc ggtttggtct gttttgcctt 3780

cacccataag cccctcgcac tctggtggca ggtgccttgt cctcagggct acagcagtag 3840

ggaggtcagt gcttcgtgcc tcgattgaag gtgacctctg ccccagatag gtggtgccag 3900

tggcttatta attccgatac tagtttgctt tgctgaccaa atgcctggta ccagaggatg 3960

gtgaggcgaa ggccaggttg ggggcagtgt tgtggccctg gggcccagcc ccaaactggg 4020

ggctctgtat atagctatga agaaaacaca aagtgtataa atctgagtat atatttacat 4080

gtctttttaa aagggtcgtt accagagatt tacccatcgg gtaagatgct cctggtggct 4140

gggaggcatc agttgctata tattaaaaac aaaaaagaaa aaaaaggaaa atgtttttaa 4200

aaaggtcata tattttttgc tacttttgct gttttatttt tttaaattat gttctaaacc 4260

tattttcagt ttaggtccct caataaaaat tgctgctgct tcatttatct atgggctgta 4320

tgaaaagggt gggaatgtcc actggaaaga agggacaccc acgggccctg gggctaggtc 4380

tgtcccgagg gcaccgcatg ctcccggcgc aggttccttg taacctcttc ttcctaggtc 4440

ctgcacccag acctcacgac gcacctcctg cctctccgct gcttttggaa agtcagaaaa 4500

agaagatgtc tgcttcgagg gcaggaaccc catccatgca gtagaggcgc tgggcagaga 4560

gtcaaggccc agcagccatc gaccatggat ggtttcctcc aaggaaaccg gtggggttgg 4620

gctggggagg gggcacctac ctaggaatag ccacggggta gagctacagt gattaagagg 4680

aaagcaaggg cgcggttgct cacgcctgta atcccagcac tttgggacac cgaggtgggc 4740

agatcacttc aggtcaggag tttgagacca gcctggccaa cttagtgaaa ccccatctct 4800

actaaaaatg caaaaattat ccaggcatgg tggcacacgc ctgtaatccc agctccacag 4860

gaggctgagg cagaatccct tgaagctggg aggcggaggt tgcagtgagc cgagattgcg 4920

ccattgcact ccagcctggg caacagagaa aacaaaaagg aaaacaaatg atgaaggtct 4980

gcagaaactg aaacccagac atgtgtctgc cccctctatg tgggcatggt tttgccagtg 5040

cttctaagtg caggagaaca tgtcacctga ggctagtttt gcattcaggt ccctggcttc 5100

gtttcttgtt ggtatgcctc cccagatcgt ccttcctgta tccatgtgac cagactgtat 5160

ttgttgggac tgtcgcagat cttggcttct tacagttctt cctgtccaaa ctccatcctg 5220

tccctcagga acggggggaa aattctccga atgtttttgg ttttttggct gcttggaatt 5280

tacttctgcc acctgctggt catcactgtc ctcactaagt ggattctggc tcccccgtac 5340

ctcatggctc aaactaccac tcctcagtcg ctatattaaa gcttatattt tgctggatta 5400

ctgctaaata caaaagaaag ttcaatatgt tttcatttct gtagggaaaa tgggattgct 5460

gctttaaatt tctgagctag ggattttttg gcagctgcag tgttggcgac tattgtaaaa 5520

ttctctttgt ttctctctgt aaatagcacc tgctaacatt acaatttgta tttatgttta 5580

aagaaggcat catttggtga acagaactag gaaatgaatt tttagctctt aaaagcattt 5640

gctttgagac cgcacaggag tgtctttcct tgtaaaacag tgatgataat ttctgccttg 5700

gccctacctt gaagcaatgt tgtgtgaagg gatgaagaat ctaaaagtct tcataagtcc 5760

ttgggagagg tgctagaaaa atataaggca ctatcataat tacagtgatg tccttgctgt 5820

tactactcaa atcacccaca aatttcccca aagactgcgc tagctgtcaa ataaaagaca 5880

gtgaaattga cctga 5895

<210> SEQ ID NO: 2

<211> LENGTH: 6055

<212> TYPE: DNA

<213> ORGANISM: homo sapiens

<400> SEQENCE: 2

actgagtccc gggaccccgg gagagcggtc aatgtgtggt cgctgcgttt cctctgcctg 60

cgccgggcat cacttgcgcg ccgcagaaag tccgtctggc agcctggata tcctctccta 120

ccggcacccg cagacgcccc tgcagccgcg gtcggcgccc gggctcccta gccctgtgcg 180

ctcaactgtc ctgcgctgcg gggtgccgcg agttccacct ccgcgcctcc ttctctagac 240

aggcgctggg agaaagaacc ggctcccgag ttctgggcat ttcgcccggc tcgaggtgca 300

ggatgcagag caaggtgctg ctggccgtcg ccctgtggct ctgcgtggag acccgggccg 360

cctctgtggg tttgcctagt gtttctcttg atctgcccag gctcagcata caaaaagaca 420

tacttacaat taaggctaat acaactcttc aaattacttg caggggacag agggacttgg 480

actggctttg gcccaataat cagagtggca gtgagcaaag ggtggaggtg actgagtgca 540

gcgatggcct cttctgtaag acactcacaa ttccaaaagt gatcggaaat gacactggag 600

cctacaagtg cttctaccgg gaaactgact tggcctcggt catttatgtc tatgttcaag 660

attacagatc tccatttatt gcttctgtta gtgaccaaca tggagtcgtg tacattactg 720

agaacaaaaa caaaactgtg gtgattccat gtctcgggtc catttcaaat ctcaacgtgt 780

cactttgtgc aagataccca gaaaagagat ttgttcctga tggtaacaga atttcctggg 840

acagcaagaa gggctttact attcccagct acatgatcag ctatgctggc atggtcttct 900

gtgaagcaaa aattaatgat gaaagttacc agtctattat gtacatagtt gtcgttgtag 960

ggtataggat ttatgatgtg gttctgagtc cgtctcatgg aattgaacta tctgttggag 1020

aaaagcttgt cttaaattgt acagcaagaa ctgaactaaa tgtggggatt gacttcaact 1080

gggaataccc ttcttcgaag catcagcata agaaacttgt aaaccgagac ctaaaaaccc 1140

agtctgggag tgagatgaag aaatttttga gcaccttaac tatagatggt gtaacccgga 1200

gtgaccaagg attgtacacc tgtgcagcat ccagtgggct gatgaccaag aagaacagca 1260

catttgtcag ggtccatgaa aaaccttttg ttgcttttgg aagtggcatg gaatctctgg 1320

tggaagccac ggtgggggag cgtgtcagaa tccctgcgaa gtaccttggt tacccacccc 1380

cagaaataaa atggtataaa aatggaatac cccttgagtc caatcacaca attaaagcgg 1440

ggcatgtact gacgattatg gaagtgagtg aaagagacac aggaaattac actgtcatcc 1500

ttaccaatcc catttcaaag gagaagcaga gccatgtggt ctctctggtt gtgtatgtcc 1560

caccccagat tggtgagaaa tctctaatct ctcctgtgga ttcctaccag tacggcacca 1620

ctcaaacgct gacatgtacg gtctatgcca ttcctccccc gcatcacatc cactggtatt 1680

ggcagttgga ggaagagtgc gccaacgagc ccagccaagc tgtctcagtg acaaacccat 1740

acccttgtga agaatggaga agtgtggagg acttccaggg aggaaataaa attgaagtta 1800

ataaaaatca atttgctcta attgaaggaa aaaacaaaac tgtaagtacc cttgttatcc 1860

aagcggcaaa tgtgtcagct ttgtacaaat gtgaagcggt caacaaagtc gggagaggag 1920

agagggtgat ctccttccac gtgaccaggg gtcctgaaat tactttgcaa cctgacatgc 1980

agcccactga gcaggagagc gtgtctttgt ggtgcactgc agacagatct acgtttgaga 2040

acctcacatg gtacaagctt ggcccacagc ctctgccaat ccatgtggga gagttgccca 2100

cacctgtttg caagaacttg gatactcttt ggaaattgaa tgccaccatg ttctctaata 2160

gcacaaatga cattttgatc atggagctta agaatgcatc cttgcaggac caaggagact 2220

atgtctgcct tgctcaagac aggaagacca agaaaagaca ttgcgtggtc aggcagctca 2280

cagtcctaga gcgtgtggca cccacgatca caggaaacct ggagaatcag acgacaagta 2340

ttggggaaag catcgaagtc tcatgcacgg catctgggaa tccccctcca cagatcatgt 2400

ggtttaaaga taatgagacc cttgtagaag actcaggcat tgtattgaag gatgggaacc 2460

ggaacctcac tatccgcaga gtgaggaagg aggacgaagg cctctacacc tgccaggcat 2520

gcagtgttct tggctgtgca aaagtggagg catttttcat aatagaaggt gcccaggaaa 2580

agacgaactt ggaaatcatt attctagtag gcacggcggt gattgccatg ttcttctggc 2640

tacttcttgt catcatccta cggaccgtta agcgggccaa tggaggggaa ctgaagacag 2700

gctacttgtc catcgtcatg gatccagatg aactcccatt ggatgaacat tgtgaacgac 2760

tgccttatga tgccagcaaa tgggaattcc ccagagaccg gctgaagcta ggtaagcctc 2820

ttggccgtgg tgcctttggc caagtgattg aagcagatgc ctttggaatt gacaagacag 2880

caacttgcag gacagtagca gtcaaaatgt tgaaagaagg agcaacacac agtgagcatc 2940

gagctctcat gtctgaactc aagatcctca ttcatattgg tcaccatctc aatgtggtca 3000

accttctagg tgcctgtacc aagccaggag ggccactcat ggtgattgtg gaattctgca 3060

aatttggaaa cctgtccact tacctgagga gcaagagaaa tgaatttgtc ccctacaaga 3120

ccaaaggggc acgattccgt caagggaaag actacgttgg agcaatccct gtggatctga 3180

aacggcgctt ggacagcatc accagtagcc agagctcagc cagctctgga tttgtggagg 3240

agaagtccct cagtgatgta gaagaagagg aagctcctga agatctgtat aaggacttcc 3300

tgaccttgga gcatctcatc tgttacagct tccaagtggc taagggcatg gagttcttgg 3360

catcgcgaaa gtgtatccac agggacctgg cggcacgaaa tatcctctta tcggagaaga 3420

acgtggttaa aatctgtgac tttggcttgg cccgggatat ttataaagat ccagattatg 3480

tcagaaaagg agatgctcgc ctccctttga aatggatggc cccagaaaca atttttgaca 3540

