Great research starts with great data.

Learn More
More >
Patent Analysis of

Detoxified Escherichia coli immunogens

Updated Time 12 June 2019

Patent Registration Data

Publication Number

US10058600

Application Number

US14/525033

Application Date

27 October 2014

Publication Date

28 August 2018

Current Assignee

GLAXOSMITHKLINE BIOLOGICALS SA

Original Assignee (Applicant)

NOVARTIS AG

International Classification

A61K39/00,A61K39/108,C07K14/245,C12N9/52

Cooperative Classification

A61K39/0258,C07K14/245,C12N9/52,C12Y304/24,A61K39/00

Inventor

SERINO, LAURA,FONTANA, MARIA RITA,GOMES MORIEL, DANILO

Patent Images

This patent contains figures and images illustrating the invention and its embodiment.

US10058600 Detoxified <i>Escherichia coli </i>immunogens 1 US10058600 Detoxified <i>Escherichia coli </i>immunogens 2 US10058600 Detoxified <i>Escherichia coli </i>immunogens 3
See all images <>

Abstract

Detoxified variants of the pathogenic E. coli ‘AcfD precursor’ (orf3526) have been identified that raise a substantially similar immune response in a subject as the native AcfD (orB526) protein. The detoxified variants may be further modified to have increased solubility as compared to the native AcfD (orf3526) protein.

Read more

Claims

1. An immunogenic polypeptide comprising a fragment or mutant of an E. coli AcfD (orf3526) protein, wherein the immunogenic polypeptide does not comprise at least the last 300 C-terminal amino acids of the E. coli AcfD (orf3526) protein, wherein the E. coli AcfD (orf3526) protein has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-19, wherein the immunogenic polypeptide raises at least 70% of the immune response in a subject as the E. coli AcfD (orf3526) protein and wherein the immunogenic polypeptide has a decreased protease activity as compared to the E. coli AcfD protein.

2. An immunogenic polypeptide comprising a fragment of an E. coli AcfD (orf3526) protein, wherein the immunogenic polypeptide does not comprise at least the last 400 C-terminal amino acids of the E. coli AcfD (orf3526) protein, wherein the E. coli AcfD (orf3526) protein has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-19, wherein the immunogenic polypeptide raises at least 70% of the immune response in a subject as the E. coli AcfD (orf3526) protein and wherein the immunogenic polypeptide has a decreased protease activity as compared to the E. coli AcfD protein.

3. The immunogenic polypeptide of claim 1, wherein the immunogenic polypeptide fragment is purified.

4. An immunogenic composition comprising the immunogenic polypeptide of claim 1 and an adjuvant.

5. A vaccine comprising the immunogenic polypeptide of claim 3 and an adjuvant.

6. A vaccine comprising the immunogenic polypeptide of claim 1 and an adjuvant.

7. The vaccine of claim 5, further comprising an additional vaccine component selected from: a Neisseria meningitidis antigen, a Streptococcus pneumoniae antigen, a Streptococcus pyogenes antigen, a Moraxella catarrhalis antigen, a Bordetella pertussis antigen, a Staphylococcus aureus antigen, a Staphylococcus epidermis antigen, a Clostridium tetani antigen, a Cornynebacterium diphtheriae antigen, a Haemophilus influenzae type B (Hib) antigen, a Pseudomonas aeruginosa antigen, a Legionella pneumophila antigen, a Streptococcus agalactiae antigen, a Neiserria gonorrhoeae antigen, a Chlamydia trachomatis antigen, a Treponema pallidum antigen, a Haemophilus ducreyi antigen, a Enterococcus faecalis antigen, a Enterococcus faecium antigen, a Helicobacter pylori antigen, a Staphylococcus saprophyticus antigen, a Yersinia enterocolitica antigen, an additional E. coli antigen, a Bacillus anthracis antigen, a Yersinia pestis antigen, a Mycobacterium tuberculosis antigen, a Rickettsia antigen, a Listeria monocytogenes antigen, a Chlamydia pneumoniae antigen, a Vibrio cholerae antigen, a Salmonella typhi antigen, a Borrelia burgdorferi antigen, a Porphyromonas gingivalis antigen, and a Klebsiella antigen.

8. The vaccine of claim 6, further comprising an additional vaccine component selected from: a Neisseria meningitidis antigen, a Streptococcus pneumoniae antigen, a Streptococcus pyogenes antigen, a Moraxella catarrhalis antigen, a Bordetella pertussis antigen, a Staphylococcus aureus antigen, a Staphylococcus epidermis antigen, a Clostridium tetani antigen, a Cornynebacterium diphtheriae antigen, a Haemophilus influenzae type B (Hib) antigen, a Pseudomonas aeruginosa antigen, a Legionella pneumophila antigen, a Streptococcus agalactiae antigen, a Neiserria gonorrhoeae antigen, a Chlamydia trachomatis antigen, a Treponema pallidum antigen, a Haemophilus ducreyi antigen, a Enterococcus faecalis antigen, a Enterococcus faecium antigen, a Helicobacter pylori antigen, a Staphylococcus saprophyticus antigen, a Yersinia enterocolitica antigen, an additional E. coli antigen, a Bacillus anthracis antigen, a Yersinia pestis antigen, a Mycobacterium tuberculosis antigen, a Rickettsia antigen, a Listeria monocytogenes antigen, a Chlamydia pneumoniae antigen, a Vibrio cholerae antigen, a Salmonella typhi antigen, a Borrelia burgdorferi antigen, a Porphyromonas gingivalis antigen, and a Klebsiella antigen.

Read more

Claim Tree

  • 1
    nogenic polypeptide comprisin a fragmen
    • or mutant of an E. coli AcfD (orf3526) protein, wherein the immunogenic polypeptide does not comprise at least the last 300 C-terminal amino acids of the E. coli AcfD (orf3526) protein, wherein the E. coli AcfD (orf3526) protein has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-19, wherein the immunogenic polypeptide raises at least 70% of the immune response in a subject as the E. coli AcfD (orf3526) protein and wherein the immunogenic polypeptide has a decreased protease activity as compared to the
    • se activity as compared to the E. coli /i>AcfD
      • protein. 3. The immunogenic polypeptide of claim
  • 2
    . coli AcfD protein. 2. A immunogen
    • c polypeptide comprising a fragment of an E. coli AcfD (orf3526) protein, wherein the immunogenic polypeptide does not comprise at least the last 400 C-terminal amino acids of the E. coli AcfD (orf3526) protein, wherein the E. coli AcfD (orf3526) protein has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-19, wherein the immunogenic polypeptide raises at least 70% of the immune response in a subject as the E. coli AcfD (orf3526) protein and wherein the immunogenic polypeptide has a decreased prote
  • 4
    , wherein the immunogenic pol peptide fr
    • gment is purified. 4. An immunogenic composition compri
  • 5
    ing the immu ogenic pol
    • peptide of claim 1 and an adjuvant. 5. A vaccine compri
    • ing the immunogenic polype tide of claim 1 an
      • an adjuvant. 7. The vaccine of claim 5, further comprising an additional vaccine component selected from: a Neisseria meningitidis antigen, a Streptococcus pneumoniae antigen, a Streptococcus pyogenes antigen, a Moraxella catarrhalis antigen, a Bordetella pertussis antigen, a Staphylococcus aureus antigen, a Staphylococcus epidermis antigen, a Clostridium tetani antigen, a Cornynebacterium diphtheriae antigen, a Haemophilus influenzae type B (Hib) antigen, a Pseudomonas aeruginosa antigen, a Legionella pneumophila antigen, a Streptococcus agalactiae antigen, a Neiserria gonorrhoeae antigen, a Chlamydia trachomatis antigen, a Treponema pallidum antigen, a Haemophilus ducreyi antigen, a Enterococcus faecalis antigen, a Enterococcus faecium antigen, a Helicobacter pylori antigen, a Staphylococcus saprophyticus antigen, a Yersinia enterocolitica antigen, an additional E. coli antigen, a Bacillus anthracis antigen, a Yersinia pestis antigen, a Mycobacterium tuberculosis ant
  • 6
    ing the immu ogenic pol
    • peptide of claim 3 and an adjuvant. 6. A vaccine compri
    • gen, a Rickettsia a tigen, a Lister
      • a monocytogenes antigen, a Chlamydia pneumoniae antigen, a Vibrio cholerae antigen, a Salmonella typhi antigen, a Borrelia burgdorferi antigen, a Porphyromonas gingivalis antigen, and a Klebsiella antigen. 8. The vaccine of claim 6, further comprising an additional vaccine component selected from: a Neisseria meningitidis antigen, a Streptococcus pneumoniae antigen, a Streptococcus pyogenes antigen, a Moraxella catarrhalis antigen, a Bordetella pertussis antigen, a Staphylococcus aureus antigen, a Staphylococcus epidermis antigen, a Clostridium tetani antigen, a Cornynebacterium diphtheriae antigen, a Haemophilus influenzae type B (Hib) antigen, a Pseudomonas aeruginosa antigen, a Legionella pneumophila antigen, a Streptococcus agalactiae antigen, a Neiserria gonorrhoeae antigen, a Chlamydia trachomatis antigen, a Treponema pallidum antigen, a Haemophilus ducreyi antigen, a Enterococcus faecalis antigen, a Enterococcus faecium antigen, a Helicobacter pylori antigen,
See all independent claims <>

Description

TECHNICAL FIELD

This invention relates to immunisation against pathogenic Escherichia coli strains.

SUBMISSION OF SEQUENCE LISTING ON ASCII TEXT FILE

The content of the following submission on ASCII text file is incorporated herein by reference in its entirety: a computer readable form (CRF) of the Sequence Listing (file name: 529552004201 SeqList.txt, date recorded: Oct. 13, 2014, size: 893 KB).

BACKGROUND

E. coli strains have traditionally been classified as either commensal or pathogenic, and pathogenic strains are then sub-classified as intestinal or extraintestinal strains. Pathogenic E. coli are discussed in more detail in reference 1, and fall into a number of different pathotypes i.e. a group of E. coli strains that cause a common disease using a common set of virulence factors. Pathotyping of strains is a routine technique that can be performed genotypically or phenotypically. One recent genotype-based pathotyping method [2] uses a DNA microarray.

Among intestinal strains at least six well-described pathotypes are known: enteropathogenic (EPEC), enterohaemorrhagic (EHEC), enteroaggregative (EAEC), enteroinvasive (EIEC), enterotoxigenic (ETEC) and diffusely adherent (DAEC).

The extraintestinal pathogenic strains (or ‘ExPEC’ strains [3,4]) of E. coli include uropathogenic (UPEC) strains, neonatal meningitis (NMEC) strains, and septicemia-associated strains (SEPEC). ExPEC is the most common cause of urinary tract infections and one of the leading causes of neonatal meningitis and neonatal sepsis in humans, which can lead to serious complications and death. Other types of extraintestinal infections include osteomyelitis, pulmonary, intra-abdominal, soft tissue, and intravascular device-associated infections. Another ExPEC pathotype outside humans is avian pathogenic (APEC), causing extraintestinal infections in poultry.

Most previous ExPEC vaccines have been based on cell lysates or on cellular structures. SOLCOUROVAC™ includes ten different heat-killed bacteria including six ExPEC strains. URO-VAXOM™ is an oral tablet vaccine containing lyophilised bacterial lysates of 18 selected E. coli strains. Baxter Vaccines developed a UTI vaccine based on pili from 6 to 10 different strains. Medlmmune developed a product called MEDI 516 based on the FimH adhesin complex. In contrast, references 5 and 6 disclose specific immunogens from ExPEC strains that can be used as the basis of defined vaccines against both NMEC and UPEC strains.

