Great research starts with great data.

Learn More
More >
Patent Analysis of

Method for determining nucleic acid composition of nucleic acid mixture

Updated Time 12 June 2019

Patent Registration Data

Publication Number

US10017824

Application Number

US14/908695

Application Date

30 July 2013

Publication Date

10 July 2018

Current Assignee

BGI GENOMICS CO., LIMITED

Original Assignee (Applicant)

BGI GENOMICS CO., LIMITED

International Classification

C12Q1/6853,C12Q1/6851,C12Q1/6876,C12Q1/6827,C12Q1/6881

Cooperative Classification

C12Q1/6886,C12Q1/6827,C12Q1/6881,C12Q1/6876,C12Q1/6851

Inventor

PAN, XIAOYU,GUO, JING,JIANG, HUI,CHEN, FANG,CHEN, SHENGPEI,ZHU, SHIDA,FAN, FAN,ZHU, JIALOU

Patent Images

This patent contains figures and images illustrating the invention and its embodiment.

US10017824 Method determining nucleic acid 1 US10017824 Method determining nucleic acid 2 US10017824 Method determining nucleic acid 3
See all images <>

Abstract

The present invention provides a method for determining the nucleic acid composition in a total nucleic acid mixture comprising a first nucleic acid and a second nucleic acid. The method comprises: 1) treating the total nucleic acid mixture with a bisulfate, to convert the non-methylated cytosine in the total nucleic acid mixture into uracil, and obtain a converted total nucleic acid mixture; 2) subjecting the converted total nucleic acid mixture to multiplexed fluorescent quantitative PCR using a first set of amplification primers and a second set of amplification primers; and 3) based on the ratio R of the methylated amplification product to the non-methylated amplification product of the predetermined nucleic acid fragment, a methylation proportion M1 of the predetermined nucleic acid fragment in the first nucleic acid, and a methylation proportion M2 of the predetermined nucleic acid fragment in the second nucleic acid, determining the nucleic acid composition in the total nucleic acid mixture.

Read more

Claims

1. A method for determining the nucleic acid composition of a total nucleic acid mixture comprising a first nucleic acid and a second nucleic acid, in which the first nucleic acid and the second nucleic acid are derived from different sources, the method comprising: 1) treating the total nucleic acid mixture with a bisulfite to convert non-methylated cytosine in the total nucleic acid mixture into uracil and to obtain a converted total nucleic acid mixture; 2) subjecting the converted total nucleic acid mixture to multiplexed fluorescent quantitative PCR using a first set of amplification primers and a second set of amplification primers to capture and amplify a predetermined nucleic acid fragment and obtain a ratio R of a methylated amplification product to a non-methylated amplification product of the predetermined nucleic acid fragment wherein the first nucleic acid and the second nucleic acid each contain the predetermined nucleic acid fragment, and the first nucleic acid and the second nucleic acid have different methylation levels in the predetermined nucleic acid fragment; wherein the first set of amplification primers specifically recognizes the predetermined nucleic acid fragment after the non-methylated cytosine in the predetermined nucleic acid fragment is converted into uracil, and the second set of amplification primers specifically recognizes the unconverted predetermined nucleic acid fragment; and wherein a methylation proportion M1=[number of methylated cytosine (mC)/total number of cytosine (C)] of the predetermined nucleic acid fragment in the first nucleic acid and a methylation proportion M2=[number of methylated cytosine (mC)/total number of cytosine (C)] of the predetermined nucleic acid fragment in the second nucleic acid are predetermined using paired control samples that correspond to the first and second nucleic acids; and 3) determining the nucleic acid content ε of the first nucleic acid in the total nucleic acid mixture according to the formula ε=(M2+RM2−R)/[R(M2−M1)−(M1−M2)] or ε=R/[M1R+M1]; wherein the predetermined nucleic acid fragment is a portion of the RASSF1A gene; wherein the predetermined nucleic acid fragment further comprises one or more additional predetermined nucleic acid fragments located within one or more genes selected from the group consisting of at least a portion of genes: SERPINB5, C21orf63, OLIG2, CBR1, SIM2, DSCAM, TRPM2, C21orf29, COL18A1, AIRE, ERG, CD48, FAIM3, ARHGAP25, BMP3, VIM, NDRG4, TFPI2, SFRP2, SEPT9, and SELPLG, and wherein the first set of amplification primers comprise the nucleotide sequences of SEQ ID NOs: 7 and 8.

2. The method according to claim 1, wherein the total nucleic acid mixture contains DNAs from maternal plasma, the first nucleic acid is a fetal DNA, and the second nucleic acid is a maternal DNA.

3. The method according to claim 1, wherein the first nucleic acid is a cancer cell DNA, and the second nucleic acid is a non-cancer cell DNA.

4. The method according to claim 1, wherein M1 is at least 10×, or at least 50× the value of M2.

5. The method according to claim 1, wherein for each gene, the predetermined nucleic acid fragment comprises at least one region selected from the group consisting of the following nucleic acid sequences: chr3:50378097-50378226 of the RASSF1A gene; chr21:45703903-45704111 of the AIRE gene; chr21:38078780-38079213 of the SIM2 gene; chr21:39878777-39879107 of the ERG gene; chr1:160681560-160681732 of the CD48 gene; chr1:207096473-207096654 of the FAIM3 gene; chr2:69001823-69002052 of the ARHGAP25 gene; chr12:109028663-109028901 of the SELPLG gene; chr4:81951942-81952808 of the BMP3 gene; chr10:17270431-17272617 of the VIM gene; chr16:58497034-58498595 of the NDRG4; chr7:93519367-93520184 of the TFPI2 gene; chr4:154709513-154710827 of the SFRP2 gene; and chr17:75368689-75370506 of the SEPT9 gene.

6. A method for determining the nucleic acid composition of a total nucleic acid mixture comprising a first nucleic acid and a second nucleic acid, in which the first nucleic acid and the second nucleic acid are derived from different sources, the method comprising: 1) treating the total nucleic acid mixture with a bisulfite to convert non-methylated cytosine in the total nucleic acid mixture into uracil and to obtain a converted total nucleic acid mixture; 2) subjecting the converted total nucleic acid mixture to multiplexed fluorescent quantitative PCR using a first set of amplification primers and a second set of amplification primers to capture and amplify a predetermined nucleic acid fragment and obtain a ratio R of a methylated amplification product to a non-methylated amplification product of the predetermined nucleic acid fragment wherein the first nucleic acid and the second nucleic acid each contain the predetermined nucleic acid fragment, and the first nucleic acid and the second nucleic acid have different methylation levels in the predetermined nucleic acid fragment; wherein the first set of amplification primers specifically recognizes the predetermined nucleic acid fragment after the non-methylated cytosine in the predetermined nucleic acid fragment is converted into uracil, and the second set of amplification primers specifically recognizes the unconverted predetermined nucleic acid fragment and wherein a methylation proportion M1=[number of methylated cytosine (mC)/total number of cytosine (C)] of the predetermined nucleic acid fragment in the first nucleic acid and a methylation proportion M2=[number of methylated cytosine (mC)/total number of cytosine (C)] of the predetermined nucleic acid fragment in the second nucleic acid are predetermined using paired control samples that correspond to the first and second nucleic acids; and 3) determining the nucleic acid content ε of the first nucleic acid in the total nucleic acid mixture according to the formula ε=(M2+RM2−R)/[R(M2−M1)−(M1−M2)] or ε=R/[M1R+M1]; wherein the predetermined nucleic acid fragment is a portion of the RASSF1A gene; wherein the predetermined nucleic acid fragment further comprises one or more additional predetermined nucleic acid fragments located within one or more genes selected from the group consisting of at least a portion of genes: SERPINB5, C21orf63, OLIG2, CBR1, SIM2, DSCAM, TRPM2, C21orf29, COL18A1, AIRE, ERG, CD48, FAIM3, ARHGAP25, BMP3, VIM, NDRG4, TFPI2, SFRP2, SEPT9, and SELPLG; and wherein the second set of amplification primers comprise the nucleotide sequences of SEQ ID NOs: 4 and 5.

7. The method according to claim 6, wherein the total nucleic acid mixture contains DNAs from maternal plasma, the first nucleic acid is a fetal DNA, and the second nucleic acid is a maternal DNA.

8. The method according to claim 6, wherein the first nucleic acid is a cancer cell DNA, and the second nucleic acid is a non-cancer cell DNA.

9. The method according to claim 6, wherein M1 is at least 10×, or at least 50× the value of M2.

10. The method according to claim 6, wherein for each gene, the predetermined nucleic acid fragment comprises at least one region selected from the group consisting of the following nucleic acid sequences: chr3:50378097-50378226 of the RASSF1A gene; chr21:45703903-45704111 of the AIRE gene; chr21:38078780-38079213 of the SIM2 gene; chr21:39878777-39879107 of the ERG gene; chr1:160681560-160681732 of the CD48 gene; chr1:207096473-207096654 of the FAIM3 gene; chr2:69001823-69002052 of the ARHGAP25 gene; chr12:109028663-109028901 of the SELPLG gene; chr4:81951942-81952808 of the BMP3 gene; chr10:17270431-17272617 of the VIM gene; chr16:58497034-58498595 of the NDRG4; chr7:93519367-93520184 of the TFPI2 gene; chr4:154709513-154710827 of the SFRP2 gene; and chr17:75368689-75370506 of the SEPT9 gene.