gagtgtacac aatccagagt gacgtctggt cttttggtgt tttgctgtgg gaaatatttt 3600

ccttaggtgc ttctccatat cctggggtaa agattgatga agaattttgt aggcgattga 3660

aagaaggaac tagaatgagg gcccctgatt atactacacc agaaatgtac cagaccatgc 3720

tggactgctg gcacggggag cccagtcaga gacccacgtt ttcagagttg gtggaacatt 3780

tgggaaatct cttgcaagct aatgctcagc aggatggcaa agactacatt gttcttccga 3840

tatcagagac tttgagcatg gaagaggatt ctggactctc tctgcctacc tcacctgttt 3900

cctgtatgga ggaggaggaa gtatgtgacc ccaaattcca ttatgacaac acagcaggaa 3960

tcagtcagta tctgcagaac agtaagcgaa agagccggcc tgtgagtgta aaaacatttg 4020

aagatatccc gttagaagaa ccagaagtaa aagtaatccc agatgacaac cagacggaca 4080

gtggtatggt tcttgcctca gaagagctga aaactttgga agacagaacc aaattatctc 4140

catcttttgg tggaatggtg cccagcaaaa gcagggagtc tgtggcatct gaaggctcaa 4200

accagacaag cggctaccag tccggatatc actccgatga cacagacacc accgtgtact 4260

ccagtgagga agcagaactt ttaaagctga tagagattgg agtgcaaacc ggtagcacag 4320

cccagattct ccagcctgac tcggggacca cactgagctc tcctcctgtt taaaaggaag 4380

catccacacc cccaactcct ggacatcaca tgagaggtgc tgctcagatt ttcaagtgtt 4440

gttctttcca ccagcaggaa gtagccgcat ttgattttca tttcgacaac agaaaaagga 4500

cctcggactg cagggagcca gtcttctagg catatcctgg aagaggcttg tgacccaaga 4560

atgtgtctgt gtcttctccc agtgttgacc tgatcctctt tttcattcat ttaaaaagca 4620

tttatcatgc cccctgctgc gggtctcacc atgggtttag aacaaagacg ttcaagaaat 4680

ggccccatcc tcaaagaagt agcagtacct ggggagctga cacttctgta aaactagaag 4740

ataaaccagg caatgtaagt gttcgaggtg ttgaagatgg gaaggatttg cagggctgag 4800

tctatccaag aggctttgtt taggacgtgg gtcccaagcc aagccttaag tgtggaattc 4860

ggattgatag aaaggaagac taacgttacc ttgctttgga gagtactgga gcctgcaaat 4920

gcattgtgtt tgctctggtg gaggtgggca tggggtctgt tctgaaatgt aaagggttca 4980

gacggggttt ctggttttag aaggttgcgt gttcttcgag ttgggctaaa gtagagttcg 5040

ttgtgctgtt tctgactcct aatgagagtt ccttccagac cgttacgtgt ctcctggcca 5100

agccccagga aggaaatgat gcagctctgg ctccttgtct cccaggctga tcctttattc 5160

agaataccac aaagaaagga cattcagctc aaggctccct gccgtgttga agagttctga 5220

ctgcacaaac cagcttctgg tttcttctgg aatgaatacc ctcatatctg tcctgatgtg 5280

atatgtctga gactgaatgc gggaggttca atgtgaagct gtgtgtggtg tcaaagtttc 5340

aggaaggatt ttaccctttt gttcttcccc ctgtccccaa cccactctca ccccgcaacc 5400

catcagtatt ttagttattt ggcctctact ccagtaaacc tgattgggtt tgttcactct 5460

ctgaatgatt attagccaga cttcaaaatt attttatagc ccaaattata acatctattg 5520

tattatttag acttttaaca tatagagcta tttctactga tttttgccct tgttctgtcc 5580

tttttttcaa aaaagaaaat gtgttttttg tttggtacca tagtgtgaaa tgctgggaac 5640

aatgactata agacatgcta tggcacatat atttatagtc tgtttatgta gaaacaaatg 5700

taatatatta aagccttata tataatgaac tttgtactat tcacattttg tatcagtatt 5760

atgtagcata acaaaggtca taatgctttc agcaattgat gtcattttat taaagaacat 5820

tgaaaaactt gaaggaatcc ctttgcaagg ttgcattact gtacccatca tttctaaaat 5880

ggaagagggg gtggctgggc acagtggccg acacctaaaa acccagcact ttggggggcc 5940

aaggtgggag gatcgcttga gcccaggagt tcaagaccag tctggccaac atggtcagat 6000

tccatctcaa agaaaaaagg taaaaataaa ataaaatgga gaagaaggaa tcaga 6055

<210> SEQ ID NO: 3

<211> LENGTH: 5718

<212> TYPE: DNA

<213> ORGANISM: homo sapiens

<400> SEQENCE: 3

ctcctgaggc tgccagcagc cagcagtgac tgcccgccct atctgggacc caggatcgct 60

ctgtgagcaa cttggagcca gagaggagat caacaaggag gaggagagag ccggcccctc 120

agccctgctg cccagcagca gcctgtgctc gccctgccca acgcagacag ccagacccag 180

ggcggcccct ctggcggctc tgctcctccc gaaggatgct tggggagtga ggcgaagctg 240

ggccgctcct ctcccctaca gcagccccct tcctccatcc ctctgttctc ctgagccttc 300

aggagcctgc accagtcctg cctgtccttc tactcagctg ttacccactc tgggaccagc 360

agtctttctg ataactggga gagggcagta aggaggactt cctggagggg gtgactgtcc 420

agagcctgga actgtgccca caccagaagc catcagcagc aaggacacca tgcggcttcc 480

gggtgcgatg ccagctctgg ccctcaaagg cgagctgctg ttgctgtctc tcctgttact 540

tctggaacca cagatctctc agggcctggt cgtcacaccc ccggggccag agcttgtcct 600

caatgtctcc agcaccttcg ttctgacctg ctcgggttca gctccggtgg tgtgggaacg 660

gatgtcccag gagcccccac aggaaatggc caaggcccag gatggcacct tctccagcgt 720

gctcacactg accaacctca ctgggctaga cacgggagaa tacttttgca cccacaatga 780

ctcccgtgga ctggagaccg atgagcggaa acggctctac atctttgtgc cagatcccac 840

cgtgggcttc ctccctaatg atgccgagga actattcatc tttctcacgg aaataactga 900

gatcaccatt ccatgccgag taacagaccc acagctggtg gtgacactgc acgagaagaa 960

aggggacgtt gcactgcctg tcccctatga tcaccaacgt ggcttttctg gtatctttga 1020

ggacagaagc tacatctgca aaaccaccat tggggacagg gaggtggatt ctgatgccta 1080

ctatgtctac agactccagg tgtcatccat caacgtctct gtgaacgcag tgcagactgt 1140

ggtccgccag ggtgagaaca tcaccctcat gtgcattgtg atcgggaatg aggtggtcaa 1200

cttcgagtgg acataccccc gcaaagaaag tgggcggctg gtggagccgg tgactgactt 1260

cctcttggat atgccttacc acatccgctc catcctgcac atccccagtg ccgagttaga 1320

agactcgggg acctacacct gcaatgtgac ggagagtgtg aatgaccatc aggatgaaaa 1380

ggccatcaac atcaccgtgg ttgagagcgg ctacgtgcgg ctcctgggag aggtgggcac 1440

actacaattt gctgagctgc atcggagccg gacactgcag gtagtgttcg aggcctaccc 1500

accgcccact gtcctgtggt tcaaagacaa ccgcaccctg ggcgactcca gcgctggcga 1560

aatcgccctg tccacgcgca acgtgtcgga gacccggtat gtgtcagagc tgacactggt 1620

tcgcgtgaag gtggcagagg ctggccacta caccatgcgg gccttccatg aggatgctga 1680

ggtccagctc tccttccagc tacagatcaa tgtccctgtc cgagtgctgg agctaagtga 1740

gagccaccct gacagtgggg aacagacagt ccgctgtcgt ggccggggca tgccccagcc 1800

gaacatcatc tggtctgcct gcagagacct caaaaggtgt ccacgtgagc tgccgcccac 1860

gctgctgggg aacagttccg aagaggagag ccagctggag actaacgtga cgtactggga 1920

ggaggagcag gagtttgagg tggtgagcac actgcgtctg cagcacgtgg atcggccact 1980

gtcggtgcgc tgcacgctgc gcaacgctgt gggccaggac acgcaggagg tcatcgtggt 2040

gccacactcc ttgcccttta aggtggtggt gatctcagcc atcctggccc tggtggtgct 2100

caccatcatc tcccttatca tcctcatcat gctttggcag aagaagccac gttacgagat 2160

ccgatggaag gtgattgagt ctgtgagctc tgacggccat gagtacatct acgtggaccc 2220

catgcagctg ccctatgact ccacgtggga gctgccgcgg gaccagcttg tgctgggacg 2280

caccctcggc tctggggcct ttgggcaggt ggtggaggcc acggctcatg gcctgagcca 2340

ttctcaggcc acgatgaaag tggccgtcaa gatgcttaaa tccacagccc gcagcagtga 2400

gaagcaagcc cttatgtcgg agctgaagat catgagtcac cttgggcccc acctgaacgt 2460

ggtcaacctg ttgggggcct gcaccaaagg aggacccatc tatatcatca ctgagtactg 2520

ccgctacgga gacctggtgg actacctgca ccgcaacaaa cacaccttcc tgcagcacca 2580

ctccgacaag cgccgcccgc ccagcgcgga gctctacagc aatgctctgc ccgttgggct 2640

ccccctgccc agccatgtgt ccttgaccgg ggagagcgac ggtggctaca tggacatgag 2700

caaggacgag tcggtggact atgtgcccat gctggacatg aaaggagacg tcaaatatgc 2760

agacatcgag tcctccaact acatggcccc ttacgataac tacgttccct ctgcccctga 2820

gaggacctgc cgagcaactt tgatcaacga gtctccagtg ctaagctaca tggacctcgt 2880

gggcttcagc taccaggtgg ccaatggcat ggagtttctg gcctccaaga actgcgtcca 2940

cagagacctg gcggctagga acgtgctcat ctgtgaaggc aagctggtca agatctgtga 3000

ctttggcctg gctcgagaca tcatgcggga ctcgaattac atctccaaag gcagcacctt 3060

tttgccttta aagtggatgg ctccggagag catcttcaac agcctctaca ccaccctgag 3120

cgacgtgtgg tccttcggga tcctgctctg ggagatcttc accttgggtg gcacccctta 3180

cccagagctg cccatgaacg agcagttcta caatgccatc aaacggggtt accgcatggc 3240