It is an object of the invention to provide further and better antigens for use in immunisation against pathogenic E. coli strains, and more particularly against intestinal pathotypes (e.g. EAEC, EIEC, EPEC and ETEC strains) as well as ExPEC pathotypes and in particular antigen that have been detoxified so as to enable their use as components for immunisation or that have been shortened without reducing the immune response raised to as to improve the expression and purification.

DISCLOSURE OF THE INVENTION

One of the many antigens disclosed in reference 5 is annotated as the accessory colonization factor D (“AcfD”) precursor (orf3526) (SEQ ID NOs: 7051 & 7052 therein; SEQ ID NO: 1 herein). Reference 5 discloses the sequence from NMEC strain IHE3034, and the present invention is based on variants of the ExPEC ‘AcfD precursor’ (orf3526) that have been identified in further pathotypes, including APEC, UPEC, EAEC, EIEC, EPEC and ETEC strains. Unlike the disclosure of reference 5, these variants can be particularly useful for treating intestinal pathotypes. Thus the invention provides such variants, together with their use in immunising patients against E. coli infections. In addition, this disclosure includes fragments and mutants of the AcfD (orf3526) protein of all E. coli pathotypes where the fragment has increased solubility as compared to the full length while raising a substantially similar immune response in a subject as that raised by the full length protein. Further, this disclosure includes fragments and mutants of the AcfD (orf3526) protein of all E. coli pathotypes where the fragment has decreased toxicity as compared to the full length protein while raising a substantially similar immune response in a subject as that raised by the full length protein. In addition, this disclosure includes fragments and mutants of the AcfD (orf3526) protein of all E. coli pathotypes where the fragment raises a substantially similar immune response in a subject as that raised by the full length protein while having improved characteristics with regard to purification when expressed in E. coli.

Polypeptides Used with the Invention

The invention provides an immunogenic polypeptide comprising an E. coli AcfD (orf3526) polypeptide comprising a mutation relative to the E. coli AcfD (orf3526) protein which decreases the toxicity of the immunogenic polypeptide as compared to the E. coli AcfD (orf3526) protein and wherein the immunogenic polypeptide raises a substantially similar immune response in a subject as the E. coli AcfD (orf3526) protein.

The E. coli AcfD (orf3526) protein may have an amino acid sequence selected from the group consisting of SEQ ID NOs:1-19.

Exemplary mutations that decrease the toxicity include a deletion of all or a portion of the zincin metalloprotease domain and a point mutation in zincin metalloprotease domain which reduces the protease activity. In certain cases, the point mutation is a mutation of a zinc binding residue or a mutation of a catalytic residue. A preferred point mutation is substitution of amino acid number 1305 based upon alignment with SEQ ID NO: 1.

Exemplary deletions include removal of at least the last 100 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 200 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 300 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 400 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 500 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 600 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 700 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 750 C-terminal amino acids of the E. coli AcfD (orf3526) protein, or at least the last 758 C-terminal amino acids of the E. coli AcfD (orf3526) protein or does not comprise at least the first 100 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 200 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 300 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 400 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 500 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 600 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 700 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 750 N-terminal amino acids of the E. coli AcfD (orf3526) protein, or at least the first 760 N-terminal amino acids of the E. coli AcfD (orf3526) protein.

The invention provides an immunogenic polypeptide comprising an E. coli AcfD (orf3526) polypeptide wherein the immunogenic polypeptide comprises an amino acid sequence that comprises:

    • (a) the amino acid sequence selected from the group consisting of SEQ ID NOs 20 to 76;
    • (b) at least a % sequence identity to any one of SEQ ID NOs: 20 to 76; or
    • (c) has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 (or more) single amino acid alterations (deletions, insertions, substitutions), which may be at separate locations or may be contiguous, as compared to the sequences of (a) or (b); and/or;
    • (d) when aligned with any of SEQ ID NOs: 20 to 76 using a pairwise alignment algorithm, each moving window of x amino acids from N-terminus to C-terminus (such that for an alignment that extends to p amino acids, where p>x, there are p−x+1 such windows) has at least x·y identical aligned amino acids, where: x is selected from 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200; y is selected from 0.50, 0.60, 0.70, 0.75, 0.80, 0.85, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99; and if x·y is not an integer then it is rounded up to the nearest integer,
    • wherein the immunogenic polypeptide comprises a mutation relative to the E. coli AcfD (orf3526) protein which decreases the toxicity of the immunogenic polypeptide as compared to the E. coli AcfD (orf3526) protein and wherein the immunogenic polypeptide raises a substantially similar immune response in a subject as the E. coli AcfD (orf3526) protein.

The preferred pairwise alignment algorithm is the Needleman-Wunsch global alignment algorithm [7], using default parameters (e.g. with Gap opening penalty=10.0, and with Gap extension penalty=0.5, using the EBLOSUM62 scoring matrix). This algorithm is conveniently implemented in the needle tool in the EMBOSS package [8].

These polypeptides include other detoxified variants of SEQ ID NOs 20 to 76, including allelic variants, polymorphic forms, homologs, orthologs, paralogs, mutants, etc.

The value of a may be selected from 50%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or more.

The foregoing immunogenic polypeptides may further contain a deletion relative to the E. coli AcfD (orf3526) protein which increases solubility of the immunogenic polypeptide as compared to the E. coli AcfD (orf3526) protein while the immunogenic polypeptide still raises a substantially similar immune response in a subject as the E. coli AcfD (orf3526) protein.

Exemplary deletions that increase the solubility include removal of substantially all of the N-terminal amino acids up to the gly-ser region, removal of all or a part of the N-terminal proline-rich repeat, or both. The immunogenic polypeptide of claim 8, wherein the deletion is removal of at least the first N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 20 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 30 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 38 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 40 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 50 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 60 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 70 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 80 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 90 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, or at least the first 94 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein.

The invention also provides an immunogenic polypeptide fragment of an E. coli AcfD (orf3526) polypeptide wherein the immunogenic polypeptide fragment comprises an amino acid sequence that comprises:

    • (a) the amino acid sequence selected from the group consisting of SEQ ID NOs 77 to 95;
    • (b) at least a % sequence identity to any one of SEQ ID NOs: 77 to 95; or
    • (c) has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 (or more) single amino acid alterations (deletions, insertions, substitutions), which may be at separate locations or may be contiguous, as compared to the sequences of (a) or (b); and/or;
    • (d) when aligned with any of SEQ ID NOs: 77 to 95 using a pairwise alignment algorithm, each moving window of x amino acids from N-terminus to C-terminus (such that for an alignment that extends to p amino acids, where p>x, there are p−x+1 such windows) has at least x·y identical aligned amino acids, where: x is selected from 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200; y is selected from 0.50, 0.60, 0.70, 0.75, 0.80, 0.85, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99; and if x·y is not an integer then it is rounded up to the nearest integer,
    • wherein the immunogenic polypeptide fragment has lower toxicity than the E. coli AcfD (orf3526) protein and wherein the immunogenic polypeptide fragment raises a substantially similar immune response in a subject as the E. coli AcfD (orf3526) protein.

The preferred pairwise alignment algorithm is the Needleman-Wunsch global alignment algorithm [7], using default parameters (e.g. with Gap opening penalty=10.0, and with Gap extension penalty=0.5, using the EBLOSUM62 scoring matrix). This algorithm is conveniently implemented in the needle tool in the EMBOSS package [8].

These polypeptides include other detoxified variants of SEQ ID NOs 77 to 95, including allelic variants, polymorphic forms, homologs, orthologs, paralogs, mutants, etc.

The value of a may be selected from 50%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or more.

The immunogenic polypeptide fragment in certain embodiments will not comprise at least the first 10 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 20 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 25 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 30 N-terminal amino acids of the E. coli AcfD (orf3526) protein, or at least the first 33 N-terminal amino acids of the E. coli AcfD (orf3526) protein.

The immunogenic polypeptide fragment in certain embodiments (which may be combined with the preceding embodiments) will not comprise at least the last 125 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 150 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 175 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 200 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 210 C-terminal amino acids of the E. coli AcfD (orf3526) protein, or at least the last 217 C-terminal amino acids of the E. coli AcfD (orf3526) protein.

The invention further provides an immunogenic polypeptide fragment comprising an E. coli AcfD (orf3526) polypeptide wherein the immunogenic polypeptide comprises an amino acid sequence that comprises:

    • (a) the amino acid sequence selected from the group consisting of SEQ ID NOs 20 to 76;
    • (b) at least a % sequence identity to any one of SEQ ID NOs: 20 to 76; or
    • (c) has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 (or more) single amino acid alterations (deletions, insertions, substitutions), which may be at separate locations or may be contiguous, as compared to the sequences of (a) or (b); and/or;
    • (d) when aligned with any of SEQ ID NOs: 20 to 76 using a pairwise alignment algorithm, each moving window of x amino acids from N-terminus to C-terminus (such that for an alignment that extends to p amino acids, where p>x, there are p−x+1 such windows) has at least x·y identical aligned amino acids, where: x is selected from 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200; y is selected from 0.50, 0.60, 0.70, 0.75, 0.80, 0.85, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99; and if x·y is not an integer then it is rounded up to the nearest integer,
    • wherein the immunogenic polypeptide fragment raises a substantially similar immune response in a subject as the E. coli AcfD (orf3526) protein.

The preferred pairwise alignment algorithm is the Needleman-Wunsch global alignment algorithm [7], using default parameters (e.g. with Gap opening penalty=10.0, and with Gap extension penalty=0.5, using the EBLOSUM62 scoring matrix). This algorithm is conveniently implemented in the needle tool in the EMBOSS package [8].

These polypeptides include other variants of SEQ ID NOs 20 to 76, including allelic variants, polymorphic forms, homologs, orthologs, paralogs, mutants, etc.

The value of a may be selected from 50%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or more.

Exemplary fragments will not comprise at least the last 100 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 200 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 300 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 400 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 500 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 600 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 700 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 750 C-terminal amino acids of the E. coli AcfD (orf3526) protein, or at least the last 758 C-terminal amino acids of the E. coli AcfD (orf3526) protein or does not comprise at least the first 100 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 200 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 300 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 400 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 500 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 600 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 700 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 750 N-terminal amino acids of the E. coli AcfD (orf3526) protein, or at least the first 760 N-terminal amino acids of the E. coli AcfD (orf3526) protein.

The foregoing immunogenic polypeptides may further contain a deletion relative to the E. coli AcfD (orf3526) protein which increases solubility of the immunogenic polypeptide as compared to the E. coli AcfD (orf3526) protein while the immunogenic polypeptide still raises a substantially similar immune response in a subject as the E. coli AcfD (orf3526) protein.

Exemplary deletions that increase the solubility include removal of substantially all of the N-terminal amino acids up to the gly-ser region, removal of all or a part of the N-terminal proline-rich repeat, or both. The immunogenic polypeptide of claim 8, wherein the deletion is removal of at least the first N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 20 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 30 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 38 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 40 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 50 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 60 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 70 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 80 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, at least the first 90 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein, or at least the first 94 N-terminal amino acids as compared to the E. coli AcfD (orf3526) protein.

The E. coli AcfD (orf3526) protein may have an amino acid sequence selected from the group consisting of SEQ ID NOs:1-19.