11. A method for determining the nucleic acid composition of a total nucleic acid mixture comprising a first nucleic acid and a second nucleic acid, in which the first nucleic acid and the second nucleic acid are derived from different sources, the method comprising: 1) treating the total nucleic acid mixture with a bisulfite to convert non-methylated cytosine in the total nucleic acid mixture into uracil and to obtain a converted total nucleic acid mixture; 2) subjecting the converted total nucleic acid mixture to multiplexed fluorescent quantitative PCR using a first set of amplification primers and a second set of amplification primers to capture and amplify a predetermined nucleic acid fragment and obtain a ratio R of a methylated amplification product to a non-methylated amplification product of the predetermined nucleic acid fragment; wherein the first nucleic acid and the second nucleic acid each contain the predetermined nucleic acid fragment, and the first nucleic acid and the second nucleic acid have different methylation levels in the predetermined nucleic acid fragment; wherein the first set of amplification primers specifically recognizes the predetermined nucleic acid fragment after the non-methylated cytosine in the predetermined nucleic acid fragment is converted into uracil, and the second set of amplification primers specifically recognizes the unconverted predetermined nucleic acid fragment and wherein a methylation proportion M1=[number of methylated cytosine (mC)/total number of cytosine (C)] of the predetermined nucleic acid fragment in the first nucleic acid and a methylation proportion M2=[number of methylated cytosine (mC)/total number of cytosine (C)] of the predetermined nucleic acid fragment in the second nucleic acid are predetermined using paired control samples that correspond to the first and second nucleic acids; and 3) determining the nucleic acid content ε of the first nucleic acid in the total nucleic acid mixture according to the formula ε=(M2+RM2−R)/[R(M2−M1)−(M1−M2)] or ε=R/[M1R+M1]; wherein the predetermined nucleic acid fragment is a portion of the RASSF1A gene; wherein the predetermined nucleic acid fragment further comprises one or more additional predetermined nucleic acid fragments located within one or more genes selected from the group consisting of at least a portion of genes: SERPINB5, C21orf63, OLIG2, CBR1, SIM2, DSCAM, TRPM2, C21orf29, COL18A1, AIRE, ERG, CD48, FAIM3, ARHGAP25, BMP3, VIM, NDRG4, TFPI2, SFRP2, SEPT9, and SELPLG; and wherein a methylation specific probe and a non-methylation specific probe are further used in the multiplexed fluorescent quantitative PCR, wherein the methylation specific probe has the nucleotide sequence of SEQ ID NO: 6, and the non-methylation specific probe has the nucleotide sequence of SEQ ID NO: 9.

12. The method according to claim 11, wherein the methylation specific probe and the non-methylation specific probe are each labeled with at least one marker selected from the group consisting of FAM, JOE, and TAMRA.

13. The method according to claim 11, wherein the total nucleic acid mixture contains DNAs from maternal plasma, the first nucleic acid is a fetal DNA, and the second nucleic acid is a maternal DNA.

14. The method according to claim 11, wherein the first nucleic acid is a cancer cell DNA, and the second nucleic acid is a non-cancer cell DNA.

15. The method according to claim 11, wherein M1 is at least 10×, or at least 50× the value of M2.

16. The method according to claim 11, wherein for each gene, the predetermined nucleic acid fragment comprises at least one region selected from the group consisting of the following nucleic acid sequences: chr3:50378097-50378226 of the RASSF1A gene; chr21:45703903-45704111 of the AIRE gene; chr21:38078780-38079213 of the SIM2 gene; chr21:39878777-39879107 of the ERG gene; chr1:160681560-160681732 of the CD48 gene; chr1:207096473-207096654 of the FAIM3 gene; chr2:69001823-69002052 of the ARHGAP25 gene; chr12:109028663-109028901 of the SELPLG gene; chr4:81951942-81952808 of the BMP3 gene; chr10:17270431-17272617 of the VIM gene; chr16:58497034-58498595 of the NDRG4; chr7:93519367-93520184 of the TFPI2 gene; chr4:154709513-154710827 of the SFRP2 gene; and chr17:75368689-75370506 of the SEPT9 gene.

17. The method according to claim 11, wherein the first set of amplification primers comprise the nucleotide sequences of SEQ ID NOs: 7 and 8 and/or the second set of amplification primers comprise the nucleotide sequences of SEQ ID NOs: 4 and 5.

Read more

Claim Tree

  • 1
    1. A method for determining the nucleic acid composition of a total nucleic acid mixture comprising a first nucleic acid and a second nucleic acid, in which the first nucleic acid and the second nucleic acid are derived from different sources, the method comprising:
    • 1) treating the total nucleic acid mixture with a bisulfite to convert non-methylated cytosine in the total nucleic acid mixture into uracil and to obtain a converted total nucleic acid mixture;
    • 2) subjecting the converted total nucleic acid mixture to multiplexed fluorescent quantitative PCR using a first set of amplification primers and a second set of amplification primers to capture and amplify a predetermined nucleic acid fragment and obtain a ratio R of a methylated amplification product to a non-methylated amplification product of the predetermined nucleic acid fragment wherein the first nucleic acid and the second nucleic acid each contain the predetermined nucleic acid fragment, and the first nucleic acid and the second nucleic acid have different methylation levels in the predetermined nucleic acid fragment; wherein the first set of amplification primers specifically recognizes the predetermined nucleic acid fragment after the non-methylated cytosine in the predetermined nucleic acid fragment is converted into uracil, and the second set of amplification primers specifically recognizes the unconverted predetermined nucleic acid fragment; and wherein a methylation proportion M1=[number of methylated cytosine (mC)/total number of cytosine (C)] of the predetermined nucleic acid fragment in the first nucleic acid and a methylation proportion M2=[number of methylated cytosine (mC)/total number of cytosine (C)] of the predetermined nucleic acid fragment in the second nucleic acid are predetermined using paired control samples that correspond to the first and second nucleic acids; and
    • 3) determining the nucleic acid content ε of the first nucleic acid in the total nucleic acid mixture according to the formula ε=(M2+RM2−R)/[R(M2−M1)−(M1−M2)] or ε=R/[M1R+M1]; wherein the predetermined nucleic acid fragment is a portion of the RASSF1A gene; wherein the predetermined nucleic acid fragment further comprises one or more additional predetermined nucleic acid fragments located within one or more genes selected from the group consisting of at least a portion of genes: SERPINB5, C21orf63, OLIG2, CBR1, SIM2, DSCAM, TRPM2, C21orf29, COL18A1, AIRE, ERG, CD48, FAIM3, ARHGAP25, BMP3, VIM, NDRG4, TFPI2, SFRP2, SEPT9, and SELPLG, and wherein the first set of amplification primers comprise the nucleotide sequences of SEQ ID NOs: 7 and 8.
    • 2. The method according to claim 1, wherein
      • the total nucleic acid mixture contains DNAs from maternal plasma, the first nucleic acid is a fetal DNA, and the second nucleic acid is a maternal DNA.
    • 3. The method according to claim 1, wherein
      • the first nucleic acid is a cancer cell DNA, and the second nucleic acid is a non-cancer cell DNA.
    • 4. The method according to claim 1, wherein
      • M1 is at least 10×, or at least 50× the value of M2.
    • 5. The method according to claim 1, wherein
      • for each gene, the predetermined nucleic acid fragment comprises
  • 6
    6. A method for determining the nucleic acid composition of a total nucleic acid mixture comprising a first nucleic acid and a second nucleic acid, in which the first nucleic acid and the second nucleic acid are derived from different sources, the method comprising:
    • 1) treating the total nucleic acid mixture with a bisulfite to convert non-methylated cytosine in the total nucleic acid mixture into uracil and to obtain a converted total nucleic acid mixture;
    • 2) subjecting the converted total nucleic acid mixture to multiplexed fluorescent quantitative PCR using a first set of amplification primers and a second set of amplification primers to capture and amplify a predetermined nucleic acid fragment and obtain a ratio R of a methylated amplification product to a non-methylated amplification product of the predetermined nucleic acid fragment wherein the first nucleic acid and the second nucleic acid each contain the predetermined nucleic acid fragment, and the first nucleic acid and the second nucleic acid have different methylation levels in the predetermined nucleic acid fragment; wherein the first set of amplification primers specifically recognizes the predetermined nucleic acid fragment after the non-methylated cytosine in the predetermined nucleic acid fragment is converted into uracil, and the second set of amplification primers specifically recognizes the unconverted predetermined nucleic acid fragment and wherein a methylation proportion M1=[number of methylated cytosine (mC)/total number of cytosine (C)] of the predetermined nucleic acid fragment in the first nucleic acid and a methylation proportion M2=[number of methylated cytosine (mC)/total number of cytosine (C)] of the predetermined nucleic acid fragment in the second nucleic acid are predetermined using paired control samples that correspond to the first and second nucleic acids; and
    • 3) determining the nucleic acid content ε of the first nucleic acid in the total nucleic acid mixture according to the formula ε=(M2+RM2−R)/[R(M2−M1)−(M1−M2)] or ε=R/[M1R+M1]; wherein the predetermined nucleic acid fragment is a portion of the RASSF1A gene; wherein the predetermined nucleic acid fragment further comprises one or more additional predetermined nucleic acid fragments located within one or more genes selected from the group consisting of at least a portion of genes: SERPINB5, C21orf63, OLIG2, CBR1, SIM2, DSCAM, TRPM2, C21orf29, COL18A1, AIRE, ERG, CD48, FAIM3, ARHGAP25, BMP3, VIM, NDRG4, TFPI2, SFRP2, SEPT9, and SELPLG; and wherein the second set of amplification primers comprise the nucleotide sequences of SEQ ID NOs: 4 and 5.
    • 7. The method according to claim 6, wherein
      • the total nucleic acid mixture contains DNAs from maternal plasma, the first nucleic acid is a fetal DNA, and the second nucleic acid is a maternal DNA.
    • 8. The method according to claim 6, wherein
      • the first nucleic acid is a cancer cell DNA, and the second nucleic acid is a non-cancer cell DNA.
    • 9. The method according to claim 6, wherein
      • M1 is at least 10×, or at least 50× the value of M2.
    • 10. The method according to claim 6, wherein
      • for each gene, the predetermined nucleic acid fragment comprises
  • 11
    11. A method for determining the nucleic acid composition of a total nucleic acid mixture comprising a first nucleic acid and a second nucleic acid, in which the first nucleic acid and the second nucleic acid are derived from different sources, the method comprising:
    • 1) treating the total nucleic acid mixture with a bisulfite to convert non-methylated cytosine in the total nucleic acid mixture into uracil and to obtain a converted total nucleic acid mixture;
    • 2) subjecting the converted total nucleic acid mixture to multiplexed fluorescent quantitative PCR using a first set of amplification primers and a second set of amplification primers to capture and amplify a predetermined nucleic acid fragment and obtain a ratio R of a methylated amplification product to a non-methylated amplification product of the predetermined nucleic acid fragment; wherein the first nucleic acid and the second nucleic acid each contain the predetermined nucleic acid fragment, and the first nucleic acid and the second nucleic acid have different methylation levels in the predetermined nucleic acid fragment; wherein the first set of amplification primers specifically recognizes the predetermined nucleic acid fragment after the non-methylated cytosine in the predetermined nucleic acid fragment is converted into uracil, and the second set of amplification primers specifically recognizes the unconverted predetermined nucleic acid fragment and wherein a methylation proportion M1=[number of methylated cytosine (mC)/total number of cytosine (C)] of the predetermined nucleic acid fragment in the first nucleic acid and a methylation proportion M2=[number of methylated cytosine (mC)/total number of cytosine (C)] of the predetermined nucleic acid fragment in the second nucleic acid are predetermined using paired control samples that correspond to the first and second nucleic acids; and
    • 3) determining the nucleic acid content ε of the first nucleic acid in the total nucleic acid mixture according to the formula ε=(M2+RM2−R)/[R(M2−M1)−(M1−M2)] or ε=R/[M1R+M1]; wherein the predetermined nucleic acid fragment is a portion of the RASSF1A gene; wherein the predetermined nucleic acid fragment further comprises one or more additional predetermined nucleic acid fragments located within one or more genes selected from the group consisting of at least a portion of genes: SERPINB5, C21orf63, OLIG2, CBR1, SIM2, DSCAM, TRPM2, C21orf29, COL18A1, AIRE, ERG, CD48, FAIM3, ARHGAP25, BMP3, VIM, NDRG4, TFPI2, SFRP2, SEPT9, and SELPLG; and wherein a methylation specific probe and a non-methylation specific probe are further used in the multiplexed fluorescent quantitative PCR, wherein the methylation specific probe has the nucleotide sequence of SEQ ID NO: 6, and the non-methylation specific probe has the nucleotide sequence of SEQ ID NO: 9.
    • 12. The method according to claim 11, wherein
      • the methylation specific probe and the non-methylation specific probe are each labeled with at least one marker selected from the group consisting of
    • 13. The method according to claim 11, wherein
      • the total nucleic acid mixture contains DNAs from maternal plasma, the first nucleic acid is a fetal DNA, and the second nucleic acid is a maternal DNA.
    • 14. The method according to claim 11, wherein
      • the first nucleic acid is a cancer cell DNA, and the second nucleic acid is a non-cancer cell DNA.
    • 15. The method according to claim 11, wherein
      • M1 is at least 10×, or at least 50× the value of M2.
    • 16. The method according to claim 11, wherein
      • for each gene, the predetermined nucleic acid fragment comprises
    • 17. The method according to claim 11, wherein
      • the first set of amplification primers comprise
See all independent claims <>