ccagcctgcc catgcctccg acgagatcta tgagatcatg cagaagtgct gggaagagaa 3300

gtttgagatt cggcccccct tctcccagct ggtgctgctt ctcgagagac tgttgggcga 3360

aggttacaaa aagaagtacc agcaggtgga tgaggagttt ctgaggagtg accacccagc 3420

catccttcgg tcccaggccc gcttgcctgg gttccatggc ctccgatctc ccctggacac 3480

cagctccgtc ctctatactg ccgtgcagcc caatgagggt gacaacgact atatcatccc 3540

cctgcctgac cccaaacccg aggttgctga cgagggccca ctggagggtt cccccagcct 3600

agccagctcc accctgaatg aagtcaacac ctcctcaacc atctcctgtg acagccccct 3660

ggagccccag gacgaaccag agccagagcc ccagcttgag ctccaggtgg agccggagcc 3720

agagctggaa cagttgccgg attcggggtg ccctgcgcct cgggcggaag cagaggatag 3780

cttcctgtag ggggctggcc cctaccctgc cctgcctgaa gctccccccc tgccagcacc 3840

cagcatctcc tggcctggcc tgaccgggct tcctgtcagc caggctgccc ttatcagctg 3900

tccccttctg gaagctttct gctcctgacg tgttgtgccc caaaccctgg ggctggctta 3960

ggaggcaaga aaactgcagg ggccgtgacc agccctctgc ctccagggag gccaactgac 4020

tctgagccag ggttccccca gggaactcag ttttcccata tgtaagatgg gaaagttagg 4080

cttgatgacc cagaatctag gattctctcc ctggctgaca ggtggggaga ccgaatccct 4140

ccctgggaag attcttggag ttactgaggt ggtaaattaa cttttttctg ttcagccagc 4200

tacccctcaa ggaatcatag ctctctcctc gcacttttat ccacccagga gctagggaag 4260

agaccctagc ctccctggct gctggctgag ctagggccta gccttgagca gtgttgcctc 4320

atccagaaga aagccagtct cctccctatg atgccagtcc ctgcgttccc tggcccgagc 4380

tggtctgggg ccattaggca gcctaattaa tgctggaggc tgagccaagt acaggacacc 4440

cccagcctgc agcccttgcc cagggcactt ggagcacacg cagccatagc aagtgcctgt 4500

gtccctgtcc ttcaggccca tcagtcctgg ggctttttct ttatcaccct cagtcttaat 4560

ccatccacca gagtctagaa ggccagacgg gccccgcatc tgtgatgaga atgtaaatgt 4620

gccagtgtgg agtggccacg tgtgtgtgcc agtatatggc cctggctctg cattggacct 4680

gctatgaggc tttggaggaa tccctcaccc tctctgggcc tcagtttccc cttcaaaaaa 4740

tgaataagtc ggacttatta actctgagtg ccttgccagc actaacattc tagagtattc 4800

caggtggttg cacatttgtc cagatgaagc aaggccatat accctaaact tccatcctgg 4860

gggtcagctg ggctcctggg agattccaga tcacacatca cactctgggg actcaggaac 4920

catgcccctt ccccaggccc ccagcaagtc tcaagaacac agctgcacag gccttgactt 4980

agagtgacag ccggtgtcct ggaaagcccc cagcagctgc cccagggaca tgggaagacc 5040

acgggacctc tttcactacc cacgatgacc tccgggggta tcctgggcaa aagggacaaa 5100

gagggcaaat gagatcacct cctgcagccc accactccag cacctgtgcc gaggtctgcg 5160

tcgaagacag aatggacagt gaggacagtt atgtcttgta aaagacaaga agcttcagat 5220

gggtacccca agaaggatgt gagaggtggg cgctttggag gtttgcccct cacccaccag 5280

ctgccccatc cctgaggcag cgctccatgg gggtatggtt ttgtcactgc ccagacctag 5340

cagtgacatc tcattgtccc cagcccagtg ggcattggag gtgccagggg agtcagggtt 5400

gtagccaaga cgcccccgca cggggagggt tgggaagggg gtgcaggaag ctcaacccct 5460

ctgggcacca accctgcatt gcaggttggc accttacttc cctgggatcc ccagagttgg 5520

tccaaggagg gagagtgggt tctcaatacg gtaccaaaga tataatcacc taggtttaca 5580

aatattttta ggactcacgt taactcacat ttatacagca gaaatgctat tttgtatgct 5640

gttaagtttt tctatctgtg tacttttttt taagggaaag attttaatat taaacctggt 5700

gcttctcact cacaaaaa 5718

<210> SEQ ID NO: 4

<211> LENGTH: 5190

<212> TYPE: DNA

<213> ORGANISM: homo sapiens

<400> SEQENCE: 4

tctgggggct cggctttgcc gcgctcgctg cacttgggcg agagctggaa cgtggaccag 60

agctcggatc ccatcgcagc taccgcgatg agaggcgctc gcggcgcctg ggattttctc 120

tgcgttctgc tcctactgct tcgcgtccag acaggctctt ctcaaccatc tgtgagtcca 180

ggggaaccgt ctccaccatc catccatcca ggaaaatcag acttaatagt ccgcgtgggc 240

gacgagatta ggctgttatg cactgatccg ggctttgtca aatggacttt tgagatcctg 300

gatgaaacga atgagaataa gcagaatgaa tggatcacgg aaaaggcaga agccaccaac 360

accggcaaat acacgtgcac caacaaacac ggcttaagca attccattta tgtgtttgtt 420

agagatcctg ccaagctttt ccttgttgac cgctccttgt atgggaaaga agacaacgac 480

acgctggtcc gctgtcctct cacagaccca gaagtgacca attattccct caaggggtgc 540

caggggaagc ctcttcccaa ggacttgagg tttattcctg accccaaggc gggcatcatg 600

atcaaaagtg tgaaacgcgc ctaccatcgg ctctgtctgc attgttctgt ggaccaggag 660

ggcaagtcag tgctgtcgga aaaattcatc ctgaaagtga ggccagcctt caaagctgtg 720

cctgttgtgt ctgtgtccaa agcaagctat cttcttaggg aaggggaaga attcacagtg 780

acgtgcacaa taaaagatgt gtctagttct gtgtactcaa cgtggaaaag agaaaacagt 840

cagactaaac tacaggagaa atataatagc tggcatcacg gtgacttcaa ttatgaacgt 900

caggcaacgt tgactatcag ttcagcgaga gttaatgatt ctggagtgtt catgtgttat 960

gccaataata cttttggatc agcaaatgtc acaacaacct tggaagtagt agataaagga 1020

ttcattaata tcttccccat gataaacact acagtatttg taaacgatgg agaaaatgta 1080

gatttgattg ttgaatatga agcattcccc aaacctgaac accagcagtg gatctatatg 1140

aacagaacct tcactgataa atgggaagat tatcccaagt ctgagaatga aagtaatatc 1200

agatacgtaa gtgaacttca tctaacgaga ttaaaaggca ccgaaggagg cacttacaca 1260

ttcctagtgt ccaattctga cgtcaatgct gccatagcat ttaatgttta tgtgaataca 1320

aaaccagaaa tcctgactta cgacaggctc gtgaatggca tgctccaatg tgtggcagca 1380

ggattcccag agcccacaat agattggtat ttttgtccag gaactgagca gagatgctct 1440

gcttctgtac tgccagtgga tgtgcagaca ctaaactcat ctgggccacc gtttggaaag 1500

ctagtggttc agagttctat agattctagt gcattcaagc acaatggcac ggttgaatgt 1560

aaggcttaca acgatgtggg caagacttct gcctatttta actttgcatt taaaggtaac 1620

aacaaagagc aaatccatcc ccacaccctg ttcactcctt tgctgattgg tttcgtaatc 1680

gtagctggca tgatgtgcat tattgtgatg attctgacct acaaatattt acagaaaccc 1740

atgtatgaag tacagtggaa ggttgttgag gagataaatg gaaacaatta tgtttacata 1800

gacccaacac aacttcctta tgatcacaaa tgggagtttc ccagaaacag gctgagtttt 1860

gggaaaaccc tgggtgctgg agctttcggg aaggttgttg aggcaactgc ttatggctta 1920

attaagtcag atgcggccat gactgtcgct gtaaagatgc tcaagccgag tgcccatttg 1980

acagaacggg aagccctcat gtctgaactc aaagtcctga gttaccttgg taatcacatg 2040

aatattgtga atctacttgg agcctgcacc attggagggc ccaccctggt cattacagaa 2100

tattgttgct atggtgatct tttgaatttt ttgagaagaa aacgtgattc atttatttgt 2160

tcaaagcagg aagatcatgc agaagctgca ctttataaga atcttctgca ttcaaaggag 2220

tcttcctgca gcgatagtac taatgagtac atggacatga aacctggagt ttcttatgtt 2280

gtcccaacca aggccgacaa aaggagatct gtgagaatag gctcatacat agaaagagat 2340

gtgactcccg ccatcatgga ggatgacgag ttggccctag acttagaaga cttgctgagc 2400

ttttcttacc aggtggcaaa gggcatggct ttcctcgcct ccaagaattg tattcacaga 2460

gacttggcag ccagaaatat cctccttact catggtcgga tcacaaagat ttgtgatttt 2520

ggtctagcca gagacatcaa gaatgattct aattatgtgg ttaaaggaaa cgctcgacta 2580

cctgtgaagt ggatggcacc tgaaagcatt ttcaactgtg tatacacgtt tgaaagtgac 2640

gtctggtcct atgggatttt tctttgggag ctgttctctt taggaagcag cccctatcct 2700

ggaatgccgg tcgattctaa gttctacaag atgatcaagg aaggcttccg gatgctcagc 2760

cctgaacacg cacctgctga aatgtatgac ataatgaaga cttgctggga tgcagatccc 2820

ctaaaaagac caacattcaa gcaaattgtt cagctaattg agaagcagat ttcagagagc 2880

accaatcata tttactccaa cttagcaaac tgcagcccca accgacagaa gcccgtggta 2940

gaccattctg tgcggatcaa ttctgtcggc agcaccgctt cctcctccca gcctctgctt 3000

gtgcacgacg atgtctgagc agaatcagtg tttgggtcac ccctccagga atgatctctt 3060

cttttggctt ccatgatggt tattttcttt tctttcaact tgcatccaac tccaggatag 3120

tgggcacccc actgcaatcc tgtctttctg agcacacttt agtggccgat gatttttgtc 3180

atcagccacc atcctattgc aaaggttcca actgtatata ttcccaatag caacgtagct 3240