The invention also provides an immunogenic polypeptide fragment of an E. coli AcfD (orf3526) polypeptide wherein the immunogenic polypeptide fragment comprises an amino acid sequence that comprises:

    • (a) the amino acid sequence selected from the group consisting of SEQ ID NOs 77 to 95;
    • (b) at least a % sequence identity to any one of SEQ ID NOs: 77 to 95; or
    • (c) has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 (or more) single amino acid alterations (deletions, insertions, substitutions), which may be at separate locations or may be contiguous, as compared to the sequences of (a) or (b); and/or;
    • (d) when aligned with any of SEQ ID NOs: 77 to 95 using a pairwise alignment algorithm, each moving window of x amino acids from N-terminus to C-terminus (such that for an alignment that extends to p amino acids, where p>x, there are p−x+1 such windows) has at least x·y identical aligned amino acids, where: x is selected from 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200; y is selected from 0.50, 0.60, 0.70, 0.75, 0.80, 0.85, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99; and if x·y is not an integer then it is rounded up to the nearest integer,
    • wherein the immunogenic polypeptide fragment raises a substantially similar immune response in a subject as the E. coli AcfD (orf3526) protein.

The preferred pairwise alignment algorithm is the Needleman-Wunsch global alignment algorithm [7], using default parameters (e.g. with Gap opening penalty=10.0, and with Gap extension penalty=0.5, using the EBLOSUM62 scoring matrix). This algorithm is conveniently implemented in the needle tool in the EMBOSS package [8].

These polypeptides include other variants of SEQ ID NOs 77 to 95, including allelic variants, polymorphic forms, homologs, orthologs, paralogs, mutants, etc.

The value of a may be selected from 50%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or more.

The immunogenic polypeptide fragment in certain embodiments will not comprise at least the first 10 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 20 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 25 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 30 N-terminal amino acids of the E. coli AcfD (orf3526) protein, or at least the first 33 N-terminal amino acids of the E. coli AcfD (orf3526) protein.

The immunogenic polypeptide fragment in certain embodiments (which may be combined with the preceding embodiments) will not comprise at least the last 125 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 150 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 175 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 200 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 210 C-terminal amino acids of the E. coli AcfD (orf3526) protein, or at least the last 217 C-terminal amino acids of the E. coli AcfD (orf3526) protein.

The invention additionally provides an immunogenic composition that comprises an immunogenic polypeptide fragment of an E. coli AcfD (orf3526) polypeptide wherein the immunogenic polypeptide fragment comprises an amino acid sequence that comprises at least a % sequence identity to any one of SEQ ID NOs: 77 to 95, wherein the immunogenic polypeptide fragment raises a substantially similar immune response in a subject as the E. coli AcfD (orf3526) protein and wherein the immunogenic polypeptide fragment does not comprise at least the last 125 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 150 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 175 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 200 C-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the last 210 C-terminal amino acids of the E. coli AcfD (orf3526) protein, or at least the last 217 C-terminal amino acids of the E. coli AcfD (orf3526) protein.

The preferred pairwise alignment algorithm is the Needleman-Wunsch global alignment algorithm [7], using default parameters (e.g. with Gap opening penalty=10.0, and with Gap extension penalty=0.5, using the EBLOSUM62 scoring matrix). This algorithm is conveniently implemented in the needle tool in the EMBOSS package [8].

These polypeptides include other variants of SEQ ID NOs 77 to 95, including allelic variants, polymorphic forms, homologs, orthologs, paralogs, mutants, etc.

The value of a may be selected from 50%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or more.

The immunogenic polypeptide fragment of the immunogenic composition in certain embodiments will not comprise at least the first 10 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 20 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 25 N-terminal amino acids of the E. coli AcfD (orf3526) protein, at least the first 30 N-terminal amino acids of the E. coli AcfD (orf3526) protein, or at least the first 33 N-terminal amino acids of the E. coli AcfD (orf3526) protein.

The immunogenic composition may further comprise an adjuvant which may in certain embodiments comprise 1-12% by volume of a metabolizable oil, and 0.2% to 2.5% by weight of an emulsifying agent, wherein the metabolizable oil and the emulsifying agent are present in the form of an oil-in-water emulsion having oil droplets substantially all of which are less than 1 micron in diameter; 4-5% by volume of squalene, and (b) about 1% of an emulsifying agent comprising polyoxyethylenesorbitan monooleate and sorbitan trioleate, wherein the squalene and the emulsifying agent are present in the form of an oil-in-water emulsion having oil droplets substantially all of which are less than 1 micron in diameter; or MF59™.

The foregoing detoxified immunogenic polypeptides and immunogenic polypeptide fragments preferably retain at least one epitope or immunogenic fragment of SEQ ID NOs 1 to 19. An epitope within a fragment may be a B-cell epitope and/or a T-cell epitope. Such epitopes can be identified empirically (e.g. using PEPSCAN [9,10] or similar methods), or they can be predicted (e.g. using the Jameson-Wolf antigenic index [11], matrix-based approaches [12], MAPITOPE [13], TEPITOPE [14,15], neural networks [16], OptiMer & EpiMer [17, 18], ADEPT [19], Tsites [20], hydrophilicity [21], antigenic index [22] or the methods disclosed in references 23-27, etc.). Epitopes are the parts of an antigen that are recognised by and bind to the antigen binding sites of antibodies or T-cell receptors, and they may also be referred to as “antigenic determinants”.

The foregoing detoxified immunogenic polypeptides and immunogenic polypeptide fragments include, without limitation, immunogenic polypeptides that, when administered to a subject in a suitable composition which can include an adjuvant (including without limitation any of the adjuvants listed or discussed in the section “Immunogenic compositions and medicaments” below), or a suitable carrier coupled to the polypeptide, induces an antibody or T-cell mediated immune response that recognizes the isolated full length polypeptide SEQ ID NOs 1 to 19, respectively, from which the immunogenic polypeptide is derived.

The foregoing detoxified immunogenic polypeptides and immunogenic polypeptide fragments include, without limitation, immunogenic polypeptides that, when administered to a subject in a suitable composition which can include an adjuvant (including without limitation any of the adjuvants listed or discussed in the section “Immunogenic compositions and medicaments” below), or a suitable carrier coupled to the polypeptide, induces an antibody or T-cell mediated immune response that recognizes the isolated full length polypeptide SEQ ID NOs 1 to 19, respectively, from which the immunogenic fragment is derived.

The foregoing detoxified immunogenic polypeptides and immunogenic polypeptide fragments include, without limitation, immunogenic polypeptides that, when administered to a subject in a suitable composition which can include an adjuvant (including without limitation any of the adjuvants listed or discussed in the section “Immunogenic compositions and medicaments” below), or a suitable carrier coupled to the polypeptide, induces an antibody or T-cell mediated immune response that recognizes the isolated full length polypeptide SEQ ID NOs 1 to 19, respectively, from which the immunogenic fragment is derived.

A detoxified polypeptide of the invention may, compared to any one of SEQ ID NOs 1 to 19, include one or more (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, etc.) amino acid substitutions, such as conservative substitutions (i.e. substitutions of one amino acid with another which has a related side chain). Genetically-encoded amino acids are generally divided into four families: (1) acidic i.e. aspartate, glutamate; (2) basic i.e. lysine, arginine, histidine; (3) non-polar i.e. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar i.e. glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. In general, substitution of single amino acids within these families does not have a major effect on the biological activity.

A detoxified polypeptide may include one or more (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, etc.) single amino acid deletions relative to any one of SEQ ID NOs 1 to 19. Similarly, a polypeptides may include one or more (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, etc.) insertions (e.g. each of 1, 2, 3, 4 or 5 amino acids) relative to any one of SEQ ID NOs 1 to 19.

In general, when a detoxified polypeptide or immunogenic polypeptide fragment of the invention comprises a sequence that is not identical to a complete one of SEQ ID NOs 1 to 19 (e.g. when it comprises a sequence listing with <100% sequence identity thereto, or when it comprises a fragment thereof) it is preferred that the polypeptide can elicit an antibody that recognises a polypeptide consisting of the complete SEQ ID sequence i.e. the antibody binds to one or more of said SEQ ID NOs 1 to 19. Such antibody may bind specifically to SEQ ID NOs 1 to 19, respectively while not binding to non-AcfD (orf3526) proteins with affinity significantly higher than the antibody's non-specific affinity to human serum albumin as a non-specific binding reference standard.

Polypeptides used with the invention can take various forms (e.g. native, fusions, glycosylated, non-glycosylated, lipidated, non-lipidated, phosphorylated, non-phosphorylated, myristoylated, non-myristoylated, monomeric, multimeric, particulate, denatured, etc.). For instance, a polypeptide of the invention may have a lipidated N-terminal cysteine (e.g. Cys-24 of SEQ ID NOs: 1 to 19).

Polypeptides used with the invention can be prepared by various means (e.g. recombinant expression, purification from cell culture, chemical synthesis, etc.). Recombinantly-expressed proteins are preferred.

Polypeptides used with the invention are preferably provided in purified or substantially purified form i.e. substantially free from other polypeptides (e.g. free from naturally-occurring polypeptides), particularly from other E. coli or host cell polypeptides, and are generally at least about 50% pure (by weight), and usually at least about 90% pure i.e. less than about 50%, and more preferably less than about 10% (e.g. 5%) of a composition is made up of other expressed polypeptides. Thus the antigens in the compositions are separated from the whole organism with which the molecule is expressed.

Polypeptides used with the invention are preferably E. coli polypeptides. Such polypeptides may be further selected from NMEC, APEC, UPEC, EAEC, EIEC, EPEC and ETEC E. coli polypeptides.

The term “polypeptide” refers to amino acid polymers of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art. Polypeptides can occur as single chains or associated chains.

The invention provides polypeptides comprising a sequence -P-Q- or -Q-P-, wherein: —P— is an amino acid sequence as defined above and -Q- is not a sequence as defined above i.e. the invention provides fusion proteins. Where the N-terminus codon of -P- is not ATG, but this codon is not present at the N-terminus of a polypeptide, it will be translated as the standard amino acid for that codon rather than as a Met. Where this codon is at the N-terminus of a polypeptide, however, it will be translated as Met. Examples of -Q- moieties include, but are not limited to, histidine tags (i.e. His where n=3, 4, 5, 6, 7, 8, 9, 10 or more), a maltose-binding protein, or glutathione-S-transferase (GST).

The invention also provides an oligomeric protein comprising a polypeptide of the invention. The oligomer may be a dimer, a trimer, a tetramer, etc. The oligomer may be a homo-oligomer or a hetero-oligomer. Polypeptides in the oligomer may be covalently or non-covalently associated.

Comparison of the immune response raised in a subject by the polypeptide with the immune response raised by the full length protein may be carried out use by any means available to one of skill in the art. One simple method as used in the examples below involves immunization of a model subject such as mouse and then challenge with a lethal dose of E. coli. For proper comparison, one of skill in the art would naturally select the same adjuvant such as Freund's complete adjuvant. In such a test the immunogenic polypeptide fragments of the present invention will raise a substantially similar immune response in a subject (i.e., will provide substantially the same protection against the lethal challenge) if, for example, the polypeptide provides at least 70% of the protection provided by the full length protein, at least 80% of the protection provided by the full length protein, at least 85% of the protection provided by the full length protein, at least 90% of the protection provided by the full length protein, at least 95% of the protection provided by the full length protein, at least 97% of the protection provided by the full length protein, at least 98% of the protection provided by the full length protein, or at least 99% of the protection provided by the full length protein.

The full length AcfD (orf3526) protein against which the immunogenic polypeptide fragment would be compared (for solubility, toxicity and immune response raised) may be any representative E. coli AcfD (orf3526) protein including without limitation SEQ ID NOs 1-19. In preferred embodiments, the AcfD (orf3526) protein will be the corresponding full length protein from which the immunogenic polypeptide fragment is obtained.

The invention also provides a process for producing a polypeptide of the invention, comprising the step of culturing a host cell transformed with nucleic acid of the invention under conditions which induce polypeptide expression. The polypeptide may then be purified e.g. from culture supernatants.