Description

CROSS-REFERENCE TO RELATED APPLICATION

This application is a Section 371 of International Application No. PCT/CN2013/080419, filed Jul. 30, 2013, which was published in the Chinese language on Feb. 5, 2015, under International Publication No. WO 2015/013885 A1, and the disclosure of which is incorporated herein by reference.

REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

This application contains a sequence listing, which is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file name “Sequence_Listing.TXT”, creation date of Jan. 26, 2016, and having a size of 5.1 kilobytes. The sequence listing submitted via EFS-Web is part of the specification and is herein incorporated by reference in entirety.

BACKGROUND

Technical Field

The present invention relates to the field of biological technology, particularly to a method for determining nucleic acid composition in a nucleic acid mixture, and more specifically to a method for determining the content of a first nucleic acid in a total nucleic acid mixture comprising the first nucleic acid and a second nucleic acid.

Related Art

Prenatal diagnosis is one of the most efficient ways to reduce congenital anomalies by diagnosing congenital defects or genetic diseases in a fetus before birth using various detection tools, for example, imaging, biochemical, cytogenetic, and molecular biological technologies.

Since 1997, research has shown that cell-free fetal DNA is present in the peripheral blood of a pregnant woman, and this finding generates a new opportunity for noninvasive fetal screening.

In the existing method for detecting fetal chromosomal aneuploidy by sequence analysis of the maternal plasma, the total free DNA in the maternal plasma is generally sequenced, without making a discrimination between the fetal and maternal DNA, and whether the fetus has chromosomal aneuploidy is determined using a significance test. The method has certain advantages in noninvasive screening of trisomies. However, when the fetal DNA concentration is low, a false negative result may potentially be obtained due to a low significance of the chromosomal abnormality.

Therefore, there is a need for an improved method for quantifying the fetal DNA in the maternal plasma.

DNA methylation refers to a chemical modification process in which in the presence of a DNA methyl transferase, a methyl group is added to the C-5 carbon of cytosine, to produce methylcytosine. Such a DNA methylation modification may be individual-, tissue- or cell-specific, such that the DNA from different sources (for example, fetal versus maternal DNA, or tumor versus normal DNA) can be discriminated based on the methylation of a particular gene, allowing the DNA from a source to be quantified.

For detection of cancers at an early stage, the methylation of a particular gene is closely linked to the occurrence and development of cancers, and thus can be used as a potential marker in early diagnosis. For example, colorectal cancer, also referred to as large intestine cancer, involves the proliferation of tumors in the large intestine, the rectum and the appendix. In the western world, it is the third most prevalent cancer, and the second leading cancer-causing death. Generally, it is thought that many large intestine cancers originate from the adenomatous polyp of the large intestine. These mushroom-like tumors are generally benign, but some of them develop into cancers after a period of time. Colon cancer may be effectively treated at an early stage by surgical operation before metastasis, to prolong survival time. Therefore, the detection of colorectal cancer at an early stage is a key factor determining whether a successful and absolute cure can be achieved. A highly specific and sensitive marker is crucial for the diagnosis of colorectal cancers. For example, qualitative and quantitative detection of abnormally high DNA methylation in serum and excrements is a new, highly promising, and non-invasive method for screening for colorectal cancer.

SUMMARY

The present invention aims to solve at least one of the technical problems above to some extent or to provide at least a useful commercial option. For this purpose, an objective of the present invention is to provide a method for effectively determining nucleic acid composition in a nucleic acid mixture comprising nucleic acids from a variety of sources.

The present invention provides a method for determining nucleic acid composition in a total nucleic acid mixture comprising a first nucleic acid and a second nucleic acid, in which the first nucleic acid and the second nucleic acid are derived from different sources, including, but not limited to, different individuals, different tissues, and different cells. According to an embodiment of the present invention, the method comprises: 1) treating the total nucleic acid mixture with a bisulfite to convert the non-methylated cytosine in the total nucleic acid mixture into uracil, and to obtain a converted total nucleic acid mixture; 2) subjecting the converted total nucleic acid mixture to multiplexed fluorescent quantitative PCR using a first set of amplification primers and a second set of amplification primers to capture and amplify a predetermined nucleic acid fragment, and to obtain a ratio R of a methylated amplification product to a non-methylated amplification product of the predetermined nucleic acid fragment, in which the first nucleic acid and the second nucleic acid both contain the predetermined nucleic acid fragment, and the predetermined nucleic acid fragment in the first nucleic acid differs from the predetermined nucleic acid fragment in the second nucleic acid in terms of the methylation level; the first set of amplification primers specifically recognize the converted predetermined nucleic acid fragment, and the second set of amplification primers specifically recognize the unconverted predetermined nucleic acid fragment; and a methylation proportion M1 of the predetermined nucleic acid fragment in the first nucleic acid and a methylation proportion M2 of the predetermined nucleic acid fragment in the second nucleic acid are predetermined; and 3) determining the nucleic acid composition in the total nucleic acid mixture based on the ratio R of the methylated amplification product to the non-methylated amplification product of the predetermined nucleic acid fragment, the methylation proportion M1 of the predetermined nucleic acid fragment in the first nucleic acid, and the methylation proportion M2 of the predetermined nucleic acid fragment in the second nucleic acid.