tctaccatga acagaaaaca ttctgatttg gaaaaagaga gggaggtatg gactgggggc 3300

cagagtcctt tccaaggctt ctccaattct gcccaaaaat atggttgata gtttacctga 3360

ataaatggta gtaatcacag ttggccttca gaaccatcca tagtagtatg atgatacaag 3420

attagaagct gaaaacctaa gtcctttatg tggaaaacag aacatcatta gaacaaagga 3480

cagagtatga acacctgggc ttaagaaatc tagtatttca tgctgggaat gagacatagg 3540

ccatgaaaaa aatgatcccc aagtgtgaac aaaagatgct cttctgtgga ccactgcatg 3600

agcttttata ctaccgacct ggtttttaaa tagagtttgc tattagagca ttgaattgga 3660

gagaaggcct ccctagccag cacttgtata tacgcatcta taaattgtcc gtgttcatac 3720

atttgagggg aaaacaccat aaggtttcgt ttctgtatac aaccctggca ttatgtccac 3780

tgtgtataga agtagattaa gagccatata agtttgaagg aaacagttaa taccattttt 3840

taaggaaaca atataaccac aaagcacagt ttgaacaaaa tctcctcttt tagctgatga 3900

acttattctg tagattctgt ggaacaagcc tatcagcttc agaatggcat tgtactcaat 3960

ggatttgatg ctgtttgaca aagttactga ttcactgcat ggctcccaca ggagtgggaa 4020

aacactgcca tcttagtttg gattcttatg tagcaggaaa taaagtatag gtttagcctc 4080

cttcgcaggc atgtcctgga caccgggcca gtatctatat atgtgtatgt acgtttgtat 4140

gtgtgtagac aaatatttgg aggggtattt ttgccctgag tccaagaggg tcctttagta 4200

cctgaaaagt aacttggctt tcattattag tactgctctt gtttcttttc acatagctgt 4260

ctagagtagc ttaccagaag cttccatagt ggtgcagagg aagtggaagg catcagtccc 4320

tatgtatttg cagttcacct gcacttaagg cactctgtta tttagactca tcttactgta 4380

cctgttcctt agaccttcca taatgctact gtctcactga aacatttaaa ttttaccctt 4440

tagactgtag cctggatatt attcttgtag tttacctctt taaaaacaaa acaaaacaaa 4500

acaaaaaact ccccttcctc actgcccaat ataaaaggca aatgtgtaca tggcagagtt 4560

tgtgtgttgt cttgaaagat tcaggtatgt tgcctttatg gtttccccct tctacatttc 4620

ttagactaca tttagagaac tgtggccgtt atctggaagt aaccatttgc actggagttc 4680

tatgctctcg cacctttcca aagttaacag attttggggt tgtgttgtca cccaagagat 4740

tgttgtttgc catactttgt ctgaaaaatt cctttgtgtt tctattgact tcaatgatag 4800

taagaaaagt ggttgttagt tatagatgtc taggtacttc aggggcactt cattgagagt 4860

tttgtcttgg atattcttga aagtttatat ttttataatt ttttcttaca tcagatgttt 4920

ctttgcagtg gcttaatgtt tgaaattatt ttgtggcttt ttttgtaaat attgaaatgt 4980

agcaataatg tcttttgaat attcccaagc ccatgagtcc ttgaaaatat tttttatata 5040

tacagtaact ttatgtgtaa atacataagc ggcgtaagtt taaaggatgt tggtgttcca 5100

cgtgttttat tcctgtatgt tgtccaattg ttgacagttc tgaagaattc taataaaatg 5160

tacatatata aatcaaaaaa aaaaaaaaaa 5190

<210> SEQ ID NO: 5

<211> LENGTH: 3291

<212> TYPE: DNA

<213> ORGANISM: homo sapiens

<400> SEQENCE: 5

agaatcggag agccggtggc gtcgcaggtc gggaggacga gcaccgagtc gagggctcgc 60

tcgtctgggc cgcccgagag tcttaatcgc gggcgcttgg gccgccatct tagatggcgg 120

gagtaagagg aaaacgattg tgaggcggga acggctttct gctgcctttt ttgggccccg 180

aaaagggtca gctggccggg ctttggggcg cgtgccctga ggcgcggagc gcgtttgcta 240

cgatgcgggg gctgctcggg gctccgtccc ctgggctggg gacgcgccga atgtgaccgc 300

ctcccgctcc ctcacccgcc gcggggagga ggagcgggcg agaagctgcc gccgaacgac 360

aggacgttgg ggcggcctgg ctccctcagg tttaagaatt gtttaagctg catcaatgga 420

gcacatacag ggagcttgga agacgatcag caatggtttt ggattcaaag atgccgtgtt 480

tgatggctcc agctgcatct ctcctacaat agttcagcag tttggctatc agcgccgggc 540

atcagatgat ggcaaactca cagatccttc taagacaagc aacactatcc gtgttttctt 600

gccgaacaag caaagaacag tggtcaatgt gcgaaatgga atgagcttgc atgactgcct 660

tatgaaagca ctcaaggtga ggggcctgca accagagtgc tgtgcagtgt tcagacttct 720

ccacgaacac aaaggtaaaa aagcacgctt agattggaat actgatgctg cgtctttgat 780

tggagaagaa cttcaagtag atttcctgga tcatgttccc ctcacaacac acaactttgc 840

tcggaagacg ttcctgaagc ttgccttctg tgacatctgt cagaaattcc tgctcaatgg 900

atttcgatgt cagacttgtg gctacaaatt tcatgagcac tgtagcacca aagtacctac 960

tatgtgtgtg gactggagta acatcagaca actcttattg tttccaaatt ccactattgg 1020

tgatagtgga gtcccagcac taccttcttt gactatgcgt cgtatgcgag agtctgtttc 1080

caggatgcct gttagttctc agcacagata ttctacacct cacgccttca cctttaacac 1140

ctccagtccc tcatctgaag gttccctctc ccagaggcag aggtcgacat ccacacctaa 1200

tgtccacatg gtcagcacca ccctgcctgt ggacagcagg atgattgagg atgcaattcg 1260

aagtcacagc gaatcagcct caccttcagc cctgtccagt agccccaaca atctgagccc 1320

aacaggctgg tcacagccga aaacccccgt gccagcacaa agagagcggg caccagtatc 1380

tgggacccag gagaaaaaca aaattaggcc tcgtggacag agagattcaa gctattattg 1440

ggaaatagaa gccagtgaag tgatgctgtc cactcggatt gggtcaggct cttttggaac 1500

tgtttataag ggtaaatggc acggagatgt tgcagtaaag atcctaaagg ttgtcgaccc 1560

aaccccagag caattccagg ccttcaggaa tgaggtggct gttctgcgca aaacacggca 1620

tgtgaacatt ctgcttttca tggggtacat gacaaaggac aacctggcaa ttgtgaccca 1680

gtggtgcgag ggcagcagcc tctacaaaca cctgcatgtc caggagacca agtttcagat 1740

gttccagcta attgacattg cccggcagac ggctcaggga atggactatt tgcatgcaaa 1800

gaacatcatc catagagaca tgaaatccaa caatatattt ctccatgaag gcttaacagt 1860

gaaaattgga gattttggtt tggcaacagt aaagtcacgc tggagtggtt ctcagcaggt 1920

tgaacaacct actggctctg tcctctggat ggccccagag gtgatccgaa tgcaggataa 1980

caacccattc agtttccagt cggatgtcta ctcctatggc atcgtattgt atgaactgat 2040

gacgggggag cttccttatt ctcacatcaa caaccgagat cagatcatct tcatggtggg 2100

ccgaggatat gcctccccag atcttagtaa gctatataag aactgcccca aagcaatgaa 2160

gaggctggta gctgactgtg tgaagaaagt aaaggaagag aggcctcttt ttccccagat 2220

cctgtcttcc attgagctgc tccaacactc tctaccgaag atcaaccgga gcgcttccga 2280

gccatccttg catcgggcag cccacactga ggatatcaat gcttgcacgc tgaccacgtc 2340

cccgaggctg cctgtcttct agttgacttt gcacctgtct tcaggctgcc aggggaggag 2400

gagaagccag caggcaccac ttttctgctc cctttctcca gaggcagaac acatgttttc 2460

agagaagctg ctgctaagga ccttctagac tgctcacagg gccttaactt catgttgcct 2520

tcttttctat ccctttgggc cctgggagaa ggaagccatt tgcagtgctg gtgtgtcctg 2580

ctccctcccc acattcccca tgctcaaggc ccagccttct gtagatgcgc aagtggatgt 2640

tgatggtagt acaaaaagca ggggcccagc cccagctgtt ggctacatga gtatttagag 2700

gaagtaaggt agcaggcagt ccagccctga tgtggagaca catgggattt tggaaatcag 2760

cttctggagg aatgcatgtc acaggcggga ctttcttcag agagtggtgc agcgccagac 2820

attttgcaca taaggcacca aacagcccag gactgccgag actctggccg cccgaaggag 2880

cctgctttgg tactatggaa cttttcttag gggacacgtc ctcctttcac agcttctaag 2940

gtgtccagtg cattgggatg gttttccagg caaggcactc ggccaatccg catctcagcc 3000

ctctcaggga gcagtcttcc atcatgctga attttgtctt ccaggagctg cccctatggg 3060

gcggggccgc agggccagcc ttgtttctct aacaaacaaa caaacaaaca gccttgtttc 3120

tctagtcaca tcatgtgtat acaaggaagc caggaataca ggttttcttg atgatttggg 3180

ttttaatttt gtttttattg cacctgacaa aatacagtta tctgatggtc cctcaattat 3240

gttattttaa taaaataaat taaatttagg tgtaaaaaaa aaaaaaaaaa a 3291

<210> SEQ ID NO: 6

<211> LENGTH: 5616

<212> TYPE: DNA

<213> ORGANISM: homo sapiens

<400> SEQENCE: 6

ccccggcgca gcgcggccgc agcagcctcc gccccccgca cggtgtgagc gcccgacgcg 60

gccgaggcgg ccggagtccc gagctagccc cggcggccgc cgccgcccag accggacgac 120

aggccacctc gtcggcgtcc gcccgagtcc ccgcctcgcc gccaacgcca caaccaccgc 180

gcacggcccc ctgactccgt ccagtattga tcgggagagc cggagcgagc tcttcgggga 240

gcagcgatgc gaccctccgg gacggccggg gcagcgctcc tggcgctgct ggctgcgctc 300

tgcccggcga gtcgggctct ggaggaaaag aaagtttgcc aaggcacgag taacaagctc 360