The invention provides an E. coli cell, containing a plasmid that encodes a polypeptide of the invention. The chromosome of the E. coli cell may include a homolog of AcfD (orf3526), or such a homolog may be absent, but in both cases the polypeptide of the invention can be expressed from the plasmid. The plasmid may include a gene encoding a marker, etc. These and other details of suitable plasmids are given below.

Although expression of the polypeptides of the invention may take place in an E. coli strain, the invention will usually use a heterologous host for expression. The heterologous host may be prokaryotic (e.g. a bacterium) or eukaryotic. Suitable hosts include, but are not limited to, Bacillus subtilis, Vibrio cholerae, Salmonella typhi, Salmonella typhimurium, Neisseria lactamica, Neisseria cinerea, Mycobacteria (e.g. M. tuberculosis), yeasts, etc.

The invention provides a process for producing a polypeptide of the invention, comprising the step of synthesising at least part of the polypeptide by chemical means.

Any and all of the foregoing proteins, polypeptides, hybrid polypeptides, epitopes and immunogenic fragments may be in any one of a number of forms including, without limitation, recombinant, isolated or substantially purified (from materials co-existing with such proteins, polypeptides, hybrid polypeptides, epitopes and immunogenic fragments in their natural state).

Nucleic Acids

The invention also provides nucleic acid encoding polypeptides and hybrid polypeptides of the invention. It also provides nucleic acid comprising a nucleotide sequence that encodes one or more polypeptides or hybrid polypeptides of the invention.

The invention also provides nucleic acid comprising nucleotide sequences having sequence identity to such nucleotide sequences. Identity between sequences is preferably determined by the Smith-Waterman homology search algorithm as described above. Such nucleic acids include those using alternative codons to encode the same amino acid.

The invention also provides nucleic acid which can hybridize to these nucleic acids. Hybridization reactions can be performed under conditions of different “stringency”. Conditions that increase stringency of a hybridization reaction of widely known and published in the art (e.g. page 7.52 of reference 211). Examples of relevant conditions include (in order of increasing stringency): incubation temperatures of 25° C., 37° C., 50° C., 55° C. and 68° C.; buffer concentrations of 10×SSC, 6×SSC, 1×SSC, 0.1×SSC (where SSC is 0.15 M NaCl and 15 mM citrate buffer) and their equivalents using other buffer systems; formamide concentrations of 0%, 25%, 50%, and 75%; incubation times from 5 minutes to 24 hours; 1, 2, or more washing steps; wash incubation times of 1, 2, or 15 minutes; and wash solutions of 6×SSC, 1×SSC, 0.1×SSC, or de-ionized water. Hybridization techniques and their optimization are well known in the art (e.g. see refs 28, 29, 211, 213, etc.].

In some embodiments, nucleic acid of the invention hybridizes to a target under low stringency conditions; in other embodiments it hybridizes under intermediate stringency conditions; in preferred embodiments, it hybridizes under high stringency conditions. An exemplary set of low stringency hybridization conditions is 50° C. and 10×SSC. An exemplary set of intermediate stringency hybridization conditions is 55° C. and 1×SSC. An exemplary set of high stringency hybridization conditions is 68° C. and 0.1×SSC.

The invention includes nucleic acid comprising sequences complementary to these sequences (e.g. for antisense or probing, or for use as primers).

Nucleic acids of the invention can be used in hybridisation reactions (e.g. Northern or Southern blots, or in nucleic acid microarrays or ‘gene chips’) and amplification reactions (e.g. PCR, SDA, SSSR, LCR, TMA, NASBA, etc.) and other nucleic acid techniques.

Nucleic acid according to the invention can take various forms (e.g. single-stranded, double-stranded, vectors, primers, probes, labelled etc.). Nucleic acids of the invention may be circular or branched, but will generally be linear. Unless otherwise specified or required, any embodiment of the invention that utilizes a nucleic acid may utilize both the double-stranded form and each of two complementary single-stranded forms which make up the double-stranded form. Primers and probes are generally single-stranded, as are antisense nucleic acids.

Nucleic acids of the invention are preferably provided in purified or substantially purified form i.e. substantially free from other nucleic acids (e.g. free from naturally-occurring nucleic acids), particularly from other E. coli or host cell nucleic acids, generally being at least about 50% pure (by weight), and usually at least about 90% pure. Nucleic acids of the invention are preferably E. coli nucleic acids.

Nucleic acids of the invention may be prepared in many ways e.g. by chemical synthesis (e.g. phosphoramidite synthesis of DNA) in whole or in part, by digesting longer nucleic acids using nucleases (e.g. restriction enzymes), by joining shorter nucleic acids or nucleotides (e.g. using ligases or polymerases), from genomic or cDNA libraries, etc.

Nucleic acid of the invention may be attached to a solid support (e.g. a bead, plate, filter, film, slide, microarray support, resin, etc.). Nucleic acid of the invention may be labelled e.g. with a radioactive or fluorescent label, or a biotin label. This is particularly useful where the nucleic acid is to be used in detection techniques e.g. where the nucleic acid is a primer or as a probe.

The term “nucleic acid” includes in general means a polymeric form of nucleotides of any length, which contain deoxyribonucleotides, ribonucleotides, and/or their analogs. It includes DNA, RNA, DNA/RNA hybrids. It also includes DNA or RNA analogs, such as those containing modified backbones (e.g. peptide nucleic acids (PNAs) or phosphorothioates) or modified bases. Thus the invention includes mRNA, tRNA, rRNA, ribozymes, DNA, cDNA, recombinant nucleic acids, branched nucleic acids, plasmids, vectors, probes, primers, etc. Where nucleic acid of the invention takes the form of RNA, it may or may not have a 5′ cap.

Nucleic acids of the invention may be part of a vector i.e. part of a nucleic acid construct designed for transduction/transfection of one or more cell types. Vectors may be, for example, “cloning vectors” which are designed for isolation, propagation and replication of inserted nucleotides, “expression vectors” which are designed for expression of a nucleotide sequence in a host cell, “viral vectors” which is designed to result in the production of a recombinant virus or virus-like particle, or “shuttle vectors”, which comprise the attributes of more than one type of vector. Preferred vectors are plasmids, as mentioned above. A “host cell” includes an individual cell or cell culture which can be or has been a recipient of exogenous nucleic acid. Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or in total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation and/or change. Host cells include cells transfected or infected in vivo or in vitro with nucleic acid of the invention.

Where a nucleic acid is DNA, it will be appreciated that “U” in a RNA sequence will be replaced by “T” in the DNA. Similarly, where a nucleic acid is RNA, it will be appreciated that “T” in a DNA sequence will be replaced by “U” in the RNA.

The term “complement” or “complementary” when used in relation to nucleic acids refers to Watson-Crick base pairing. Thus the complement of C is G, the complement of G is C, the complement of A is T (or U), and the complement of T (or U) is A. It is also possible to use bases such as I (the purine inosine) e.g. to complement pyrimidines (C or T).

Nucleic acids of the invention can be used, for example: to produce polypeptides; as hybridization probes for the detection of nucleic acid in biological samples; to generate additional copies of the nucleic acids; to generate ribozymes or antisense oligonucleotides; as single-stranded DNA primers or probes; or as triple-strand forming oligonucleotides.

The invention provides a process for producing nucleic acid of the invention, wherein the nucleic acid is synthesised in part or in whole using chemical means.

The invention provides vectors comprising nucleotide sequences of the invention (e.g. cloning or expression vectors) and host cells transformed with such vectors.

Nucleic acid amplification according to the invention may be quantitative and/or real-time.

For certain embodiments of the invention, nucleic acids are preferably at least 7 nucleotides in length (e.g. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300 nucleotides or longer).

For certain embodiments of the invention, nucleic acids are preferably at most 500 nucleotides in length (e.g. 450, 400, 350, 300, 250, 200, 150, 140, 130, 120, 110, 100, 90, 80, 75, 70, 65, 60, 55, 50, 45, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15 nucleotides or shorter).

Primers and probes of the invention, and other nucleic acids used for hybridization, are preferably between 10 and 30 nucleotides in length (e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides).

Immunogenic Compositions and Medicaments

Polypeptides of the invention are useful as active ingredients (immunogens) in immunogenic compositions, and such compositions may be useful as vaccines. Vaccines according to the invention may either be prophylactic (i.e. to prevent infection) or therapeutic (i.e. to treat infection), but will typically be prophylactic.

Immunogenic compositions will be pharmaceutically acceptable. They will usually include components in addition to the antigens e.g. they typically include one or more pharmaceutical carrier(s), excipient(s) and/or adjuvant(s). A thorough discussion of carriers and excipients is available in ref. 208. Thorough discussions of vaccine adjuvants are available in refs. 30 and 31.

Compositions will generally be administered to a mammal in aqueous form. Prior to administration, however, the composition may have been in a non-aqueous form. For instance, although some vaccines are manufactured in aqueous form, then filled and distributed and administered also in aqueous form, other vaccines are lyophilised during manufacture and are reconstituted into an aqueous form at the time of use. Thus a composition of the invention may be dried, such as a lyophilised formulation.

The composition may include preservatives such as thiomersal or 2-phenoxyethanol. It is preferred, however, that the vaccine should be substantially free from (i.e. less than 5 μg/ml) mercurial material e.g. thiomersal-free. Vaccines containing no mercury are more preferred. Preservative-free vaccines are particularly preferred.

To improve thermal stability, a composition may include a temperature protective agent.

To control tonicity, it is preferred to include a physiological salt, such as a sodium salt. Sodium chloride (NaCl) is preferred, which may be present at between 1 and 20 mg/ml e.g. about 10±2 mg/ml NaCl. Other salts that may be present include potassium chloride, potassium dihydrogen phosphate, disodium phosphate dehydrate, magnesium chloride, calcium chloride, etc.

Compositions will generally have an osmolality of between 200 mOsm/kg and 400 mOsm/kg, preferably between 240-360 mOsm/kg, and will more preferably fall within the range of 290-310 mOsm/kg.

Compositions may include one or more buffers. Typical buffers include: a phosphate buffer; a Tris buffer; a borate buffer; a succinate buffer; a histidine buffer (particularly with an aluminum hydroxide adjuvant); or a citrate buffer. Buffers will typically be included in the 5-20 mM range.

The pH of a composition will generally be between 5.0 and 8.1, and more typically between 6.0 and 8.0 e.g. 6.5 and 7.5, or between 7.0 and 7.8.

The composition is preferably sterile. The composition is preferably non-pyrogenic e.g. containing <1 EU (endotoxin unit, a standard measure) per dose, and preferably <0.1 EU per dose. The composition is preferably gluten free.

The composition may include material for a single immunisation, or may include material for multiple immunisations (i.e. a ‘multidose’ kit). The inclusion of a preservative is preferred in multidose arrangements. As an alternative (or in addition) to including a preservative in multidose compositions, the compositions may be contained in a container having an aseptic adaptor for removal of material.

Human vaccines are typically administered in a dosage volume of about 0.5 ml, although a half dose (i.e. about 0.25 ml) may be administered to children.

Immunogenic compositions of the invention may also comprise one or more immunoregulatory agents. Preferably, one or more of the immunoregulatory agents include one or more adjuvants. The adjuvants may include a TH1 adjuvant and/or a TH2 adjuvant, further discussed below.