According to an embodiment of the present invention, the treatment of DNA with a bisulfite allows the non-methylated cytosine to be converted into uracil by deamination, while the cytosine protected with a methyl group remains unchanged, such that a methylated cytosine site can be discriminated from a non-methylated cytosine site. Further, after PCR, the original methylated cytosine remains unchanged, and the uracil obtained after treatment with a bisulfite is completely converted into thymine. Therefore, a methylated fragment or a non-methylated fragment in the DNA obtained after treatment with a bisulfite can be specifically amplified by designing a methylation specific or non-methylation specific PCR primer. The number of methylated fragments and non-methylated fragments correlates with the composition ratio of nucleic acid molecules from different sources, allowing the composition of nucleic acid molecules from different sources, for example, the content of a first nucleic acid or a second nucleic acid, in the nucleic acid mixture to be effectively determined using the method according to the present invention.

According to an embodiment of the present invention, the method can further have the following additional technical features.

In an embodiment according to the present invention, the first nucleic acid is a fetal DNA, and the second nucleic acid is a maternal DNA. Optionally, the total nucleic acid mixture is from maternal plasma DNA. Accordingly, the fetal DNA concentration in the mixture of maternal and fetal DNA can be effectively determined. In some other embodiments of the present invention, the first nucleic acid is a cancer cell DNA, and the second nucleic acid is a non-cancer cell DNA. Optionally, the total nucleic acid mixture is present in a tissue, plasma, or fecal DNA sample from a tumor patient. Therefore, the methylation level in cancer tissues of tumor patients can be analyzed.

In an embodiment according to the present invention, the contents of the first nucleic acid in the total nucleic acid mixture is determined in Step 3) according to the formula ε=(M2+RM2−R/[R(M2−M1)−(M1−M2)] to thereby effectively determine the composition and content of nucleic acid molecules in the total nucleic acid mixture.

In an embodiment according to the present invention, M1 is at least 10×, preferably at least 50×, more preferably at least 90×, and most preferably at least 100× the value of M2 to thereby further improve the efficiency with which the composition and content of the nucleic acid molecules are determined.

In an embodiment according to the present invention, the contents of the first nucleic acid in the total nucleic acid mixture is determined in Step 3) according to the formula ε=R/[M1R+M1] to thereby further simplify the method for determining the composition and content of nucleic acid molecules in the total nucleic acid mixture, and further improve the efficiency with which the composition and content of the nucleic acid molecules in the total nucleic acid mixture are determined.

In an embodiment according to the present invention, the predetermined nucleic acid fragment includes one or more nucleic acid fragments located on different chromosomes.

In an embodiment according to the present invention, the predetermined nucleic acid fragment includes one or more nucleic acid fragments located on different genes. In an embodiment according to the present invention, the predetermined nucleic acid fragment can be selected from at least a portion of a gene of RASSF1A, SERPINB5, C21orf63, OLIG2, CBR1, SIM2, DSCAM, TRPM2, C21orf29, COL18A1, AIRE, ERG, CD48, FAIM3, ARHGAP25, BMP3, VIM, NDRG4, TFPI2, SFRP2, SEPT9, or SELPLG. Therefore, the method can be effectively used in prenatal and tumor screening. According to an embodiment of the present invention, for various genes, the predetermined nucleic acid fragment includes at least one selected from the nucleic acid sequences shown below:


Gene
Nucleic acid sequence
RASSF1A
chr3: 50378097-50378226
AIRE
chr21: 45703903-45704111
SIM2
chr21: 38078780-38079213
ERG
chr21: 39878777-39879107
CD48
chr1: 160681560-160681732
FAIM3
chr1: 207096473-207096654
ARHGAP25
chr2: 69001823-69002052
SELPLG
chr12: 109028663-109028901
BMP3
chr4: 81951942-81952808
VIM
chr10: 17270431-17272617
NDRG4
chr16: 58497034-58498595
TFPI2
chr7: 93519367-93520184
SFRP2
chr4: 154709513-154710827
SEPT9
chr17: 75368689-75370506

Accordingly, the fetal DNA concentration in a mixture of maternal and fetal DNA, or the concentration of the cancer cell DNA in a mixture of cancer cell and non-cancer cell DNA derived from a tumor tissue of a tumor patient can be effectively determined. In an embodiment according to the present invention, for a RASSF1A gene, the first set of amplification primers include nucleic acid molecules as shown in SEQ ID NOs: 7 and 8. Accordingly, the fetal DNA concentration in a mixture of maternal and fetal DNA, or the concentration of the cancer cell DNA in a mixture of cancer cell and non-cancer cell DNA derived from a tumor tissue can be effectively determined.

In an embodiment according to the present invention, for a RASSF1A gene, the second set of amplification primers include nucleic acid molecules as shown in SEQ ID NOs: 4 and 5. Accordingly, the fetal DNA concentration in a mixture of maternal and fetal DNA, or the concentration of the cancer cell DNA in a mixture of cancer cell and non-cancer cell DNA derived from a tumor tissue can be effectively determined.

In an embodiment according to the present invention, a methylation specific probe and a non-methylation specific probe are further used in the multiplexed fluorescent quantitative PCR to thereby further improve the efficiency of the fluorescent quantitative PCR.

In an embodiment according to the present invention, a methylation specific probe and a non-methylation specific probe each bear a marker selected from at least one of FAM, JOE, and TAMRA to thereby further improve the efficiency of the fluorescent quantitative PCR.

In an embodiment according to the present invention, a methylation specific probe has a sequence as shown in SEQ ID NO: 6, and a non-methylation specific probe has a sequence as shown in SEQ ID NO: 9 to thereby further improve the efficiency of the fluorescent quantitative PCR.

In an embodiment according to the present invention, a methylation specific probe is marked with FAM and TAMRA to thereby further improve the efficiency of the fluorescent quantitative PCR. In an embodiment according to the present invention, a non-methylation specific probe is marked with JOE and TAMRA to thereby further improve the efficiency of the fluorescent quantitative PCR.

Accordingly, a method according to the present invention has at least the following advantages:

1. The content of a specific DNA in a DNA specimen from a subject can be assayed by a method according to an embodiment of the present invention using methylation specific multiplexed quantitative PCR.

2. Methods according to embodiments of the present invention are rapid and convenient. A method according to an embodiment of the present invention includes only a few steps, practically merely including options of DNA extraction, bisulfite treatment and quantitative PCR (QPCR). The convenience of the method makes a method according to the embodiment of the present invention applicable to various types of clinical detection (for example, detection of the fetal DNA in maternal plasma, or the detection of DNA content in tumor cells in specimens from tumor patients). The quickness of the method allows a method according to the embodiment of the present invention to be potentially applicable to quality control analysis of various types of clinical detection (for example, non-invasive prenatal diagnosis).

3. A method according to an embodiment of the present invention has a high throughput. The present invention involves a method for quantification by (but not limited to) QPCR, which has the advantage of high throughput. For example, using Applied Biosystems® StepOne™ or StepOnePlus™ Real-Time PCR Systems, up to 96 samples can be analyzed in one QPCR procedure.

4. A method according to an embodiment of the present invention has extendibility. A method according to the present invention involves analyzing content of a specific DNA in a DNA specimen from a subject by methylation specific multiplexed QPCR. For example, when multiple methylation markers (on different chromosomes) are used in the present invention, the variation in copy number of a specific DNA (for example, T21) of some chromosomes in the DNA specimen of a subject can be detected while the content of a specific DNA in the DNA specimen from the subject is being analyzed. It should be noted that the term “methylation marker” as used herein refers to a nucleic acid fragment that significantly differs in methylation level in nucleic acids from different sources. At least a portion of the gene RASSF1A, SERPINB5, C21orf63, OLIG2, CBR1, SIM2, DSCAM, TRPM2, C21orf29, COL18A1, AIRE, ERG, CD48, FAIM3, ARHGAP25, BMP3, VIM, NDRG4, TFPI2, SFRP2, SEPT9 or SELPLG mentioned above, or nucleic acid fragments in the table below can be used as a “methylation marker”.


Gene
Nucleic acid sequence
RASSF1A
chr3: 50378097-50378226
AIRE
chr21: 45703903-45704111
SIM2
chr21: 38078780-38079213
ERG
chr21: 39878777-39879107
CD48
chr1: 160681560-160681732
FAIM3
chr1: 207096473-207096654
ARHGAP25
chr2: 69001823-69002052
SELPLG
chr12: 109028663-109028901
BMP3
chr4: 81951942-81952808
VIM
chr10: 17270431-17272617
NDRG4
chr16: 58497034-58498595
TFPI2
chr7: 93519367-93520184
SFRP2
chr4: 154709513-154710827
SEPT9
chr17: 75368689-75370506

Additional aspects and advantages of the present invention will be partly given in, and partly apparent from, the description below, or understood through the practice of the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS

The above and/or other additional aspects and advantages of the present invention become apparent and comprehensible from the description of embodiments in connection with the accompanying drawings, in which:

FIG. 1 is a schematic flow chart of a method for analyzing a total nucleic acid mixture according to an embodiment of the present invention.