acgcagttgg gcacttttga agatcatttt ctcagcctcc agaggatgtt caataactgt 420

gaggtggtcc ttgggaattt ggaaattacc tatgtgcaga ggaattatga tctttccttc 480

ttaaagacca tccaggaggt ggctggttat gtcctcattg ccctcaacac agtggagcga 540

attcctttgg aaaacctgca gatcatcaga ggaaatatgt actacgaaaa ttcctatgcc 600

ttagcagtct tatctaacta tgatgcaaat aaaaccggac tgaaggagct gcccatgaga 660

aatttacagg aaatcctgca tggcgccgtg cggttcagca acaaccctgc cctgtgcaac 720

gtggagagca tccagtggcg ggacatagtc agcagtgact ttctcagcaa catgtcgatg 780

gacttccaga accacctggg cagctgccaa aagtgtgatc caagctgtcc caatgggagc 840

tgctggggtg caggagagga gaactgccag aaactgacca aaatcatctg tgcccagcag 900

tgctccgggc gctgccgtgg caagtccccc agtgactgct gccacaacca gtgtgctgca 960

ggctgcacag gcccccggga gagcgactgc ctggtctgcc gcaaattccg agacgaagcc 1020

acgtgcaagg acacctgccc cccactcatg ctctacaacc ccaccacgta ccagatggat 1080

gtgaaccccg agggcaaata cagctttggt gccacctgcg tgaagaagtg tccccgtaat 1140

tatgtggtga cagatcacgg ctcgtgcgtc cgagcctgtg gggccgacag ctatgagatg 1200

gaggaagacg gcgtccgcaa gtgtaagaag tgcgaagggc cttgccgcaa agtgtgtaac 1260

ggaataggta ttggtgaatt taaagactca ctctccataa atgctacgaa tattaaacac 1320

ttcaaaaact gcacctccat cagtggcgat ctccacatcc tgccggtggc atttaggggt 1380

gactccttca cacatactcc tcctctggat ccacaggaac tggatattct gaaaaccgta 1440

aaggaaatca cagggttttt gctgattcag gcttggcctg aaaacaggac ggacctccat 1500

gcctttgaga acctagaaat catacgcggc aggaccaagc aacatggtca gttttctctt 1560

gcagtcgtca gcctgaacat aacatccttg ggattacgct ccctcaagga gataagtgat 1620

ggagatgtga taatttcagg aaacaaaaat ttgtgctatg caaatacaat aaactggaaa 1680

aaactgtttg ggacctccgg tcagaaaacc aaaattataa gcaacagagg tgaaaacagc 1740

tgcaaggcca caggccaggt ctgccatgcc ttgtgctccc ccgagggctg ctggggcccg 1800

gagcccaggg actgcgtctc ttgccggaat gtcagccgag gcagggaatg cgtggacaag 1860

tgcaaccttc tggagggtga gccaagggag tttgtggaga actctgagtg catacagtgc 1920

cacccagagt gcctgcctca ggccatgaac atcacctgca caggacgggg accagacaac 1980

tgtatccagt gtgcccacta cattgacggc ccccactgcg tcaagacctg cccggcagga 2040

gtcatgggag aaaacaacac cctggtctgg aagtacgcag acgccggcca tgtgtgccac 2100

ctgtgccatc caaactgcac ctacggatgc actgggccag gtcttgaagg ctgtccaacg 2160

aatgggccta agatcccgtc catcgccact gggatggtgg gggccctcct cttgctgctg 2220

gtggtggccc tggggatcgg cctcttcatg cgaaggcgcc acatcgttcg gaagcgcacg 2280

ctgcggaggc tgctgcagga gagggagctt gtggagcctc ttacacccag tggagaagct 2340

cccaaccaag ctctcttgag gatcttgaag gaaactgaat tcaaaaagat caaagtgctg 2400

ggctccggtg cgttcggcac ggtgtataag ggactctgga tcccagaagg tgagaaagtt 2460

aaaattcccg tcgctatcaa ggaattaaga gaagcaacat ctccgaaagc caacaaggaa 2520

atcctcgatg aagcctacgt gatggccagc gtggacaacc cccacgtgtg ccgcctgctg 2580

ggcatctgcc tcacctccac cgtgcagctc atcacgcagc tcatgccctt cggctgcctc 2640

ctggactatg tccgggaaca caaagacaat attggctccc agtacctgct caactggtgt 2700

gtgcagatcg caaagggcat gaactacttg gaggaccgtc gcttggtgca ccgcgacctg 2760

gcagccagga acgtactggt gaaaacaccg cagcatgtca agatcacaga ttttgggctg 2820

gccaaactgc tgggtgcgga agagaaagaa taccatgcag aaggaggcaa agtgcctatc 2880

aagtggatgg cattggaatc aattttacac agaatctata cccaccagag tgatgtctgg 2940

agctacgggg tgaccgtttg ggagttgatg acctttggat ccaagccata tgacggaatc 3000

cctgccagcg agatctcctc catcctggag aaaggagaac gcctccctca gccacccata 3060

tgtaccatcg atgtctacat gatcatggtc aagtgctgga tgatagacgc agatagtcgc 3120

ccaaagttcc gtgagttgat catcgaattc tccaaaatgg cccgagaccc ccagcgctac 3180

cttgtcattc agggggatga aagaatgcat ttgccaagtc ctacagactc caacttctac 3240

cgtgccctga tggatgaaga agacatggac gacgtggtgg atgccgacga gtacctcatc 3300

ccacagcagg gcttcttcag cagcccctcc acgtcacgga ctcccctcct gagctctctg 3360

agtgcaacca gcaacaattc caccgtggct tgcattgata gaaatgggct gcaaagctgt 3420

cccatcaagg aagacagctt cttgcagcga tacagctcag accccacagg cgccttgact 3480

gaggacagca tagacgacac cttcctccca gtgcctgaat acataaacca gtccgttccc 3540

aaaaggcccg ctggctctgt gcagaatcct gtctatcaca atcagcctct gaaccccgcg 3600

cccagcagag acccacacta ccaggacccc cacagcactg cagtgggcaa ccccgagtat 3660

ctcaacactg tccagcccac ctgtgtcaac agcacattcg acagccctgc ccactgggcc 3720

cagaaaggca gccaccaaat tagcctggac aaccctgact accagcagga cttctttccc 3780

aaggaagcca agccaaatgg catctttaag ggctccacag ctgaaaatgc agaataccta 3840

agggtcgcgc cacaaagcag tgaatttatt ggagcatgac cacggaggat agtatgagcc 3900

ctaaaaatcc agactctttc gatacccagg accaagccac agcaggtcct ccatcccaac 3960

agccatgccc gcattagctc ttagacccac agactggttt tgcaacgttt acaccgacta 4020

gccaggaagt acttccacct cgggcacatt ttgggaagtt gcattccttt gtcttcaaac 4080

tgtgaagcat ttacagaaac gcatccagca agaatattgt ccctttgagc agaaatttat 4140

ctttcaaaga ggtatatttg aaaaaaaaaa aaagtatatg tgaggatttt tattgattgg 4200

ggatcttgga gtttttcatt gtcgctattg atttttactt caatgggctc ttccaacaag 4260

gaagaagctt gctggtagca cttgctaccc tgagttcatc caggcccaac tgtgagcaag 4320

gagcacaagc cacaagtctt ccagaggatg cttgattcca gtggttctgc ttcaaggctt 4380

ccactgcaaa acactaaaga tccaagaagg ccttcatggc cccagcaggc cggatcggta 4440

ctgtatcaag tcatggcagg tacagtagga taagccactc tgtcccttcc tgggcaaaga 4500

agaaacggag gggatggaat tcttccttag acttactttt gtaaaaatgt ccccacggta 4560

cttactcccc actgatggac cagtggtttc cagtcatgag cgttagactg acttgtttgt 4620

cttccattcc attgttttga aactcagtat gctgcccctg tcttgctgtc atgaaatcag 4680

caagagagga tgacacatca aataataact cggattccag cccacattgg attcatcagc 4740

atttggacca atagcccaca gctgagaatg tggaatacct aaggatagca ccgcttttgt 4800

tctcgcaaaa acgtatctcc taatttgagg ctcagatgaa atgcatcagg tcctttgggg 4860

catagatcag aagactacaa aaatgaagct gctctgaaat ctcctttagc catcacccca 4920

accccccaaa attagtttgt gttacttatg gaagatagtt ttctcctttt acttcacttc 4980

aaaagctttt tactcaaaga gtatatgttc cctccaggtc agctgccccc aaaccccctc 5040

cttacgcttt gtcacacaaa aagtgtctct gccttgagtc atctattcaa gcacttacag 5100

ctctggccac aacagggcat tttacaggtg cgaatgacag tagcattatg agtagtgtgg 5160

aattcaggta gtaaatatga aactagggtt tgaaattgat aatgctttca caacatttgc 5220

agatgtttta gaaggaaaaa agttccttcc taaaataatt tctctacaat tggaagattg 5280

gaagattcag ctagttagga gcccaccttt tttcctaatc tgtgtgtgcc ctgtaacctg 5340

actggttaac agcagtcctt tgtaaacagt gttttaaact ctcctagtca atatccaccc 5400

catccaattt atcaaggaag aaatggttca gaaaatattt tcagcctaca gttatgttca 5460

gtcacacaca catacaaaat gttccttttg cttttaaagt aatttttgac tcccagatca 5520

gtcagagccc ctacagcatt gttaagaaag tatttgattt ttgtctcaat gaaaataaaa 5580

ctatattcat ttccactcta aaaaaaaaaa aaaaaa 5616

<210> SEQ ID NO: 7

<211> LENGTH: 8733

<212> TYPE: DNA

<213> ORGANISM: homo sapiens

<400> SEQENCE: 7

gctcccggct tagaggacag cggggaaggc gggcggtggg gcagggggcc tgaagcggcg 60

gtaccggtgc tggcggcggc agctgaggcc ttggccgaag ccgcgcgaac ctcagggcaa 120

gatgcttgga accggacctg ccgccgccac caccgctgcc accacatcta gcaatgtgag 180

cgtcctgcag cagtttgcca gtggcctaaa gagccggaat gaggaaacca gggccaaagc 240

cgccaaggag ctccagcact atgtcaccat ggaactccga gagatgagtc aagaggagtc 300

tactcgcttc tatgaccaac tgaaccatca catttttgaa ttggtttcca gctcagatgc 360

caatgagagg aaaggtggca tcttggccat agctagcctc ataggagtgg aaggtgggaa 420

tgccacccga attggcagat ttgccaacta tcttcggaac ctcctcccct ccaatgaccc 480