Adjuvants which may be used in compositions of the invention include, but are not limited to:

A. Mineral-Containing Compositions

Mineral containing compositions suitable for use as adjuvants in the invention include mineral salts, such as aluminium salts and calcium salts (or mixtures thereof). Calcium salts include calcium phosphate (e.g. the “CAP” particles disclosed in ref. 32). Aluminum salts include hydroxides, phosphates, sulfates, etc., with the salts taking any suitable form (e.g. gel, crystalline, amorphous, etc.). Adsorption to these salts is preferred. The mineral containing compositions may also be formulated as a particle of metal salt [33].

The adjuvants known as aluminum hydroxide and aluminum phosphate may be used. These names are conventional, but are used for convenience only, as neither is a precise description of the actual chemical compound which is present (e.g. see chapter 9 of reference 30). The invention can use any of the “hydroxide” or “phosphate” adjuvants that are in general use as adjuvants. The adjuvants known as “aluminium hydroxide” are typically aluminium oxyhydroxide salts, which are usually at least partially crystalline. The adjuvants known as “aluminium phosphate” are typically aluminium hydroxyphosphates, often also containing a small amount of sulfate (i.e. aluminium hydroxyphosphate sulfate). They may be obtained by precipitation, and the reaction conditions and concentrations during precipitation influence the degree of substitution of phosphate for hydroxyl in the salt.

A fibrous morphology (e.g. as seen in transmission electron micrographs) is typical for aluminium hydroxide adjuvants. The pI of aluminium hydroxide adjuvants is typically about 11 i.e. the adjuvant itself has a positive surface charge at physiological pH. Adsorptive capacities of between 1.8-2.6 mg protein per mg Al+++ at pH 7.4 have been reported for aluminium hydroxide adjuvants.

Aluminium phosphate adjuvants generally have a PO4/Al molar ratio between 0.3 and 1.2, preferably between 0.8 and 1.2, and more preferably 0.95±0.1. The aluminium phosphate will generally be amorphous, particularly for hydroxyphosphate salts. A typical adjuvant is amorphous aluminium hydroxyphosphate with PO4/Al molar ratio between 0.84 and 0.92, included at 0.6 mg Al3+/ml. The aluminium phosphate will generally be particulate (e.g. plate-like morphology as seen in transmission electron micrographs). Typical diameters of the particles are in the range 0.5-20 μm (e.g. about 5-10 μm) after any antigen adsorption. Adsorptive capacities of between 0.7-1.5 mg protein per mg Al+++ at pH 7.4 have been reported for aluminium phosphate adjuvants.

The point of zero charge (PZC) of aluminium phosphate is inversely related to the degree of substitution of phosphate for hydroxyl, and this degree of substitution can vary depending on reaction conditions and concentration of reactants used for preparing the salt by precipitation. PZC is also altered by changing the concentration of free phosphate ions in solution (more phosphate=more acidic PZC) or by adding a buffer such as a histidine buffer (makes PZC more basic). Aluminium phosphates used according to the invention will generally have a PZC of between 4.0 and 7.0, more preferably between 5.0 and 6.5 e.g. about 5.7.

Suspensions of aluminium salts used to prepare compositions of the invention may contain a buffer (e.g. a phosphate or a histidine or a Tris buffer), but this is not always necessary. The suspensions are preferably sterile and pyrogen-free. A suspension may include free aqueous phosphate ions e.g. present at a concentration between 1.0 and 20 mM, preferably between 5 and 15 mM, and more preferably about 10 mM. The suspensions may also comprise sodium chloride.

The invention can use a mixture of both an aluminium hydroxide and an aluminium phosphate. In this case there may be more aluminium phosphate than hydroxide e.g. a weight ratio of at least 2:1 e.g. ≥5:1, ≥6:1, ≥7:1, ≥8:1, ≥9:1, etc.

The concentration of Al+++ in a composition for administration to a patient is preferably less than 10 mg/ml e.g. ≤5 mg/ml, ≤4 mg/ml, ≤3 mg/ml, ≤2 mg/ml, ≤1 mg/ml, etc. A preferred range is between 0.3 and 1 mg/ml. A maximum of 0.85 mg/dose is preferred.

B. Oil Emulsions

Oil emulsion compositions suitable for use as adjuvants in the invention include squalene-water emulsions, such as MF59 [Chapter 10 of ref. 30; see also ref. 34] (5% Squalene, 0.5% Tween 80, and 0.5% Span 85, formulated into submicron particles using a microfluidizer). Complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA) may also be used.

Various oil-in-water emulsion adjuvants are known, and they typically include at least one oil and at least one surfactant, with the oil(s) and surfactant(s) being biodegradable (metabolisable) and biocompatible. The oil droplets in the emulsion are generally less than 5 μm in diameter, and ideally have a sub-micron diameter, with these small sizes being achieved with a microfluidiser to provide stable emulsions. Droplets with a size less than 220 nm are preferred as they can be subjected to filter sterilization.

The emulsion can comprise oils such as those from an animal (such as fish) or vegetable source. Sources for vegetable oils include nuts, seeds and grains. Peanut oil, soybean oil, coconut oil, and olive oil, the most commonly available, exemplify the nut oils. Jojoba oil can be used e.g. obtained from the jojoba bean. Seed oils include safflower oil, cottonseed oil, sunflower seed oil, sesame seed oil and the like. In the grain group, corn oil is the most readily available, but the oil of other cereal gains such as wheat, oats, rye, rice, teff, triticale and the like may also be used. 6-10 carbon fatty acid esters of glycerol and 1,2-propanediol, while not occurring naturally in seed oils, may be prepared by hydrolysis, separation and esterification of the appropriate materials starting from the nut and seed oils. Fats and oils from mammalian milk are metabolizable and may therefore be used in the practice of this invention. The procedures for separation, purification, saponification and other means necessary for obtaining pure oils from animal sources are well known in the art. Most fish contain metabolizable oils which may be readily recovered. For example, cod liver oil, shark liver oils, and whale oil such as spermaceti exemplify several of the fish oils which may be used herein. A number of branched chain oils are synthesized biochemically in 5-carbon isoprene units and are generally referred to as terpenoids. Shark liver oil contains a branched, unsaturated terpenoids known as squalene, 2,6,10,15,19,23-hexamethyl-2,6,10,14,18,22-tetracosahexaene, which is particularly preferred herein. Squalane, the saturated analog to squalene, is also a preferred oil. Fish oils, including squalene and squalane, are readily available from commercial sources or may be obtained by methods known in the art. Other preferred oils are the tocopherols (see below). Mixtures of oils can be used.

Surfactants can be classified by their ‘HLB’ (hydrophile/lipophile balance). Preferred surfactants of the invention have a HLB of at least 10, preferably at least 15, and more preferably at least 16. The invention can be used with surfactants including, but not limited to: the polyoxyethylene sorbitan esters surfactants (commonly referred to as the Tweens), especially polysorbate 20 and polysorbate 80; copolymers of ethylene oxide (EO), propylene oxide (PO), and/or butylene oxide (BO), sold under the DOWFAX™ tradename, such as linear EO/PO block copolymers; octoxynols, which can vary in the number of repeating ethoxy (oxy-1,2-ethanediyl) groups, with octoxynol-9 (Triton X-100, or t-octylphenoxypolyethoxyethanol) being of particular interest; (octylphenoxy)polyethoxyethanol (IGEPAL CA-630/NP-40); phospholipids such as phosphatidylcholine (lecithin); nonylphenol ethoxylates, such as the Tergitol™ NP series; polyoxyethylene fatty ethers derived from lauryl, cetyl, stearyl and oleyl alcohols (known as Brij surfactants), such as triethyleneglycol monolauryl ether (Brij 30); and sorbitan esters (commonly known as the SPANs), such as sorbitan trioleate (Span 85) and sorbitan monolaurate. Non-ionic surfactants are preferred. Preferred surfactants for including in the emulsion are Tween 80 (polyoxyethylene sorbitan monooleate), Span 85 (sorbitan trioleate), lecithin and Triton X-100.

Mixtures of surfactants can be used e.g. Tween 80/Span 85 mixtures. A combination of a polyoxyethylene sorbitan ester such as polyoxyethylene sorbitan monooleate (Tween 80) and an octoxynol such as t-octylphenoxypolyethoxyethanol (Triton X-100) is also suitable. Another useful combination comprises laureth 9 plus a polyoxyethylene sorbitan ester and/or an octoxynol.

Preferred amounts of surfactants (% by weight) are: polyoxyethylene sorbitan esters (such as Tween 80) 0.01 to 1%, in particular about 0.1%; octyl- or nonylphenoxy polyoxyethanols (such as Triton X-100, or other detergents in the Triton series) 0.001 to 0.1%, in particular 0.005 to 0.02%; polyoxyethylene ethers (such as laureth 9) 0.1 to 20%, preferably 0.1 to 10% and in particular 0.1 to 1% or about 0.5%.

Preferred emulsion adjuvants have an average droplets size of ≤1 μm e.g. ≤750 nm, ≤500 nm, ≤400 nm, ≤300 nm, ≤250 nm, ≤220 nm, ≤200 nm, or smaller. These droplet sizes can conveniently be achieved by techniques such as microfluidisation.

Specific oil-in-water emulsion adjuvants useful with the invention include, but are not limited to:

    • A submicron emulsion of squalene, Tween 80, and Span 85. The composition of the emulsion by volume can be about 5% squalene, about 0.5% polysorbate 80 and about 0.5% Span 85. In weight terms, these ratios become 4.3% squalene, 0.5% polysorbate 80 and 0.48% Span 85. This adjuvant is known as ‘MF59’ [35-37], as described in more detail in Chapter 10 of ref. 38 and chapter 12 of ref 39. The MF59 emulsion advantageously includes citrate ions e.g. 10 mM sodium citrate buffer.
    • An emulsion of squalene, a tocopherol, and Tween 80. The emulsion may include phosphate buffered saline. It may also include Span 85 (e.g. at 1%) and/or lecithin. These emulsions may have from 2 to 10% squalene, from 2 to 10% tocopherol and from 0.3 to 3% Tween 80, and the weight ratio of squalene:tocopherol is preferably ≤1 as this provides a more stable emulsion. Squalene and Tween 80 may be present volume ratio of about 5:2. One such emulsion can be made by dissolving Tween 80 in PBS to give a 2% solution, then mixing 90 ml of this solution with a mixture of (5 g of DL-α-tocopherol and 5 ml squalene), then microfluidising the mixture. The resulting emulsion may have submicron oil droplets e.g. with an average diameter of between 100 and 250 nm, preferably about 180 nm.
    • An emulsion of squalene, a tocopherol, and a Triton detergent (e.g. Triton X-100). The emulsion may also include a 3d-MPL (see below). The emulsion may contain a phosphate buffer.
    • An emulsion comprising a polysorbate (e.g. polysorbate 80), a Triton detergent (e.g. Triton X-100) and a tocopherol (e.g. an α-tocopherol succinate). The emulsion may include these three components at a mass ratio of about 75:11:10 (e.g. 750 μg/ml polysorbate 80, 110 μg/ml Triton X-100 and 100 μg/ml α-tocopherol succinate), and these concentrations should include any contribution of these components from antigens. The emulsion may also include squalene. The emulsion may also include a 3d-MPL (see below). The aqueous phase may contain a phosphate buffer.
    • An emulsion of squalane, polysorbate 80 and poloxamer 401 (“Pluronic™ L121”). The emulsion can be formulated in phosphate buffered saline, pH 7.4. This emulsion is a useful delivery vehicle for muramyl dipeptides, and has been used with threonyl-MDP in the “SAF-1” adjuvant [40] (0.05-1% Thr-MDP, 5% squalane, 2.5% Pluronic L121 and 0.2% polysorbate 80). It can also be used without the Thr-MDP, as in the “AF” adjuvant [41] (5% squalane, 1.25% Pluronic L121 and 0.2% polysorbate 80). Microfluidisation is preferred.
    • An emulsion comprising squalene, an aqueous solvent, a polyoxyethylene alkyl ether hydrophilic nonionic surfactant (e.g. polyoxyethylene (12) cetostearyl ether) and a hydrophobic nonionic surfactant (e.g. a sorbitan ester or mannide ester, such as sorbitan monoleate or ‘Span 80’). The emulsion is preferably thermoreversible and/or has at least 90% of the oil droplets (by volume) with a size less than 200 nm [42]. The emulsion may also include one or more of: alditol; a cryoprotective agent (e.g. a sugar, such as dodecylmaltoside and/or sucrose); and/or an alkylpolyglycoside. Such emulsions may be lyophilized.
    • An emulsion of squalene, poloxamer 105 and Abil-Care [43]. The final concentration (weight) of these components in adjuvanted vaccines are 5% squalene, 4% poloxamer 105 (pluronic polyol) and 2% Abil-Care 85 (Bis-PEG/PPG-16/16 PEG/PPG-16/16 dimethicone; caprylic/capric triglyceride).
    • An emulsion having from 0.5-50% of an oil, 0.1-10% of a phospholipid, and 0.05-5% of a non-ionic surfactant. As described in reference 44, preferred phospholipid components are phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidylglycerol, phosphatidic acid, sphingomyelin and cardiolipin. Submicron droplet sizes are advantageous.
    • A submicron oil-in-water emulsion of a non-metabolisable oil (such as light mineral oil) and at least one surfactant (such as lecithin, Tween 80 or Span 80). Additives may be included, such as QuilA saponin, cholesterol, a saponin-lipophile conjugate (such as GPI-0100, described in reference 45, produced by addition of aliphatic amine to desacylsaponin via the carboxyl group of glucuronic acid), dimethyidioctadecylammonium bromide and/or N,N-dioctadecyl-N,N-bis(2-hydroxyethyl)propanediamine.
    • An emulsion in which a saponin (e.g. QuilA or QS21) and a sterol (e.g. a cholesterol) are associated as helical micelles [46].
    • An emulsion comprising a mineral oil, a non-ionic lipophilic ethoxylated fatty alcohol, and a non-ionic hydrophilic surfactant (e.g. an ethoxylated fatty alcohol and/or polyoxyethylene-polyoxypropylene block copolymer) [47].
    • An emulsion comprising a mineral oil, a non-ionic hydrophilic ethoxylated fatty alcohol, and a non-ionic lipophilic surfactant (e.g. an ethoxylated fatty alcohol and/or polyoxyethylene-polyoxypropylene block copolymer) [47].