DETAILED DESCRIPTION

Embodiments of the present invention will be exemplarily described in detail hereinafter with reference to accompanying drawings in which the same or like reference characters refer to the same or like elements or elements having the same or like functions throughout. The embodiments described below with reference to accompanying drawings are exemplary, and intended to explain, rather than limit the present invention.

The terms “first” and “second” are used herein for purposes of description, and are not intended to indicate or imply relative importance or implicitly point out the number of the indicated technical feature. Therefore, the features defined by “first”, and “second” may explicitly or implicitly include one or more features. In the description of the present invention, “plural” means two or more, unless it is defined otherwise specifically.

Referring to FIG. 1, a method for analyzing a nucleic acid mixture according to the present invention is described in detail.

As shown in FIG. 1, the present invention provides a method for determining the nucleic acid composition in a total nucleic acid mixture. The total nucleic acid mixture comprises a first nucleic acid and a second nucleic acid. Specifically, the method comprises the following steps.

S100: Bisulfite Treatment

In this step, the total nucleic acid mixture is treated with a bisulfite to convert non-methylated cytosine in the total nucleic acid mixture into uracil, and to obtain a converted total nucleic acid mixture. During the step, the target region/fragment in the total nucleic acid mixture can be captured in advance if needed, and then treated with a bisulfite.

According to an embodiment of the present invention, the type of the total nucleic acid mixture that can be treated and analyzed by a method according to the present invention is not particularly limited, as long as the nucleic acid molecules from various sources contained in the total nucleic acid mixture have different methylation levels, and particularly different methylation levels exist for the same sequence. For example, according to an embodiment of the present invention, the total nucleic acid mixture can be a mixture of fetal and maternal DNA, or a mixture of cancer cell and non-cancer cell DNA. Thus, the total nucleic acid mixture can be a maternal plasma DNA, or a tissue, plasma or fecal DNA from a tumor patient. Specifically, in an embodiment according to the present invention, the first nucleic acid is a fetal DNA, and the second nucleic acid is a maternal DNA. Optionally, the total nucleic acid mixture is a maternal plasma DNA. Accordingly, the fetal DNA concentration in the mixture of maternal and fetal DNA can be effectively determined. In some other embodiments of the present invention, the first nucleic acid is a cancer cell DNA, and the second nucleic acid is a non-cancer cell DNA. The total nucleic acid mixture is a tissue, plasma, or fecal DNA from a tumor patient. Therefore, the methylation level in cancer tissues of tumor patients can be assayed.

According to an embodiment of the present invention, the method for extracting the DNA mixture from relevant biological samples is not particularly limited. For example, the DNA mixture can be extracted by a conventional DNA extraction method such as a salting-out method, column chromatography, a magnetic bead method, and an SDS method. Among the methods, the magnetic bead method is preferred. Briefly, the magnetic bead method comprises the following steps. Naked DNA molecules are obtained after the blood, tissues or cells are treated with proteinase K in a cell lysis buffer. The DNA molecules are subjected to reversible affinity adsorption using specific magnetic beads. The proteins, lipids, and other impurities are removed by washing with a detergent. The DNA molecules are then eluted from the magnetic beads using an eluant.

After the total nucleic acid mixture is obtained, the obtained mixture can be directly treated with a bisulfite, or the target region/fragment from the total nucleic acid mixture can be captured in advance if needed, and then treated with a bisulfite. According to an embodiment of the present invention, the treatment of DNA with a bisulfite allows non-methylated cytosines to be converted into uracils by deamination, while cytosines protected with a methyl group remain unchanged, such that a methylated cytosine site can be discriminated from a non-methylated cytosine site. Therefore, the subsequent analysis of a region comprising a methylated site or a non-methylated site can be effectively carried out. According to an embodiment of the present invention, the bisulfite treatment can be accomplished by any know methods, provided that the non-methylated cytosine can be converted into uracil by deamination, while the cytosine protected with a methyl group remains unchanged.

S200: Multiplexed Quantitative PCR

After the nucleic acid mixture is converted by treatment with a bisulfite, the relative proportions of the methylated fragment and the non-methylated fragment in the converted total nucleic acid mixture are analyzed by multiplexed PCR. Specifically, the converted total nucleic acid mixture is subjected to multiplexed fluorescent quantitative PCR using a first set of amplification primers and a second set of amplification primers, to determine a ratio R of a methylated amplification product and a non-methylated amplification product of the predetermined nucleic acid fragment.

The term “predetermined nucleic acid fragment” as used herein is a nucleic acid fragment that differs in methylation levels between a first nucleic acid and a second nucleic acid. According to an embodiment of the present invention, the first set of amplification primers specifically recognizes the converted predetermined nucleic acid fragment, and the second set of amplification primers specifically recognizes the unconverted predetermined nucleic acid fragment.

In an embodiment according to the present invention, the predetermined nucleic acid fragment includes one or more nucleic acid molecules located on different chromosomes.

In an embodiment according to the present invention, the predetermined nucleic acid fragment includes one or more nucleic acid fragments located on different genes. According to an embodiment of the present invention, the predetermined nucleic acid fragment can be selected from at least a portion of a gene of RASSF1A, SERPINB5, C21orf63, OLIG2, CBR1, SIM2, DSCAM, TRPM2, C21orf29, COL18A1, AIRE, ERG, CD48, FAIM3, ARHGAP25, BMP3, VIM, NDRG4, TFPI2, SFRP2, SEPT9, or SELPLG. Accordingly, the fetal DNA concentration in a mixture of maternal and fetal DNA, or the concentration of the cancer cell DNA in a mixture of cancer cell and non-cancer cell DNA derived from a tumor tissue can be effectively determined. According to an embodiment of the present invention, for various genes, the predetermined nucleic acid fragment includes at least one selected from the nucleic acid sequences shown below:


Gene
Nucleic acid sequence
RASSF1A
chr3: 50378097-50378226
AIRE
chr21: 45703903-45704111
SIM2
chr21: 38078780-38079213
ERG
chr21: 39878777-39879107
CD48
chr1: 160681560-160681732
FAIM3
chr1: 207096473-207096654
ARHGAP25
chr2: 69001823-69002052
SELPLG
chr12: 109028663-109028901
BMP3
chr4: 81951942-81952808
VIM
chr10: 17270431-17272617
NDRG4
chr16: 58497034-58498595
TFPI2
chr7: 93519367-93520184
SFRP2
chr4: 154709513-154710827
SEPT9
chr17: 75368689-75370506

It should be understood by those of skill in the art that the nucleic acid sequences in the table above are described by the positions of the sequences on each chromosome of the genome. For example, the nucleic acid sequence chr3:50378097-50378226 of the RASSF1A gene refers to the nucleic acid sequence from positions 50378097 to 50378226 on chr3 of the human genome, that is, the nucleic acid sequence: accagctgccgtgtggggttgcacgcggtgccccgcgcgatgcgcagegcgttggcacgctccagccgggtgeggccettccc agcgcgcccagcgggtgccagctcccgcagctcaatgagctcaggct (SEQ ID NO: 1).

The term “multiplexed fluorescent quantitative PCR” as used herein can be referred to as methylation specific multiplexed QPCR, which is an experimental method by which a methylated and a non-methylated DNA fragment from a methylation marker can be amplified, and fluorescently quantified. During QPCR, the principle underlying the real-time fluorescent quantification is a probe method, in which the probe is an oligonucleotide probe that is tagged with a fluorescent reporter and a fluorescent quencher at the two ends, respectively. During PCR amplification, one specific fluorescent probe is added at the same time that a pair of primers is added. When the probe is intact, the florescent signal emitted from the reporter is absorbed by the quencher. During PCR amplification, the probe is enzymatically cleaved by the 5′-3′ exonuclease activity of the Taq enzyme, such that the florescent reporter disassociates from the florescent quencher, whereby a florescence detection system can detect a fluorescent signal. During PCR amplification, a fluorescent molecule is formed for each DNA chain that is amplified, and thus the intensity of the fluorescent signal is proportional to the number of DNA molecules binding to the probe. As described above, in the multiplexed QPCR according to the present invention, the two sets of primers are designed such that the methylated and non-methylated DNA fragments in the methylation marker are both amplified, and the two kinds of DNA are quantified relatively using the methylation probe that specifically binds to the methylated fragment, and the non-methylation probe that specifically binds to the non-methylated fragment. Therefore, in an embodiment according to the present invention, a methylation specific probe and a non-methylation specific probe are further used in the multiplexed fluorescent quantitative PCR to thereby further improve the efficiency of the fluorescent quantitative PCR. In an embodiment according to the present invention, a methylation specific probe and a non-methylation specific probe each bear a marker selected from at least one of FAM, JOE, and TAMRA to thereby further improve the efficiency of the fluorescent quantitative PCR. In an embodiment according to the present invention, the methylation specific probe has a sequence as shown in SEQ ID NO: 6, and the non-methylation specific probe has a sequence as shown in SEQ ID NO: 9 to thereby further improve the efficiency of the fluorescent quantitative PCR. In an embodiment according to the present invention, the methylation specific probe is marked with FAM and TAMRA to thereby further improve the efficiency of the fluorescent quantitative PCR. In an embodiment according to the present invention, the non-methylation specific probe is marked with JOE and TAMRA to thereby further improve the efficiency of the fluorescent quantitative PCR.