agttgtcatg gaaatggcat ccaaggccat tggccgtctt gccatggcag gggacacttt 540

taccgctgag tacgtggaat ttgaggtgaa gcgagccctg gaatggctgg gtgctgaccg 600

caatgagggc cggagacatg cagctgtcct ggttctccgt gagctggcca tcagcgtccc 660

taccttcttc ttccagcaag tgcaaccctt ctttgacaac atttttgtgg ccgtgtggga 720

ccccaaacag gccatccgtg agggagctgt agccgccctt cgtgcctgtc tgattctcac 780

aacccagcgt gagccgaagg agatgcagaa gcctcagtgg tacaggcaca catttgaaga 840

agcagagaag ggatttgatg agaccttggc caaagagaag ggcatgaatc gggatgatcg 900

gatccatgga gccttgttga tccttaacga gctggtccga atcagcagca tggagggaga 960

gcgtctgaga gaagaaatgg aagaaatcac acagcagcag ctggtacacg acaagtactg 1020

caaagatctc atgggcttcg gaacaaaacc tcgtcacatt acccccttca ccagtttcca 1080

ggctgtacag ccccagcagt caaatgcctt ggtggggctg ctggggtaca gctctcacca 1140

aggcctcatg ggatttggga cctcccccag tccagctaag tccaccctgg tggagagccg 1200

gtgttgcaga gacttgatgg aggagaaatt tgatcaggtg tgccagtggg tgctgaaatg 1260

caggaatagc aagaactcgc tgatccaaat gacaatcctt aatttgttgc cccgcttggc 1320

tgcattccga ccttctgcct tcacagatac ccagtatctc caagatacca tgaaccatgt 1380

cctaagctgt gtcaagaagg agaaggaacg tacagcggcc ttccaagccc tggggctact 1440

ttctgtggct gtgaggtctg agtttaaggt ctatttgcct cgcgtgctgg acatcatccg 1500

agcggccctg cccccaaagg acttcgccca taagaggcag aaggcaatgc aggtggatgc 1560

cacagtcttc acttgcatca gcatgctggc tcgagcaatg gggccaggca tccagcagga 1620

tatcaaggag ctgctggagc ccatgctggc agtgggacta agccctgccc tcactgcagt 1680

gctctacgac ctgagccgtc agattccaca gctaaagaag gacattcaag atgggctact 1740

gaaaatgctg tccctggtcc ttatgcacaa accccttcgc cacccaggca tgcccaaggg 1800

cctggcccat cagctggcct ctcctggcct cacgaccctc cctgaggcca gcgatgtggg 1860

cagcatcact cttgccctcc gaacgcttgg cagctttgaa tttgaaggcc actctctgac 1920

ccaatttgtt cgccactgtg cggatcattt cctgaacagt gagcacaagg agatccgcat 1980

ggaggctgcc cgcacctgct cccgcctgct cacaccctcc atccacctca tcagtggcca 2040

tgctcatgtg gttagccaga ccgcagtgca agtggtggca gatgtgctta gcaaactgct 2100

cgtagttggg ataacagatc ctgaccctga cattcgctac tgtgtcttgg cgtccctgga 2160

cgagcgcttt gatgcacacc tggcccaggc ggagaacttg caggccttgt ttgtggctct 2220

gaatgaccag gtgtttgaga tccgggagct ggccatctgc actgtgggcc gactcagtag 2280

catgaaccct gcctttgtca tgcctttcct gcgcaagatg ctcatccaga ttttgacaga 2340

gttggagcac agtgggattg gaagaatcaa agagcagagt gcccgcatgc tggggcacct 2400

ggtctccaat gccccccgac tcatccgccc ctacatggag cctattctga aggcattaat 2460

tttgaaactg aaagatccag accctgatcc aaacccaggt gtgatcaata atgtcctggc 2520

aacaatagga gaattggcac aggttagtgg cctggaaatg aggaaatggg ttgatgaact 2580

ttttattatc atcatggaca tgctccagga ttcctctttg ttggccaaaa ggcaggtggc 2640

tctgtggacc ctgggacagt tggtggccag cactggctat gtagtagagc cctacaggaa 2700

gtaccctact ttgcttgagg tgctactgaa ttttctgaag actgagcaga accagggtac 2760

acgcagagag gccatccgtg tgttagggct tttaggggct ttggatcctt acaagcacaa 2820

agtgaacatt ggcatgatag accagtcccg ggatgcctct gctgtcagcc tgtcagaatc 2880

caagtcaagt caggattcct ctgactatag cactagtgaa atgctggtca acatgggaaa 2940

cttgcctctg gatgagttct acccagctgt gtccatggtg gccctgatgc ggatcttccg 3000

agaccagtca ctctctcatc atcacaccat ggttgtccag gccatcacct tcatcttcaa 3060

gtccctggga ctcaaatgtg tgcagttcct gccccaggtc atgcccacgt tccttaacgt 3120

cattcgagtc tgtgatgggg ccatccggga atttttgttc cagcagctgg gaatgttggt 3180

gtcctttgtg aagagccaca tcagacctta tatggatgaa atagtcaccc tcatgagaga 3240

attctgggtc atgaacacct caattcagag cacgatcatt cttctcattg agcaaattgt 3300

ggtagctctt gggggtgaat ttaagctcta cctgccccag ctgatcccac acatgctgcg 3360

tgtcttcatg catgacaaca gcccaggccg cattgtctct atcaagttac tggctgcaat 3420

ccagctgttt ggcgccaacc tggatgacta cctgcattta ctgctgcctc ctattgttaa 3480

gttgtttgat gcccctgaag ctccactgcc atctcgaaag gcagcgctag agactgtgga 3540

ccgcctgacg gagtccctgg atttcactga ctatgcctcc cggatcattc accctattgt 3600

tcgaacactg gaccagagcc cagaactgcg ctccacagcc atggacacgc tgtcttcact 3660

tgtttttcag ctggggaaga agtaccaaat tttcattcca atggtgaata aagttctggt 3720

gcgacaccga atcaatcatc agcgctatga tgtgctcatc tgcagaattg tcaagggata 3780

cacacttgct gatgaagagg aggatccttt gatttaccag catcggatgc ttaggagtgg 3840

ccaaggggat gcattggcta gtggaccagt ggaaacagga cccatgaaga aactgcacgt 3900

cagcaccatc aacctccaaa aggcctgggg cgctgccagg agggtctcca aagatgactg 3960

gctggaatgg ctgagacggc tgagcctgga gctgctgaag gactcatcat cgccctccct 4020

gcgctcctgc tgggccctgg cacaggccta caacccgatg gccagggatc tcttcaatgc 4080

tgcatttgtg tcctgctggt ctgaactgaa tgaagatcaa caggatgagc tcatcagaag 4140

catcgagttg gccctcacct cacaagacat cgctgaagtc acacagaccc tcttaaactt 4200

ggctgaattc atggaacaca gtgacaaggg ccccctgcca ctgagagatg acaatggcat 4260

tgttctgctg ggtgagagag ctgccaagtg ccgagcatat gccaaagcac tacactacaa 4320

agaactggag ttccagaaag gccccacccc tgccattcta gaatctctca tcagcattaa 4380

taataagcta cagcagccgg aggcagcggc cggagtgtta gaatatgcca tgaaacactt 4440

tggagagctg gagatccagg ctacctggta tgagaaactg cacgagtggg aggatgccct 4500

tgtggcctat gacaagaaaa tggacaccaa caaggacgac ccagagctga tgctgggccg 4560

catgcgctgc ctcgaggcct tgggggaatg gggtcaactc caccagcagt gctgtgaaaa 4620

gtggaccctg gttaatgatg agacccaagc caagatggcc cggatggctg ctgcagctgc 4680

atggggttta ggtcagtggg acagcatgga agaatacacc tgtatgatcc ctcgggacac 4740

ccatgatggg gcattttata gagctgtgct ggcactgcat caggacctct tctccttggc 4800

acaacagtgc attgacaagg ccagggacct gctggatgct gaattaactg cgatggcagg 4860

agagagttac agtcgggcat atggggccat ggtttcttgc cacatgctgt ccgagctgga 4920

ggaggttatc cagtacaaac ttgtccccga gcgacgagag atcatccgcc agatctggtg 4980

ggagagactg cagggctgcc agcgtatcgt agaggactgg cagaaaatcc ttatggtgcg 5040

gtcccttgtg gtcagccctc atgaagacat gagaacctgg ctcaagtatg caagcctgtg 5100

cggcaagagt ggcaggctgg ctcttgctca taaaacttta gtgttgctcc tgggagttga 5160

tccgtctcgg caacttgacc atcctctgcc aacagttcac cctcaggtga cctatgccta 5220

catgaaaaac atgtggaaga gtgcccgcaa gatcgatgcc ttccagcaca tgcagcattt 5280

tgtccagacc atgcagcaac aggcccagca tgccatcgct actgaggacc agcagcataa 5340

gcaggaactg cacaagctca tggcccgatg cttcctgaaa cttggagagt ggcagctgaa 5400

tctacagggc atcaatgaga gcacaatccc caaagtgctg cagtactaca gcgccgccac 5460

agagcacgac cgcagctggt acaaggcctg gcatgcgtgg gcagtgatga acttcgaagc 5520

tgtgctacac tacaaacatc agaaccaagc ccgcgatgag aagaagaaac tgcgtcatgc 5580

cagcggggcc aacatcacca acgccaccac tgccgccacc acggccgcca ctgccaccac 5640

cactgccagc accgagggca gcaacagtga gagcgaggcc gagagcaccg agaacagccc 5700

caccccatcg ccgctgcaga agaaggtcac tgaggatctg tccaaaaccc tcctgatgta 5760

cacggtgcct gccgtccagg gcttcttccg ttccatctcc ttgtcacgag gcaacaacct 5820

ccaggataca ctcagagttc tcaccttatg gtttgattat ggtcactggc cagatgtcaa 5880

tgaggcctta gtggaggggg tgaaagccat ccagattgat acctggctac aggttatacc 5940

tcagctcatt gcaagaattg atacgcccag acccttggtg ggacgtctca ttcaccagct 6000

tctcacagac attggtcggt accaccccca ggccctcatc tacccactga cagtggcttc 6060

taagtctacc acgacagccc ggcacaatgc agccaacaag attctgaaga acatgtgtga 6120

gcacagcaac accctggtcc agcaggccat gatggtgagc gaggagctga tccgagtggc 6180

catcctctgg catgagatgt ggcatgaagg cctggaagag gcatctcgtt tgtactttgg 6240