In some embodiments an emulsion may be mixed with antigen extemporaneously, at the time of delivery, and thus the adjuvant and antigen may be kept separately in a packaged or distributed vaccine, ready for final formulation at the time of use. In other embodiments an emulsion is mixed with antigen during manufacture, and thus the composition is packaged in a liquid adjuvanted form. The antigen will generally be in an aqueous form, such that the vaccine is finally prepared by mixing two liquids. The volume ratio of the two liquids for mixing can vary (e.g. between 5:1 and 1:5) but is generally about 1:1. Where concentrations of components are given in the above descriptions of specific emulsions, these concentrations are typically for an undiluted composition, and the concentration after mixing with an antigen solution will thus decrease.

Where a composition includes a tocopherol, any of the α, β, γ, δ, ε or ξ tocopherols can be used, but α-tocopherols are preferred. The tocopherol can take several forms e.g. different salts and/or isomers. Salts include organic salts, such as succinate, acetate, nicotinate, etc. D-α-tocopherol and DL-α-tocopherol can both be used. Tocopherols are advantageously included in vaccines for use in elderly patients (e.g. aged 60 years or older) because vitamin E has been reported to have a positive effect on the immune response in this patient group [48]. They also have antioxidant properties that may help to stabilize the emulsions [49]. A preferred α-tocopherol is DL-α-tocopherol, and the preferred salt of this tocopherol is the succinate. The succinate salt has been found to cooperate with TNF-related ligands in vivo.

C. Saponin Formulations [Chapter 22 of Ref 30]

Saponin formulations may also be used as adjuvants in the invention. Saponins are a heterogeneous group of sterol glycosides and triterpenoid glycosides that are found in the bark, leaves, stems, roots and even flowers of a wide range of plant species. Saponin from the bark of the Quillaia saponaria Molina tree have been widely studied as adjuvants. Saponin can also be commercially obtained from Smilax ornata (sarsaprilla), Gypsophilla paniculata (brides veil), and Saponaria officianalis (soap root). Saponin adjuvant formulations include purified formulations, such as QS21, as well as lipid formulations, such as ISCOMs. QS21 is marketed as Stimulon™.

Saponin compositions have been purified using HPLC and RP-HPLC. Specific purified fractions using these techniques have been identified, including QS7, QS17, QS18, QS21, QH-A, QH-B and QH-C. Preferably, the saponin is QS21. A method of production of QS21 is disclosed in ref. 50. Saponin formulations may also comprise a sterol, such as cholesterol[51].

Combinations of saponins and cholesterols can be used to form unique particles called immunostimulating complexs (ISCOMs) [chapter 23 of ref. 30]. ISCOMs typically also include a phospholipid such as phosphatidylethanolamine or phosphatidylcholine. Any known saponin can be used in ISCOMs. Preferably, the ISCOM includes one or more of QuilA, QHA & QHC. ISCOMs are further described in refs. 51-53. Optionally, the ISCOMS may be devoid of additional detergent [54].

A review of the development of saponin based adjuvants can be found in refs. 55 & 56.

D. Virosomes and Virus-Like Particles

Virosomes and virus-like particles (VLPs) can also be used as adjuvants in the invention. These structures generally contain one or more proteins from a virus optionally combined or formulated with a phospholipid. They are generally non-pathogenic, non-replicating and generally do not contain any of the native viral genome. The viral proteins may be recombinantly produced or isolated from whole viruses. These viral proteins suitable for use in virosomes or VLPs include proteins derived from influenza virus (such as HA or NA), Hepatitis B virus (such as core or capsid proteins), Hepatitis E virus, measles virus, Sindbis virus, Rotavirus, Foot-and-Mouth Disease virus, Retrovirus, Norwalk virus, human Papilloma virus, HIV, RNA-phages, Qβ-phage (such as coat proteins), GA-phage, fr-phage, AP205 phage, and Ty (such as retrotransposon Ty protein p1). VLPs are discussed further in refs. 57-62. Virosomes are discussed further in, for example, ref. 63

E. Bacterial or Microbial Derivatives

Adjuvants suitable for use in the invention include bacterial or microbial derivatives such as non-toxic derivatives of enterobacterial lipopolysaccharide (LPS), Lipid A derivatives, immunostimulatory oligonucleotides and ADP-ribosylating toxins and detoxified derivatives thereof.

Non-toxic derivatives of LPS include monophosphoryl lipid A (MPL) and 3-O-deacylated MPL (3dMPL). 3dMPL is a mixture of 3 de-O-acylated monophosphoryl lipid A with 4, 5 or 6 acylated chains. A preferred “small particle” form of 3 De-O-acylated monophosphoryl lipid A is disclosed in ref. 64. Such “small particles” of 3dMPL are small enough to be sterile filtered through a 0.22 μm membrane[64]. Other non-toxic LPS derivatives include monophosphoryl lipid A mimics, such as aminoalkyl glucosaminide phosphate derivatives e.g. RC-529 [65,66].

Lipid A derivatives include derivatives of lipid A from Escherichia coli such as OM-174. OM-174 is described for example in refs. 67 & 68.

Immunostimulatory oligonucleotides suitable for use as adjuvants in the invention include nucleotide sequences containing a CpG motif (a dinucleotide sequence containing an unmethylated cytosine linked by a phosphate bond to a guanosine). Double-stranded RNAs and oligonucleotides containing palindromic or poly(dG) sequences have also been shown to be immunostimulatory.

The CpG's can include nucleotide modifications/analogs such as phosphorothioate modifications and can be double-stranded or single-stranded. References 69, 70 and 71 disclose possible analog substitutions e.g. replacement of guanosine with 2′-deoxy-7-deazaguanosine. The adjuvant effect of CpG oligonucleotides is further discussed in refs. 72-77.

The CpG sequence may be directed to TLR9, such as the motif GTCGTT or TTCGTT [78]. The CpG sequence may be specific for inducing a Th1 immune response, such as a CpG-A ODN, or it may be more specific for inducing a B cell response, such a CpG-B ODN. CpG-A and CpG-B ODNs are discussed in refs. 79-81. Preferably, the CpG is a CpG-A ODN.

Preferably, the CpG oligonucleotide is constructed so that the 5′ end is accessible for receptor recognition. Optionally, two CpG oligonucleotide sequences may be attached at their 3′ ends to form “immunomers”. See, for example, refs. 78 & 82-84.

A useful CpG adjuvant is CpG7909, also known as ProMune™ (Coley Pharmaceutical Group, Inc.). Another is CpG1826. As an alternative, or in addition, to using CpG sequences, TpG sequences can be used [85], and these oligonucleotides may be free from unmethylated CpG motifs. The immunostimulatory oligonucleotide may be pyrimidine-rich. For example, it may comprise more than one consecutive thymidine nucleotide (e.g. TTTT, as disclosed in ref. 85), and/or it may have a nucleotide composition with >25% thymidine (e.g. >35%, >40%, >50%, >60%, >80%, etc.). For example, it may comprise more than one consecutive cytosine nucleotide (e.g. CCCC, as disclosed in ref. 85), and/or it may have a nucleotide composition with >25% cytosine (e.g. >35%, >40%, >50%, >60%, >80%, etc.). These oligonucleotides may be free from unmethylated CpG motifs. Immunostimulatory oligonucleotides will typically comprise at least 20 nucleotides. They may comprise fewer than 100 nucleotides.

A particularly useful adjuvant based around immunostimulatory oligonucleotides is known as IC-31™ [86]. Thus an adjuvant used with the invention may comprise a mixture of (i) an oligonucleotide (e.g. between 15-40 nucleotides) including at least one (and preferably multiple) CpI motifs (i.e. a cytosine linked to an inosine to form a dinucleotide), and (ii) a polycationic polymer, such as an oligopeptide (e.g. between 5-20 amino acids) including at least one (and preferably multiple) Lys-Arg-Lys tripeptide sequence(s). The oligonucleotide may be a deoxynucleotide comprising 26-mer sequence 5′-(IC)13-3′ (SEQ ID NO: 110). The polycationic polymer may be a peptide comprising 11-mer amino acid sequence KLKLLLLLKLK (SEQ ID NO: 111).

Bacterial ADP-ribosylating toxins and detoxified derivatives thereof may be used as adjuvants in the invention. Preferably, the protein is derived from E. coli (E. coli heat labile enterotoxin “LT”), cholera (“CT”), or pertussis (“PT”). The use of detoxified ADP-ribosylating toxins as mucosal adjuvants is described in ref. 87 and as parenteral adjuvants in ref. 88. The toxin or toxoid is preferably in the form of a holotoxin, comprising both A and B subunits. Preferably, the A subunit contains a detoxifying mutation; preferably the B subunit is not mutated. Preferably, the adjuvant is a detoxified LT mutant such as LT-K63, LT-R72, and LT-G192. The use of ADP-ribosylating toxins and detoxified derivatives thereof, particularly LT-K63 and LT-R72, as adjuvants can be found in refs. 89-96. A useful CT mutant is or CT-E29H [97]. Numerical reference for amino acid substitutions is preferably based on the alignments of the A and B subunits of ADP-ribosylating toxins set forth in ref. 98, specifically incorporated herein by reference in its entirety solely for the purpose of the alignment and amino acid numbering therein.