In an embodiment according to the present invention, for the RASSF1A gene, the first set of amplification primers preferably includes nucleic acid molecules as shown in SEQ ID NOs: 7 and 8. For the RASSF1A gene, the second set of amplification primers preferably includes nucleic acid molecules as shown in SEQ ID NOs: 4 and 5. Accordingly, the fetal DNA concentration in the mixture of maternal and fetal DNA can be effectively determined.

The analysis of the relative contents of different fragments using multiplexed quantitative PCR can be carried out by any known methods. For example, the method and the relative standard curve method may be used. In the present invention, preferably 2−ΔΔct method is preferably used to calculate the ratio of the methylated fragment to the non-methylated fragment, which is then calibrated by a standard curve.

According to an embodiment of the present invention, the preceding two steps can be conducted in parallel or in advance for particular nucleic acids, for example, the first nucleic acid and the second nucleic acid, to predetermine a methylation proportion M1 of the predetermined nucleic acid fragment in the first nucleic acid, and a methylation proportion M2 of the predetermined nucleic acid fragment in the second nucleic acid.

S300: Analysis of Composition of Nucleic Acid Molecules

The number of the methylated fragment and non-methylated fragment correlates with the composition ratio of nucleic acid molecules from different sources. After determining the methylation proportion M1 of a predetermined nucleic acid fragment in the first nucleic acid and the methylation proportion M2 of the predetermined nucleic acid fragment in the second nucleic acid, and determining the ratio R of the methylated amplification product to the non-methylated amplification product of the predetermined nucleic acid fragment by multiplexed fluorescent quantitative PCR, the composition of the nucleic acid molecules, for example, the content of the first nucleic acid or the second nucleic acid, can be effectively determined through data analysis.

According to an embodiment of the present invention, the content E of the first nucleic acid in the total nucleic acid mixture is determined in this step according to the formula ε=(M2+RM2−R)/[R(M2−M1)−(M1−M2)] to thereby effectively determine the composition and content of nucleic acid molecules in the total nucleic acid mixture.

In an embodiment according to the present invention, a predetermined nucleic acid fragment that differs significantly in methylation level in the first nucleic acid and the second nucleic acid can be used. For example, M1 is at least 10×, preferably at least 50×, more preferably at least 90×, and most preferably at least 100× the value of M2 to thereby further improve the efficiency with which the composition and content of the nucleic acid molecules are determined since the value of M2 is small and can be ignored without influencing the final result. Accordingly, in an embodiment according to the present invention, the content 8 of the first nucleic acid in the total nucleic acid mixture can be determined according to the formula ε=R/[M1R+M1] in this step to thereby further simplify the method for determining the composition and content of nucleic acid molecules in the total nucleic acid mixture, and further improve the efficiency with which the composition and content of the nucleic acid molecules in the total nucleic acid mixture are determined.

Hereinafter, the embodiments of the present invention are described in detail by way of examples. However, it should be understood by those skilled in the art that the following examples are for illustrative purposes and not intended to limit the scope of the invention in any way. Where no specific conditions are given in the examples, conventional conditions or conditions recommended by the manufacturer are followed. The reagents or instruments for which no manufacturers are noted are all common products commercially available.

Example 1: Sequencing of Fetal methylation Marker

First, it should be noted that the fetal methylation marker is one or more differentially methylated genomic regions, the methylation levels of which differ significantly in fetal DNA and maternal DNA, and only slightly among populations.

In this example, 9 samples of placental DNA and paired maternal leukocyte DNA specimens were selected and used for determining the methylation level of a candidate fetal methylation marker, i.e. a region (chr3:50378097-50378226, SEQ ID NO: 1) of the RASSF1A gene, and the individual differences were evaluated. The specific method was as follows.

Bisulfite sequencing PCR (BSP) was used to determine the methylation level of the candidate marker. Specifically, the BSP primer sequences were forward primer GTTGTTTTTTGGTTGTTTTTTT (SEQ ID NO: 2); and reverse primer CCTACACCCAAATTTCCATTAC (SEQ ID NO: 3). TA cloning and sequencing were then employed to determine the methylation level of the BSP product. Specifically, 30 clones were selected from each specimen for Sanger 3730 sequencing. The methylation level of the candidate marker in the placental DNA and the maternal leukocyte DNA was then calculated, according to m=number of methylated cytosine (mC)/total number of cytosine (C). The experimental results are shown in Table 1 below, in which m1 denotes the methylation level of the candidate marker in the placental DNA; and m2 denotes the methylation level of the candidate marker in the maternal leukocyte DNA.


TABLE 1
Methylation level of the candidate marker
Sample
m1
m2
1
82.60%
0.90%
2
87.50%
0.20%
3
92.80%
0.40%
4
92.90%
0.20%
5
91.60%
0.00%
6
95.20%
0.40%
7
94.40%
0.80%
8
93.50%
0.20%
9
84.80%
0.20%
Average
90.59%
0.37%

Example 2: Quantification of Fetal DNA Concentration

DNA of 6 maternal plasma specimens was extracted using a QIAamp DNA Mini Kit, and the fetal DNA concentration was determined based on the values of m1 and m2 determined in Example 1. The specific steps were as follows.

(1) Bisulfite Treatment

The plasma DNA specimens from the subjects were treated with a bisulfate using the EZ DNA Methylation-Direct™ Kit.

(2) Design of methylation Specific Primers

Two pairs of primers were designed for the marker mentioned in Example 1 and were used in multiplexed QPCR, which included a pair of methylation specific primers and a pair of non-methylation specific primers for specifically amplifying the methylated and non-methylated DNA fragment, respectively. The primer and probe sequences are shown in Table 2 below.


TABLE 2 
Primer and probe sequence
Type of primer or probe
Sequence
Methylation specific
GATTAGTTGTCGTGTGGGGTTGTAC
primer-forward
(SEQ ID NO: 4)
Methylation specific
ATCGAAAAAACCTAAACTCATTAAA
primer-reverse
CTACG (SEQ ID NO: 5)
Methylation specific 
TGGTACGTTTTAGTCGGGTGCGGTT
site
(SEQ ID NO: 6)
Non-methylation specific
GGATTAGTTGTTGTGTGGGGTTGTA
primer-forward
T (SEQ ID NO: 7)
Non-methylation specific
AAAAAAACCTAAACTCATTAAACTA
primer-reverse
CAAA (SEQ ID NO: 8)
Non-methylation specific
TGGTGTTTTGTGTGATGTGTAGTGT
site
GTTGG (SEQ ID NO: 9)

(3) Methylation Specific Multiplexed QPCR

The Sigma JumpStart™ Taq DNA Polymerase was used for multiplexed QPCR, in which the QPCR quantification was carried out using a probe method, the probe used in the methylation specific PCR was marked with FAM and TAMRA, and the probe used in the non-methylation specific PCR was marked with JOE and TAMRA. Specifically, the QPCR system was as follows.


Reagent
Volume (μL)
10X PCR buffer (containing 15 mM MgCl2)
2.5
*MgSO4 (50 mM)
1
dNTP (2.5 mM)
3
Methylation specific probe (10 μM)
0.625
Non-methylation specific probe (10 μM)
0.625
ROX reference dye
0.5
Mixture of methylation specific primers
2
(both were 10 μM)
Mixture of non-methylation specific primers
2
(both were 10 μM)
JumpStart Polymerase (2.5 U/μL)
1
Template
11.75
In total
25
Note:
*indicates that the component may be added or not

The PCR protocol was as follows.


Temperature
Time
Cycle
Remark
94° C
  1 min
1
Initiation of denaturization
94° C.
30 s
45
Denaturization
60° C.
30 s
Anneal
72° C.
30 s
Extension
72° C.
10 min
1
Final derivation
 4° C.
Forever
1
Retention

(4) Quantification of Fetal DNA Concentration

The ratio of the methylated amplification product to the non-methylated amplification product was calculated by using the 2−ΔΔCt method and then calibrated by a standard curve. The calibrated ratio (represented by R in the formula) was used in the calculation of fetal DNA content in the maternal plasma specimen, where N is defined as the total number of DNA molecules in the parental plasma sample; 8 is the fetal DNA content; m1 is the methylation level of the fetal DNA, and m1=90.59%; and m2 is the methylation level of the maternal leukocyte DNA, and m2=0.37%. R and 8 are then calculated as follows.

R=NumberofmethylatedofDNANumberofnon-methylatedDNA=Nɛm1+N(1-ɛ)m2Nɛ(1-m1)+N(1-ɛ)(1-m2),andɛ=m2+Rm2-R[R(m2-m1)-(m1-m2)].(Formula1)

Because m2≈0, ε may be simply calculated as

ɛ=Rm1+Rm1.(Formula2)

The calculation results are shown in Table 3 below.