ggaaaggaac gtgaaaggca tgtttgaggt gctggagccc ttgcatgcta tgatggaacg 6300

gggcccccag actctgaagg aaacatcctt taatcaggcc tatggtcgag atttaatgga 6360

ggcccaagag tggtgcagga agtacatgaa atcagggaat gtcaaggacc tcacccaagc 6420

ctgggacctc tattatcatg tgttccgacg aatctcaaag cagctgcctc agctcacatc 6480

cttagagctg caatatgttt ccccaaaact tctgatgtgc cgggaccttg aattggctgt 6540

gccaggaaca tatgacccca accagccaat cattcgcatt cagtccatag caccgtcttt 6600

gcaagtcatc acatccaagc agaggccccg gaaattgaca cttatgggca gcaacggaca 6660

tgagtttgtt ttccttctaa aaggccatga agatctgcgc caggatgagc gtgtgatgca 6720

gctcttcggc ctggttaaca cccttctggc caatgaccca acatctcttc ggaaaaacct 6780

cagcatccag agatacgctg tcatcccttt atcgaccaac tcgggcctca ttggctgggt 6840

tccccactgt gacacactgc acgccctcat ccgggactac agggagaaga agaagatcct 6900

tctcaacatc gagcatcgca tcatgttgcg gatggctccg gactatgacc acttgactct 6960

gatgcagaag gtggaggtgt ttgagcatgc cgtcaataat acagctgggg acgacctggc 7020

caagctgctg tggctgaaaa gccccagctc cgaggtgtgg tttgaccgaa gaaccaatta 7080

tacccgttct ttagcggtca tgtcaatggt tgggtatatt ttaggcctgg gagatagaca 7140

cccatccaac ctgatgctgg accgtctgag tgggaagatc ctgcacattg actttgggga 7200

ctgctttgag gttgctatga cccgagagaa gtttccagag aagattccat ttagactaac 7260

aagaatgttg accaatgcta tggaggttac aggcctggat ggcaactaca gaatcacatg 7320

ccacacagtg atggaggtgc tgcgagagca caaggacagt gtcatggccg tgctggaagc 7380

ctttgtctat gaccccttgc tgaactggag gctgatggac acaaatacca aaggcaacaa 7440

gcgatcccga acgaggacgg attcctactc tgctggccag tcagtcgaaa ttttggacgg 7500

tgtggaactt ggagagccag cccataagaa aacggggacc acagtgccag aatctattca 7560

ttctttcatt ggagacggtt tggtgaaacc agaggcccta aataagaaag ctatccagat 7620

tattaacagg gttcgagata agctcactgg tcgggacttc tctcatgatg acactttgga 7680

tgttccaacg caagttgagc tgctcatcaa acaagcgaca tcccatgaaa acctctgcca 7740

gtgctatatt ggctggtgcc ctttctggta actggaggcc cagatgtgcc catcacgttt 7800

tttctgaggc ttttgtactt tagtaaatgc ttccactaaa ctgaaaccat ggtgagaaag 7860

tttgactttg ttaaatattt tgaaatgtaa atgaaaagaa ctactgtata ttaaaagttg 7920

gtttgaacca actttctagc tgctgttgaa gaatatattg tcagaaacac aaggcttgat 7980

ttggttccca ggacagtgaa acatagtaat accacgtaaa tcaagccatt cattttgggg 8040

aacagaagat ccataacttt agaaatacgg gttttgactt aactcacaag agaactcatc 8100

ataagtactt gctgatggaa gaatgaccta gttgctcctc tcaacatggg tacagcaaac 8160

tcagcacagc caagaagcct caggtcgtgg agaacatgga ttaggatcct agactgtaaa 8220

gacacagaag atgctgacct cacccctgcc acctatccca agacctcact ggtctgtgga 8280

cagcagcaga aatgtttgca agataggcca aaatgagtac aaaaggtctg tcttccatca 8340

gacccagtga tgctgcgact cacacgcttc aattcaagac ctgaccgcta gtagggaggt 8400

ttattcagat cgctggcagc ctcggctgag cagatgcaca gaggggatca ctgtgcagtg 8460

ggaccaccct cactggcctt ctgcagcagg gttctgggat gttttcagtg gtcaaaatac 8520

tctgtttaga gcaagggctc agaaaacaga aatactgtca tggaggtgct gaacacaggg 8580

aaggtctggt acatattgga aattatgagc agaacaaata ctcaactaaa tgcacaaagt 8640

ataaagtgta gccatgtcta gacaccatgt tgtatcagaa taatttttgt gccaataaat 8700

gacatcagaa ttttaaacat atgtaaaaaa aaa 8733

<210> SEQ ID NO: 8

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 8

cattcgggcc gagatgtct 19

<210> SEQ ID NO: 9

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 9

ctccaggcca gaaagagaga gtag 24

<210> SEQ ID NO: 10

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Probe

<400> SEQENCE: 10

ccgtggcctt agctgtgctc gc 22

<210> SEQ ID NO: 11

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 11

cacatggcct ccaaggagta a 21

<210> SEQ ID NO: 12

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 12

tgagggtctc tctcttcctc ttgt 24

<210> SEQ ID NO: 13

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Probe

<400> SEQENCE: 13

ctggaccacc agccccagca ag 22

<210> SEQ ID NO: 14

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 14

ccagggattt gcctcacctt 20

<210> SEQ ID NO: 15

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 15

aaagagatga agcccccaca t 21

<210> SEQ ID NO: 16

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Probe

<400> SEQENCE: 16

ccttgatgac tgccttgcct cctcag 26

<210> SEQ ID NO: 17

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 17

gctcgagatg tgatgaagga gat 23

<210> SEQ ID NO: 18

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 18

ccagcaggtc agcaaagaat t 21

<210> SEQ ID NO: 19

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Probe

<400> SEQENCE: 19

ccatcacatt gtagccctct gtgtgctc 28

<210> SEQ ID NO: 20

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 20

cacctagtgg ctgggagctt 20

<210> SEQ ID NO: 21

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 21

gcccagtttt atcatctcac aaga 24

<210> SEQ ID NO: 22

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Probe

<400> SEQENCE: 22

tggcacttac ctttgtccct tgcttca 27

<210> SEQ ID NO: 23

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 23

gaaggagctg cccatgagaa 20

<210> SEQ ID NO: 24

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 24

gactatgtcc cgccactgga t 21

<210> SEQ ID NO: 25

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Probe

<400> SEQENCE: 25

aaatcctgca tggcgccgtg c 21

<210> SEQ ID NO: 26

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 26

caccactcaa acgctgacat gta 23

<210> SEQ ID NO: 27

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 27

ccaactgcca ataccagtgg at 22

<210> SEQ ID NO: 28

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Probe

<400> SEQENCE: 28

tatgccattc ctcccccgca tca 23

<210> SEQ ID NO: 29

<211> LENGTH: 16

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 29

agcgctggcg aaatcg 16

<210> SEQ ID NO: 30

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 30

ttcacgcgaa ccagtgtca 19

<210> SEQ ID NO: 31

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Probe

<400> SEQENCE: 31

ctgtccacgc gcaacgtgtc g 21

<210> SEQ ID NO: 32

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 32

cacgggacat tcaccacatc 20

<210> SEQ ID NO: 33

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 33

gggtgccatc cacttcaca 19

<210> SEQ ID NO: 34

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Probe

<400> SEQENCE: 34

actataaaaa gacaaccaac ggccgactgc 30

<210> SEQ ID NO: 35

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 35

aggccgcatt gtctctatca a 21

<210> SEQ ID NO: 36

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 36

gcagtaaatg caggtagtca tcca 24

<210> SEQ ID NO: 37

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Probe

<400> SEQENCE: 37

tgcaatccag ctgtttggcg cc 22

<210> SEQ ID NO: 38

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 38

gaggtcgaca tccacaccta atg 23

<210> SEQ ID NO: 39

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 39

tcgaattgca tcctcaatca tc 22

<210> SEQ ID NO: 40

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Probe

<400> SEQENCE: 40

ccacatggtc agcaccaccc tgc 23

<210> SEQ ID NO: 41

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 41

cagatttcag agagcaccaa tca 23

<210> SEQ ID NO: 42