F. Human Immunomodulators

Human immunomodulators suitable for use as adjuvants in the invention include cytokines, such as interleukins (e.g. IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 [99], etc.) [100], interferons (e.g. interferon-γ), macrophage colony stimulating factor, and tumor necrosis factor. A preferred immunomodulator is IL-12.

G. Bioadhesives and Mucoadhesives

Bioadhesives and mucoadhesives may also be used as adjuvants in the invention. Suitable bioadhesives include esterified hyaluronic acid microspheres [101] or mucoadhesives such as cross-linked derivatives of poly(acrylic acid), polyvinyl alcohol, polyvinyl pyrollidone, polysaccharides and carboxymethylcellulose. Chitosan and derivatives thereof may also be used as adjuvants in the invention[102].

H. Microparticles

Microparticles may also be used as adjuvants in the invention. Microparticles (i.e. a particle of ˜100 nm to ˜150 μm in diameter, more preferably ˜0.200 nm to ˜30 μm in diameter, and most preferably ˜500 nm to ˜10 μm in diameter) formed from materials that are biodegradable and non-toxic (e.g. a poly(α-hydroxy acid), a polyhydroxybutyric acid, a polyorthoester, a polyanhydride, a polycaprolactone, etc.), with poly(lactide-co-glycolide) are preferred, optionally treated to have a negatively-charged surface (e.g. with SDS) or a positively-charged surface (e.g. with a cationic detergent, such as CTAB).

I. Liposomes (Chapters 13 & 14 of Ref 30)

Examples of liposome formulations suitable for use as adjuvants are described in refs. 103-105.

J. Polyoxyethylene Ether and Polyoxyethylene Ester Formulations

Adjuvants suitable for use in the invention include polyoxyethylene ethers and polyoxyethylene esters [106]. Such formulations further include polyoxyethylene sorbitan ester surfactants in combination with an octoxynol[107] as well as polyoxyethylene alkyl ethers or ester surfactants in combination with at least one additional non-ionic surfactant such as an octoxynol[108]. Preferred polyoxyethylene ethers are selected from the following group: polyoxyethylene-9-lauryl ether (laureth 9), polyoxyethylene-9-steoryl ether, polyoxytheylene-8-steoryl ether, polyoxyethylene-4-lauryl ether, polyoxyethylene-35-lauryl ether, and polyoxyethylene-23-lauryl ether.

K. Phosphazenes

A phosphazene, such as poly[di(carboxylatophenoxy)phosphazene] (“PCPP”) as described, for example, in references 109 and 110, may be used.

L. Muramyl Peptides

Examples of muramyl peptides suitable for use as adjuvants in the invention include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), and N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1′-2′-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE).

M. Imidazoquinolone Compounds.

Examples of imidazoquinolone compounds suitable for use adjuvants in the invention include Imiquimod (“R-837”) [111,112], Resiquimod (“R-848”) [113], and their analogs; and salts thereof (e.g. the hydrochloride salts). Further details about immunostimulatory imidazoquinolines can be found in references 114 to 118.

N. Substituted Ureas

Substituted ureas useful as adjuvants include compounds of formula I, II or III, or salts thereof:

    • as defined in reference 119, such as ‘ER 803058’, ‘ER 803732’, ‘ER 804053’, ER 804058’, ‘ER 804059’, ‘ER 804442’, ‘ER 804680’, ‘ER 804764’, ER 803022 or ‘ER 804057’ e.g.:

O. Further Adjuvants

Further adjuvants that may be used with the invention include:

    • An aminoalkyl glucosaminide phosphate derivative, such as RC-529 [120,121].
    • A thiosemicarbazone compound, such as those disclosed in reference 122. Methods of formulating, manufacturing, and screening for active compounds are also described in reference 122. The thiosemicarbazones are particularly effective in the stimulation of human peripheral blood mononuclear cells for the production of cytokines, such as TNF-α.
    • A tryptanthrin compound, such as those disclosed in reference 123. Methods of formulating, manufacturing, and screening for active compounds are also described in reference 123. The thiosemicarbazones are particularly effective in the stimulation of human peripheral blood mononuclear cells for the production of cytokines, such as TNF-α.
    • A nucleoside analog, such as: (a) Isatorabine (ANA-245; 7-thia-8-oxoguanosine):

    • and prodrugs thereof; (b) ANA975; (c) ANA-025-1; (d) ANA380; (e) the compounds disclosed in references 124 to 126Loxoribine (7-allyl-8-oxoguanosine) [127].
    • Compounds disclosed in reference 128, including: Acylpiperazine compounds, Indoledione compounds, Tetrahydraisoquinoline (THIQ) compounds, Benzocyclodione compounds, Aminoazavinyl compounds, Aminobenzimidazole quinolinone (ABIQ) compounds [129,130], Hydrapthalamide compounds, Benzophenone compounds, Isoxazole compounds, Sterol compounds, Quinazilinone compounds, Pyrrole compounds [131], Anthraquinone compounds, Quinoxaline compounds, Triazine compounds, Pyrazalopyrimidine compounds, and Benzazole compounds [132].
    • Compounds containing lipids linked to a phosphate-containing acyclic backbone, such as the TLR4 antagonist E5564 [133,134]:
    • A polyoxidonium polymer [135,136] or other N-oxidized polyethylene-piperazine derivative.
    • Methyl inosine 5′-monophosphate (“MIMP”) [137].
    • A polyhydroxlated pyrrolizidine compound [138], such as one having formula:

    • where R is selected from the group comprising hydrogen, straight or branched, unsubstituted or substituted, saturated or unsaturated acyl, alkyl (e.g. cycloalkyl), alkenyl, alkynyl and aryl groups, or a pharmaceutically acceptable salt or derivative thereof. Examples include, but are not limited to: casuarine, casuarine-6-α-D-glucopyranose, 3-epi-casuarine, 7-epi-casuarine, 3,7-diepi-casuarine, etc.
    • A CD1d ligand, such as an α-glycosylceramide[139-146] (e.g. α-galactosylceramide), phytosphingosine-containing α-glycosylceramides, OCH, KRN7000 [(2S,3S,4R)-1-O-(α-D-galactopyranosyl)-2-(N-hexacosanoylamino)-1,3,4-octadecanetriol], CRONY-101, 3n-O-sulfo-galactosylceramide, etc.
    • A gamma inulin [147] or derivative thereof, such as algammulin.

Adjuvant Combinations

The invention may also comprise combinations of aspects of one or more of the adjuvants identified above. For example, the following adjuvant compositions may be used in the invention: (1) a saponin and an oil-in-water emulsion[148]; (2) a saponin (e.g. QS21)+a non-toxic LPS derivative (e.g. 3dMPL) [149]; (3) a saponin (e.g. QS21)+a non-toxic LPS derivative (e.g. 3dMPL)+a cholesterol; (4) a saponin (e.g. QS21)+3dMPL+IL-12 (optionally+a sterol) [150]; (5) combinations of 3dMPL with, for example, QS21 and/or oil-in-water emulsions [151]; (6) SAF, containing 10% squalane, 0.4% Tween 80™, 5% pluronic-block polymer L121, and thr-MDP, either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion. (7) Ribi™ adjuvant system (RAS), (Ribi Immunochem) containing 2% squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (Detox™); and (8) one or more mineral salts (such as an aluminum salt)+a non-toxic derivative of LPS (such as 3dMPL).

Other substances that act as immunostimulating agents are disclosed in chapter 7 of ref. 30.

The use of an aluminium hydroxide and/or aluminium phosphate adjuvant is particularly preferred, and antigens are generally adsorbed to these salts. Calcium phosphate is another preferred adjuvant. Other preferred adjuvant combinations include combinations of Th1 and Th2 adjuvants such as CpG & alum or resiquimod & alum. A combination of aluminium phosphate and 3dMPL may be used.

The compositions of the invention may elicit both a cell mediated immune response as well as a humoral immune response. This immune response will preferably induce long lasting (e.g. neutralising) antibodies and a cell mediated immunity that can quickly respond upon exposure to pnuemococcus.

Two types of T cells, CD4 and CD8 cells, are generally thought necessary to initiate and/or enhance cell mediated immunity and humoral immunity. CD8 T cells can express a CD8 co-receptor and are commonly referred to as Cytotoxic T lymphocytes (CTLs). CD8 T cells are able to recognized or interact with antigens displayed on MHC Class I molecules.

CD4 T cells can express a CD4 co-receptor and are commonly referred to as T helper cells. CD4 T cells are able to recognize antigenic peptides bound to MHC class II molecules. Upon interaction with a MHC class II molecule, the CD4 cells can secrete factors such as cytokines. These secreted cytokines can activate B cells, cytotoxic T cells, macrophages, and other cells that participate in an immune response. Helper T cells or CD4+ cells can be further divided into two functionally distinct subsets: TH1 phenotype and TH2 phenotypes which differ in their cytokine and effector function.

Activated TH1 cells enhance cellular immunity (including an increase in antigen-specific CTL production) and are therefore of particular value in responding to intracellular infections. Activated TH1 cells may secrete one or more of IL-2, IFN-γ, and TNF-β. A TH1 immune response may result in local inflammatory reactions by activating macrophages, NK (natural killer) cells, and CD8 cytotoxic T cells (CTLs). A TH1 immune response may also act to expand the immune response by stimulating growth of B and T cells with IL-12. TH1 stimulated B cells may secrete IgG2a.

Activated TH2 cells enhance antibody production and are therefore of value in responding to extracellular infections. Activated TH2 cells may secrete one or more of IL-4, IL-5, IL-6, and IL-10. A TH2 immune response may result in the production of IgG1, IgE, IgA and memory B cells for future protection.

An enhanced immune response may include one or more of an enhanced TH1 immune response and a TH2 immune response.

A TH1 immune response may include one or more of an increase in CTLs, an increase in one or more of the cytokines associated with a TH1 immune response (such as IL-2, IFN-γ, and TNF-β), an increase in activated macrophages, an increase in NK activity, or an increase in the production of IgG2a. Preferably, the enhanced TH1 immune response will include an increase in IgG2a production.

A TH1 immune response may be elicited using a TH1 adjuvant. A TH1 adjuvant will generally elicit increased levels of IgG2a production relative to immunization of the antigen without adjuvant. TH1 adjuvants suitable for use in the invention may include for example saponin formulations, virosomes and virus like particles, non-toxic derivatives of enterobacterial lipopolysaccharide (LPS), immunostimulatory oligonucleotides. Immunostimulatory oligonucleotides, such as oligonucleotides containing a CpG motif, are preferred TH1 adjuvants for use in the invention.

A TH2 immune response may include one or more of an increase in one or more of the cytokines associated with a TH2 immune response (such as IL-4, IL-5, IL-6 and IL-10), or an increase in the production of IgG1, IgE, IgA and memory B cells. Preferably, the enhanced TH2 immune response will include an increase in IgG1 production.

A TH2 immune response may be elicited using a TH2 adjuvant. A TH2 adjuvant will generally elicit increased levels of IgG1 production relative to immunization of the antigen without adjuvant. TH2 adjuvants suitable for use in the invention include, for example, mineral containing compositions, oil-emulsions, and ADP-ribosylating toxins and detoxified derivatives thereof. Mineral containing compositions, such as aluminium salts are preferred TH2 adjuvants for use in the invention.