TABLE 3
Fetal DNA concentration in maternal plasma specimen
Estimated fetal
Estimated fetal
concentration
concentration
Sample ID
(by using Formula 1)
(by using Formula 2)
1
0.1554
0.1557
2
0.1917
0.1918
3
0.1325
0.1328
4
0.1230
0.1231
5
0.1299
0.1300
6
0.0663
0.0667

Therefore, the fetal DNA concentration in the maternal plasma specimen can be effectively quantified using the method according to the present invention. In addition, the obtained quantification results of the fetal DNA concentration in the parental plasma specimen may be further used to detect abnormalities in the number chromosomes. When the fetal DNA concentration calculated using the methylation difference between the RASSF1A gene on the maternal and fetal chr3 is used to detected an abnormality in the number of chr3, εchr3 of the test and normal control specimens is calculated, and the test specimen is determined to contain a fetal chr3 trisomy if the εchr3 of the test specimen is about 1.5. Similarly, the test specimen is determined to contain a fetal chr3 tetrasomy if the εchr3 of the test specimen is about 2.

Similarly, using the detection of an abnormality in the number of chr21 as an example, a marker (e.g. AIRE, SIM2, ERG and so on) on chr21 is selected and the fetal DNA concentration in the test and normal control samples is quantified using the method above to calculate the εchr21 of the test and normal control samples. The test specimen is determined to contain a fetal chr21 trisomy if the εchr21 of the test specimen is about 1.5. Similarly, the test specimen is determined to contain a fetal chr21 tetrasomy if the εchr21 of the test specimen is about 2. It should be noted that the term “about” as used herein is within ±10%.

Example 3

The cancer cell DNA concentration in a plasma DNA specimen from a patient with colorectal cancer was determined by the method according to the present invention following the steps below. The specific steps were as follows.

(1) Sequencing of predetermined nucleic acid fragment: A colorectal cancer cell DNA and a normal cell DNA specimen were used. For a predetermined nucleic acid fragment from the methylation genes SEPT9, NDRG4, and TFPI2 specific for colorectal cancer, a BSP product was obtained by bisulfite sequencing PCR (BSP), and then the methylation level of the BSP product was determined by TA cloning and sequencing. Specifically, 30 clones were selected from each specimen for Sanger 3730 sequencing. The methylation level of the predetermined nucleic acid fragment in the colorectal cancer cell DNA and normal cell DNA was then calculated, according to m=number of methylated cytosine (mC)/total number of cytosine (C) or m=number of methylated clones/total number of clones. m1 is the methylation level in the cancer cell DNA and m2 is the methylation level in the normal cell DNA.

(2) Specimen extraction: A plasma DNA sample was extracted from a patient with colorectal cancer using the QIAamp DNA Mini Kit.

(3) Bisulfite treatment: The plasma DNA specimen from the subject was treated with a bisulfite by using the EZ DNA Methylation-Direct™ Kit.

(4) Design of methylation specific primers: For each of the 3 methylation genes SEPT9, NDRG4, and TFPI2 specific for colorectal cancer, two pairs of primers were designed and used in multiplexed QPCR, which included a pair of methylation specific primers and a pair of non-methylation specific primers for specifically amplifying the methylated and non-methylated DNA fragment, respectively. The primer and probe sequences corresponding to the 3 genes are shown in Table 4 below.


TABLE 4 
Primer and probe sequences
Type of primer or
probe
ID
Sequence
Methylation specific
SEPT9-M-F
TATTAGTTATTATGTCGGA
primer-forward
TTTCGC 
(SEQ ID NO: 10)
Methylation specific
SEPT9-M-R
GCCTAAATTAAAAATCCCG
primer-reverse
TC
(SEQ ID NO: 11)
Methylation specific
M-SEPT9-
TGGAGAGGATTTTGCGGGT
site
Probe
GGGTTT
(SEQ ID NO: 12)
Non-methylation
SEPT9-U-F
ATTAGTTATTATGTTGGAT
specific
TTTGTGG
primer-forward
(SEQ ID NO: 13)
Non-methylation
SEPT9-U-R
AAAACACCTAAATTAAAAA
specific
TCCCATC
primer-reverse
(SEQ ID NO: 14)
Non-methylation
U-SEPT9-
TGTGGTTGTGGATGTGTTG
specific site
Probe
GAGAGG
(SEQ ID NO: 15)
Methylation specific
NDRG4-M-F
TTTAGGTTCGGTATCGTTT
primer-forward
CGCG 
(SEQ ID NO: 16)
Methylation specific
NDRG4-M-R
CGAACTAAAAACGATACGC
primer-reverse
CG
(SEQ ID NO: 17)
Methylation specific
M-NDRG4-
TCGAGCGTTTATATTCGTT
site
Probe
AAATTTACGCGGGTA 
(SEQ ID NO: 18)
Non-methylation
NDRG4-U-F
GATTAGTTTTAGGTTTGGT
specific
ATTGTTTTGT
primer-forward
(SEQ ID NO: 19)
Non-methylation
NDRG4-U-R
AAAACCAAACTAAAAACAA
specific
TACACCA
primer-reverse
(SEQ ID NO: 20)
Non-methylation
U-NDRG4-
TTGAGTGTTTATATTTGTT
specific site
Probe
AAATTTATGTGGGTATGTT
TTTG 
(SEQ ID NO: 21)
Methylation specific
TFPI2-M-F
TCGTTGGGTAAGGCGTTC
primer-forward
(SEQ ID NO: 22)
Methylation specific
TFPI2-M-R
AAACGAACACCCGAACCG
primer-reverse
(SEQ ID NO: 23)
Methylation specific
M-TFPI2-
AAAGCGTTTGGCGGGAGGA
site
Probe
GGT 
(SEQ ID NO: 24)
Non-methylation
TFPI2-U-F
TGGTTTGTTGGGTAAGGTG
specific
TTT
primer-forward
(SEQ ID NO: 25)
Non-methylation
TFPI2-U-R
ATAAACAAACACCCAAACC
specific
ACC
primer-reverse
(SEQ ID NO: 26)
Non-methylation
U-TFPI2-
AAGTGTTTGGTGGGAGGAG
specific site
Probe
GTGTGTGGT 
(SEQ ID NO: 27)

(5) Methylation specific multiplexed QPCR: The Sigma JumpStart™ Taq DNA Polymerase was used for multiplexed QPCR, in which the QPCR quantification was carried out using a probe method, the probe used in methylation specific PCR was marked with FAM and TAMRA, and the probe used in non-Methylation specific PCR was marked with JOE and TAMRA.

(6) Quantification of cancer cell DNA concentration: The ratio of the methylated amplification product to the non-methylated amplification product was calculated using the 2−ΔΔCt method and then calibrated by a standard curve. The calibrated ratio (represented by R in the formula) was used to calculate the cancer cell DNA content in the cancer cell specimen, where N is defined as the total number of DNA molecules in the specimen; c is the cancer cell DNA content; m1 is the methylation level of the cancer cell DNA, and approaches 1, and m2 is the methylation level of non-cancer cell DNA in the specimen, and is about 0.

Further

R=NumberofmethylatedofDNANumberofnon-methylatedDNA=Nɛm1+N(1-ɛ)m2Nɛ(1-m1)+N(1-ɛ)(1-m2),andɛ=m2+Rm2-R[R(m2-m1)-(m1-m2)].(Formula1)

can be used to quantify the cancer cell DNA content in the cancer cell specimen. Because m2≈0, ε may be simply calculated as

ɛ=Rm1+Rm1.(Formula2)

Consequently, the cancer cell DNA content in the plasma DNA specimen from a patient with colorectal cancer is calculated.

INDUSTRIAL APPLICABILITY

Using the method for determining the nucleic acid composition in a total nucleic acid mixture according to the present invention, the fetal DNA concentration in the maternal and fetal DNA mixture or the cancer cell DNA concentration in the tumor tissue of a tumor patient can be effectively determined with a high degree of accuracy and reliable reproducibility. Moreover, the method can be used to analyze multiple specimens at the same time.

Although specific embodiments of the present invention are described in detail above, it should be understood by those skilled in the art that various modifications and replacements may be made to the details based on the teachings disclosed herein, which all fall within the scope of the present invention defined by the appended claims and equivalents thereof.

In the description of the specification, the description with reference to the terms “an embodiment”, “some embodiments”, “exemplary embodiments”, “example”, “specific example”, or “some example”, and so on, means that specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In the present specification, the illustrative expression of the above terms is not necessarily referring to the same embodiment or example. Moreover, the described specific features, structures, materials or characteristics can be combined in any suitable manner in one or more embodiments.