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 42

aatggtctac cacgggcttc t 21

<210> SEQ ID NO: 43

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Probe

<400> SEQENCE: 43

ttactccaac ttagcaaact gcagccccaa 30

Read more
PatSnap Solutions

Great research starts with great data.

Use the most comprehensive innovation intelligence platform to maximise ROI on research.

Learn More

Patent Valuation

$

Reveal the value <>

20.29/100 Score

Market Attractiveness

It shows from an IP point of view how many competitors are active and innovations are made in the different technical fields of the company. On a company level, the market attractiveness is often also an indicator of how diversified a company is. Here we look into the commercial relevance of the market.

66.0/100 Score

Market Coverage

It shows the sizes of the market that is covered with the IP and in how many countries the IP guarantees protection. It reflects a market size that is potentially addressable with the invented technology/formulation with a legal protection which also includes a freedom to operate. Here we look into the size of the impacted market.

70.15/100 Score

Technology Quality

It shows the degree of innovation that can be derived from a company’s IP. Here we look into ease of detection, ability to design around and significance of the patented feature to the product/service.

43.0/100 Score

Assignee Score

It takes the R&D behavior of the company itself into account that results in IP. During the invention phase, larger companies are considered to assign a higher R&D budget on a certain technology field, these companies have a better influence on their market, on what is marketable and what might lead to a standard.

16.7/100 Score

Legal Score

It shows the legal strength of IP in terms of its degree of protecting effect. Here we look into claim scope, claim breadth, claim quality, stability and priority.

Citation

Patents Cited in This Cited by
Title Current Assignee Application Date Publication Date
Methods for prognosis and monitoring cancer therapy BAYER HEALTHCARE LLC 13 September 2012 10 January 2013
Gene Expression Profiles and Methods of Use SIEMENS HEALTHCARE DIAGNOSTICS INC. 10 November 2006 16 September 2010
Biomarkers and methods for determining sensitivity to vascular endothelial growth factor receptor-2 modulators BRISTOL-MYERS SQUIBB COMPANY 11 April 2008 16 September 2010
Identification of signature genes associated with hepatocellular carcinoma BAYER HEALTHCARE LLC 21 October 2009 20 October 2011
Quantitative assays for PDGFR-beta in body fluids HAMER PETER J,CARNEY WALTER P,MORRIS LETICIA,ELTING JAMES 10 August 2006 15 February 2007
See full citation <>

More like this

Title Current Assignee Application Date Publication Date
Gene and protein expression profiles associated with the therapeutic efficacy of irinotecan NMDX, LLC 18 June 2009 03 December 2009
Uttroside b and derivatives thereof as therapeutics for hepatocellular carcinoma RAJIV GANDHI CENTRE FOR BIOTECHNOLOGY, AN AUTONOMOUS INSTITUTE UNDER THE DEPARTMENT OF BIO-TECHNOLOGY, GOVERNMENT OF INDIA 27 May 2017 07 December 2017
Methods for predicting sensibility to treatment with PARP inhibitors in cancerous patients XENTECH 12 April 2017 19 October 2017
Methods for treatment and selection of patients responsive to immune mediated cancer therapy BINNIG, GERD,ALTHAMMER, SONJA,SCHMIDT, GUNTER,HIGGS, BRANDON,STEELE, KEITH 09 December 2016 15 June 2017
Therapeutic and diagnostic methods for cancer GENENTECH, INC.,FOUNDATION MEDICINE, INC. 27 February 2017 08 September 2017
Gene signature predictive of hepatocellular carcinoma response to transcatheter arterial chemoembolization (TACE) THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES 07 February 2017 17 August 2017
Cancer patient selection for administration of wnt signaling inhibitors using RNF43 mutation status NOVARTIS AG,CONG, FENG,HAO, HUAIXIANG,HSIEH, HSIN-I,JIANG, XIAOMO 22 February 2013 06 September 2013
Method of determining a chemotherapeutic regimen based on ERCCI expression CANCER GENETICS, INC. 11 June 2001 03 June 2003
Molecular signature of hepatocellular carcinoma INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE (INSERM),UNIVERSITE DE RENNES 1 30 May 2017 07 December 2017
PREDICTION OF RESPONSIVENESS TO PIK3/mTOR INHIBITORS CEMM - FORSCHUNGSZENTRUM FÜR MOLEKULARE MEDIZIN GMBH,NIJMAN, SEBASTIAN,MUELLNER, MARKUS 22 March 2012 04 October 2012
Biomarkers and methods for determining sensitivity to vascular endothelial growth factor receptor-2 modulators BRISTOL-MYERS SQUIBB COMPANY,WU, SHUJIAN,AYERS, MARK DAVID,HAN, XIA,YOGANATHAN, SUGANTHY 12 March 2008 23 October 2008
Identification of predictive biomarkers associated with WNT pathway inhibitors ONCOMED PHARMACEUTICALS, INC. 10 June 2016 15 December 2016
발명의 명칭 유전자 다형성을 이용한 소라페닙 치료에 대한 반응성 예측방법 국립암센터 09 April 2014 20 October 2015
Biomarker profiles for predicting outcomes of cancer therapy with erbb3 inhibitors and/or chemotherapies MERRIMACK PHARMACEUTICALS, INC. 21 December 2016 27 July 2017
Biomarkers for sensitivity to Anti-IGF1r therapy SCHERING CORPORATION,WANG, YAN,WANG, YAOLIN,LEVITAN, DIANE,SEIDEL-DUGAN, CYNTHIA 17 December 2008 25 June 2009
Tumor antigens for determining cancer therapy BIONTECH AG,TRON - TRANSLATIONALE ONKOLOGIE AN DER UNIVERSITÄTSMEDIZIN DER JOHANNES GUTENBERG-UNIVERSITÄT MAINZ GEMEINNÜTZIGE GMBH 30 July 2014 05 February 2015
Method and biomarkers for predicting efficacy and evaluation of an ox40 agonist treatment GENENTECH, INC.,F. HOFFMANN-LA ROCHE AG 02 November 2015 12 May 2016
Diagnostic and therapeutic methods for cancer GENENTECH, INC.,F. HOFFMANN-LA ROCHE AG 11 April 2017 19 October 2017
Gene signatures for cancer detection and treatment ALMAC DIAGNOSTICS LIMITED 15 March 2017 21 September 2017
Methods for detecting, diagnosing and treating hepatocellular carcinomas (HCC) ONCOTHERAPY SCIENCE, INC.,THE UNIVERSITY OF TOKYO,NAKAMURA, YUSUKE,FURUKAWA, YOICHI 14 September 2004 02 June 2005
See all similar patents <>

More Patents & Intellectual Property

PatSnap Solutions

PatSnap solutions are used by R&D teams, legal and IP professionals, those in business intelligence and strategic planning roles and by research staff at academic institutions globally.

PatSnap Solutions
Search & Analyze
The widest range of IP search tools makes getting the right answers and asking the right questions easier than ever. One click analysis extracts meaningful information on competitors and technology trends from IP data.
Business Intelligence
Gain powerful insights into future technology changes, market shifts and competitor strategies.
Workflow
Manage IP-related processes across multiple teams and departments with integrated collaboration and workflow tools.
Contact Sales
Clsoe
US10017823 Analytical increasing susceptibility 1 US10017823 Analytical increasing susceptibility 2 US10017823 Analytical increasing susceptibility 3