<160> NUMBER OF SEQ ID NOS: 27

<210> SEQ ID NO: 1

<211> LENGTH: 130

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<220> FEATURE:

<400> SEQENCE: 1

accagctgcc gtgtggggtt gcacgcggtg ccccgcgcga tgcgcagcgc gttggcacgc 60

tccagccggg tgcggccctt cccagcgcgc ccagcgggtg ccagctcccg cagctcaatg 120

agctcaggct 130

<210> SEQ ID NO: 2

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 2

gttgtttttt ggttgttttt tt 22

<210> SEQ ID NO: 3

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 3

cctacaccca aatttccatt ac 22

<210> SEQ ID NO: 4

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 4

gattagttgt cgtgtggggt tgtac 25

<210> SEQ ID NO: 5

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 5

atcgaaaaaa cctaaactca ttaaactacg 30

<210> SEQ ID NO: 6

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Methylation specific site

<400> SEQENCE: 6

tggtacgttt tagtcgggtg cggtt 25

<210> SEQ ID NO: 7

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 7

ggattagttg ttgtgtgggg ttgtat 26

<210> SEQ ID NO: 8

<211> LENGTH: 29

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 8

aaaaaaacct aaactcatta aactacaaa 29

<210> SEQ ID NO: 9

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Non-methylation specific site

<400> SEQENCE: 9

tggtgttttg tgtgatgtgt agtgtgttgg 30

<210> SEQ ID NO: 10

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 10

tattagttat tatgtcggat ttcgc 25

<210> SEQ ID NO: 11

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 11

gcctaaatta aaaatcccgt c 21

<210> SEQ ID NO: 12

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Methylation specific site

<400> SEQENCE: 12

tggagaggat tttgcgggtg ggttt 25

<210> SEQ ID NO: 13

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 13

attagttatt atgttggatt ttgtgg 26

<210> SEQ ID NO: 14

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 14

aaaacaccta aattaaaaat cccatc 26

<210> SEQ ID NO: 15

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Non-methylation specific site

<400> SEQENCE: 15

tgtggttgtg gatgtgttgg agagg 25

<210> SEQ ID NO: 16

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 16

tttaggttcg gtatcgtttc gcg 23

<210> SEQ ID NO: 17

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 17

cgaactaaaa acgatacgcc g 21

<210> SEQ ID NO: 18

<211> LENGTH: 34

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Methylation specific site

<400> SEQENCE: 18

tcgagcgttt atattcgtta aatttacgcg ggta 34

<210> SEQ ID NO: 19

<211> LENGTH: 29

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 19

gattagtttt aggtttggta ttgttttgt 29

<210> SEQ ID NO: 20

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 20

aaaaccaaac taaaaacaat acacca 26

<210> SEQ ID NO: 21

<211> LENGTH: 42

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Non-methylation specific site

<400> SEQENCE: 21

ttgagtgttt atatttgtta aatttatgtg ggtatgtttt tg 42

<210> SEQ ID NO: 22

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 22

tcgttgggta aggcgttc 18

<210> SEQ ID NO: 23

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 23

aaacgaacac ccgaaccg 18

<210> SEQ ID NO: 24

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Methylation specific site

<400> SEQENCE: 24

aaagcgtttg gcgggaggag gt 22

<210> SEQ ID NO: 25

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 25

tggtttgttg ggtaaggtgt tt 22

<210> SEQ ID NO: 26

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Primer

<400> SEQENCE: 26

ataaacaaac acccaaacca cc 22

<210> SEQ ID NO: 27

<211> LENGTH: 28

<212> TYPE: DNA

<213> ORGANISM: Artificial

<220> FEATURE:

<223> OTHER INFORMATION: Non-methylation specific site

<400> SEQENCE: 27

aagtgtttgg tgggaggagg tgtgtggt 28

Read more
PatSnap Solutions

Great research starts with great data.

Use the most comprehensive innovation intelligence platform to maximise ROI on research.

Learn More

Patent Valuation

$

Reveal the value <>

20.0/100 Score

Market Attractiveness

It shows from an IP point of view how many competitors are active and innovations are made in the different technical fields of the company. On a company level, the market attractiveness is often also an indicator of how diversified a company is. Here we look into the commercial relevance of the market.

67.0/100 Score

Market Coverage

It shows the sizes of the market that is covered with the IP and in how many countries the IP guarantees protection. It reflects a market size that is potentially addressable with the invented technology/formulation with a legal protection which also includes a freedom to operate. Here we look into the size of the impacted market.

69.54/100 Score

Technology Quality

It shows the degree of innovation that can be derived from a company’s IP. Here we look into ease of detection, ability to design around and significance of the patented feature to the product/service.

42.0/100 Score

Assignee Score

It takes the R&D behavior of the company itself into account that results in IP. During the invention phase, larger companies are considered to assign a higher R&D budget on a certain technology field, these companies have a better influence on their market, on what is marketable and what might lead to a standard.

17.0/100 Score

Legal Score

It shows the legal strength of IP in terms of its degree of protecting effect. Here we look into claim scope, claim breadth, claim quality, stability and priority.

Citation

Patents Cited in This Cited by
Title Current Assignee Application Date Publication Date
Quantitative multiplex methylation-specific PCR THE JOHNS HOPKINS UNIVERSITY 28 October 2004 27 October 2005
Methods for fetal DNA detection and allele quantitation GENZYME CORPORATION,LANDES, GREGORY, M.,MICHALOWSKY, LESLIE,MILLER, GLENN,WEBER, WILLIAM 17 January 2003 31 July 2003
Use of methylation status of mint loci and tumor-related genes as a marker for melanoma and breast cancer JOHN WAYNE CANCER INSTITUTE 24 December 2008 03 September 2009
尿液诊断膀胱癌的方法和试剂盒 上海市肿瘤研究所 23 September 2011 11 January 2012
See full citation <>

More like this

Title Current Assignee Application Date Publication Date
Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene GENOMICTREE, INC. 26 September 2012 16 May 2013
Composition and method for hot start nucleic acid amplification ROCHE DIAGNOSTICS GMBH 11 July 2002 17 October 2006
Method for analyzing DNA methylation KAGOSHIMA UNIVERSITY 21 April 2011 17 March 2015
Process for high-throughput DNA methylation analysis THE UNIVERSITY OF SOUTHERN CALIFORNIA 02 June 2009 04 December 2012
Detecting gene methylation for diagnosis of a proliferative disorder VERIDEX, LLC 14 September 2006 21 March 2007
Differential amplification of mutant nucleic acids by PCR in a mixture of nucleic acids INSTITUT PASTEUR 28 December 2006 24 September 2013
Biomarkers for head and neck cancer and methods of their use THE REGENTS OF THE UNIVERSITY OF COLORADO, A BODY CORPORATE 16 October 2015 21 April 2016
Methods for diagnosing bladder cancer NUCLEIX LTD. 05 July 2016 12 January 2017
Methods for using long ssdna polynucleotides as primers in PCR assays MAUTNER, MARTÍN EDUARDO 10 July 2017 18 January 2018
Chimeric oligonucleotides for ligation-enhanced nucleic acid detection, methods and compositions therefor APPLIED BIOSYSTEMS, LLC 26 April 2013 18 November 2014
Method and nucleic acids for the improved treatment of breast cancers EPIGENOMICS AG,ERASMUS UNIVERSITY MEDICAL CENTRE ROTTERDAM,MARTENS, JOHN, W., M.,FOEKENS, JOHN,SIEUWERTS, ANIETA, M. 17 October 2006 26 April 2007
DNA methylation in colorectal and breast cancer diagnostic methods CLINICAL GENOMICS PTY LTD,COMMONWEALTH SCIENTIFIC AND INDUSTRIAL RESEARCH ORGANISATION 24 August 2012 02 July 2014
Epigenetic methods and nucleic acids for the detection of lung cell proliferative disorders EPIGENOMICS AG,PLUM, ACHIM,RUJAN, TAMAS,MAIER, SABINE,LESCHE, RALF 30 September 2005 06 April 2006
Method for determining the methylation pattern of a polynucleic acid EPIGENOMICS AG 16 February 2006 26 April 2011
Methods and compositions for differentiating tissues or cell types using epigenetic markers EPIGENOMICS AG,LEWIN, JOERN,BERLIN, KURT,HILDMANN, THOMAS,OLEK, ALEXANDER 12 August 2004 16 June 2005
Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions CORNELL RESEARCH FOUNDATION, INC. 16 September 2005 30 September 2008
Determination of nucleic acid methylation AGENCY FOR SCIENCE, TECHNOLOGY AND RESEARCH 25 November 2016 01 June 2017
結腸直腸細胞増殖性疾患の分析のための方法および核酸 エピゲノミクス アーゲー 13 February 2003 23 June 2005
Markers for improved detection of breast cancer ONCOMETHYLOME SCIENCES, S.A.,THE JOHNS HOPKINS UNIVERSITY,HERMAN, JAMES,AHUJA, NITA,SCHEUBEL, KORNEL, E. 02 March 2009 03 September 2009
Use of PITX2 nucleic acids for the improved treatment of breast cell proliferative disorders EPIGENOMICS AG 01 October 2003 25 December 2013
See all similar patents <>

More Patents & Intellectual Property

PatSnap Solutions

PatSnap solutions are used by R&D teams, legal and IP professionals, those in business intelligence and strategic planning roles and by research staff at academic institutions globally.

PatSnap Solutions
Search & Analyze
The widest range of IP search tools makes getting the right answers and asking the right questions easier than ever. One click analysis extracts meaningful information on competitors and technology trends from IP data.
Business Intelligence
Gain powerful insights into future technology changes, market shifts and competitor strategies.
Workflow
Manage IP-related processes across multiple teams and departments with integrated collaboration and workflow tools.
Contact Sales
Clsoe
US10017824 Method determining nucleic acid 1 US10017824 Method determining nucleic acid 2 US10017824 Method determining nucleic acid 3