Preferably, the invention includes a composition comprising a combination of a TH1 adjuvant and a TH2 adjuvant. Preferably, such a composition elicits an enhanced TH1 and an enhanced TH2 response, i.e., an increase in the production of both IgG1 and IgG2a production relative to immunization without an adjuvant. Still more preferably, the composition comprising a combination of a TH1 and a TH2 adjuvant elicits an increased TH1 and/or an increased TH2 immune response relative to immunization with a single adjuvant (i.e., relative to immunization with a TH1 adjuvant alone or immunization with a TH2 adjuvant alone).

The immune response may be one or both of a TH1 immune response and a TH2 response. Preferably, immune response provides for one or both of an enhanced TH1 response and an enhanced TH2 response.

The enhanced immune response may be one or both of a systemic and a mucosal immune response. Preferably, the immune response provides for one or both of an enhanced systemic and an enhanced mucosal immune response. Preferably the mucosal immune response is a TH2 immune response. Preferably, the mucosal immune response includes an increase in the production of IgA.

E. coli can cause disease at a number of anatomical locations [4] and so the compositions of the invention may be prepared in various forms. For example, the compositions may be prepared as injectables, either as liquid solutions or suspensions. Solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared (e.g. a lyophilised composition or a spray-freeze dried composition). The composition may be prepared for topical administration e.g. as an ointment, cream or powder. The composition may be prepared for oral administration e.g. as a tablet or capsule, as a spray, or as a syrup (optionally flavoured). The composition may be prepared for pulmonary administration e.g. as an inhaler, using a fine powder or a spray. The composition may be prepared as a suppository or pessary. The composition may be prepared for nasal, aural or ocular administration e.g. as drops. The composition may be in kit form, designed such that a combined composition is reconstituted just prior to administration to a patient. Such kits may comprise one or more antigens in liquid form and one or more lyophilised antigens.

Where a composition is to be prepared extemporaneously prior to use (e.g. where a component is presented in lyophilised form) and is presented as a kit, the kit may comprise two vials, or it may comprise one ready-filled syringe and one vial, with the contents of the syringe being used to reactivate the contents of the vial prior to injection.

Immunogenic compositions used as vaccines comprise an immunologically effective amount of antigen(s), as well as any other components, as needed. By ‘immunologically effective amount’, it is meant that the administration of that amount to an individual, either in a single dose or as part of a series, is effective for treatment or prevention. This amount varies depending upon the health and physical condition of the individual to be treated, age, the taxonomic group of individual to be treated (e.g. non-human primate, primate, etc.), the capacity of the individual's immune system to synthesise antibodies, the degree of protection desired, the formulation of the vaccine, the treating doctor's assessment of the medical situation, and other relevant factors. It is expected that the amount will fall in a relatively broad range that can be determined through routine trials.

Methods of Treatment, and Administration of the Vaccine

The invention also provides a method for raising an immune response in a mammal comprising the step of administering an effective amount of a composition of the invention. The immune response is preferably protective and preferably involves antibodies and/or cell-mediated immunity. The method may raise a booster response.

The invention also provides a polypeptide of the invention for use as a medicament e.g. for use in raising an immune response in a mammal.

The invention also provides the use of a polypeptide of the invention in the manufacture of a medicament for raising an immune response in a mammal.

The invention also provides a delivery device pre-filled with an immunogenic composition of the invention.

By raising an immune response in the mammal by these uses and methods, the mammal can be protected against E. coli infection, including ExPEC and non-ExPEC strains. The invention is particularly useful for providing broad protection against pathogenic E. coli, including intestinal pathotypes such as EPEC, EAEC, EIEC, ETEC and DAEC pathotypes. Thus the mammal may be protected against diseases including, but not limited to peritonitis, pyelonephritis, cystitis, endocarditis, prostatitis, urinary tract infections (UTIs), meningitis (particularly neonatal meningitis), sepsis (or SIRS), dehydration, pneumonia, diarrhea (infantile, travellers', acute, persistent, etc.), bacillary dysentery, hemolytic uremic syndrome (HUS), pericarditis, bacteriuria, etc.

SEQ ID NO: 21, 30, 35, 40, 49, 54, 59, 68, and 73 and their other detoxified variants are particularly useful for immunising against the EAEC pathotype, and thus for preventing diarrhea (both acute and chronic).

SEQ ID NO: 22, 28, 36, 41, 47, 55, 56, 60, 66, 74, and 75 and their other detoxified variants are particularly useful for immunising against the UPEC pathotype, and thus for preventing UTIs including, but not limited to, pyelonephritis, cystitis (both acute and recurrent), peritonitis, catheter-associated UTIs, prostatisis, and bacteriuria (including asymptomatic bacteriuria).

SEQ ID NO: 23, 42, and 61 and their other detoxified variants are particularly useful for immunising against the EIEC pathotype, and thus for preventing dysentery (in particular bacillary dysentery) and HUS (e.g. in children).

SEQ ID NO: 24, 27, 29, 43, 46, 48, 62, 65, and 67 and their other detoxified variants are particularly useful for immunising against the ETEC pathotype, and thus for preventing diarrhea (including travellers' and infant diarrhea).

SEQ ID NO: 25, 26, 33, 34, 45, 53, 63, 64, and 72 and their other detoxified variants are particularly useful for immunising against the EAEC pathotype, and thus for preventing diarrhea (both acute and chronic).

SEQ ID NO: 79, 85, 93, and 94 and their other detoxified variants are particularly useful for immunising against the UPEC pathotype, and thus for preventing UTIs including, but not limited to, pyelonephritis, cystitis (both acute and recurrent), peritonitis, catheter-associated UTIs, prostatisis, and bacteriuria (including asymptomatic bacteriuria).

SEQ ID NO: 80 and their other detoxified variants are particularly useful for immunising against the EIEC pathotype, and thus for preventing dysentery (in particular bacillary dysentery) and HUS (e.g. in children).

SEQ ID NO: 81, 84, and 86 and their other detoxified variants are particularly useful for immunising against the ETEC pathotype, and thus for preventing diarrhea (including travellers' and infant diarrhea).

SEQ ID NOs: 82, 83, and 91 and their other detoxified variants are particularly useful for immunising against the EPEC pathotype, and thus for preventing diarrhea (including infantile diarrhea).

SEQ ID NO: 21, 30, 35, 40, 49, 54, 59, 68, and 73 and their other variants are particularly useful for immunising against the EAEC pathotype, and thus for preventing diarrhea (both acute and chronic).

SEQ ID NO: 22, 28, 36, 41, 47, 55, 56, 60, 66, 74, and 75 and their other variants are particularly useful for immunising against the UPEC pathotype, and thus for preventing UTIs including, but not limited to, pyelonephritis, cystitis (both acute and recurrent), peritonitis, catheter-associated UTIs, prostatisis, and bacteriuria (including asymptomatic bacteriuria).

SEQ ID NO: 23, 42, and 61 and their other variants are particularly useful for immunising against the EIEC pathotype, and thus for preventing dysentery (in particular bacillary dysentery) and HUS (e.g. in children).

SEQ ID NO: 24, 27, 29, 43, 46, 48, 62, 65, and 67 and their other variants are particularly useful for immunising against the ETEC pathotype, and thus for preventing diarrhea (including travellers' and infant diarrhea).

SEQ ID NO: 25, 26, 33, 34, 45, 53, 63, 64, and 72 and their other variants are particularly useful for immunising against the EAEC pathotype, and thus for preventing diarrhea (both acute and chronic).

SEQ ID NO: 79, 85, 93, and 94 and their other are particularly useful for immunising against the UPEC pathotype, and thus for preventing UTIs including, but not limited to, pyelonephritis, cystitis (both acute and recurrent), peritonitis, catheter-associated UTIs, prostatisis, and bacteriuria (including asymptomatic bacteriuria).

SEQ ID NO: 80 and their other variants are particularly useful for immunising against the EIEC pathotype, and thus for preventing dysentery (in particular bacillary dysentery) and HUS (e.g. in children).

SEQ ID NO: 81, 84, and 86 and their other variants are particularly useful for immunising against the ETEC pathotype, and thus for preventing diarrhea (including travellers' and infant diarrhea).

SEQ ID NOs: 82, 83, and 91 and their other variants are particularly useful for immunising against the EPEC pathotype, and thus for preventing diarrhea (including infantile diarrhea).

The mammal is preferably a human, but may be e.g. a cow, a pig, a chicken, a cat or a dog, as E. coli disease is also problematic in these species [4]. Where the vaccine is for prophylactic use, the human is preferably a child (e.g. a toddler or infant) or a teenager; where the vaccine is for therapeutic use, the human is preferably a teenager or an adult. A vaccine intended for children may also be administered to adults e.g. to assess safety, dosage, immunogenicity, etc.

One way of checking efficacy of therapeutic treatment involves monitoring E. coli infection after administration of the compositions of the invention. One way of checking efficacy of prophylactic treatment involves monitoring immune responses, systemically (such as monitoring the level of IgG1 and IgG2a production) and/or mucosally (such as monitoring the level of IgA production), against the antigens in the compositions of the invention after administration of the composition. Typically, antigen-specific serum antibody responses are determined post-immunisation but pre-challenge whereas antigen-specific mucosal antibody responses are determined post-immunisation and post-challenge.

Another way of assessing the immunogenicity of the compositions of the present invention is to express the proteins recombinantly for screening patient sera or mucosal secretions by immunoblot and/or microarrays. A positive reaction between the protein and the patient sample indicates that the patient has mounted an immune response to the protein in question. This method may also be used to identify immunodominant antigens and/or epitopes within antigens.

The efficacy of vaccine compositions can also be determined in vivo by challenging animal models of E. coli infection, e.g., guinea pigs or mice, with the vaccine compositions. A murine model of ExPEC and lethal sepsis is described in reference 152. A cotton rat model is disclosed in ref. 153

Compositions of the invention will generally be administered directly to a patient. Direct delivery may be accomplished by parenteral injection (e.g. subcutaneously, intraperitoneally, intravenously, intramuscularly, or to the interstitial space of a tissue), or mucosally, such as by rectal, oral (e.g. tablet, spray), vaginal, topical, transdermal or transcutaneous, intranasal, ocular, aural, pulmonary or other mucosal administration. Novel direct delivery forms can also include transgenic expression of the polypeptides disclosed herein in foods, e.g., transgenic expression in a potato.

The invention may be used to elicit systemic and/or mucosal immunity, preferably to elicit an enhanced systemic and/or mucosal immunity.

Preferably the enhanced systemic and/or mucosal immunity is reflected in an enhanced TH1 and/or TH2 immune response. Preferably, the enhanced immune response includes an increase in the production of IgG1 and/or IgG2a and/or IgA.

Dosage can be by a single dose schedule or a multiple dose schedule. Multiple doses may be used in a primary immunisation schedule and/or in a booster immunisation schedule. In a multiple dose schedule the various doses may be given by the same or different routes e.g. a parenteral prime and mucosal boost, a mucosal prime and parenteral boost, etc. Multiple doses will typically be administered at least 1 week apart (e.g. about 2 weeks, about 3 weeks, about 4 weeks, about 6 weeks, about 8 weeks, about 10 weeks, about 12 weeks, about 16 weeks, etc.).

Vaccines of the invention may be used to treat both children and adults. Thus a human patient may be less than 1 year old, 1-5 years old, 5-15 years old, 15-55 years old, or at least 55 years old. Preferred patients for receiving the vaccines are the elderly (e.g. ≥50 years old, ≥60 years old, and preferably ≥65 years), the young (e.g. ≤5 years old), hospitalised patients, healthcare workers, armed service and military personnel, pregnant women, the chronically ill, or immunodeficient patients. The vaccines are not suitable solely for these groups, however, and may be used more generally in a population.

Vaccines of the invention are particularly useful for patients who are expecting a surgical operation, or other hospital in-patients. They are also useful in patients who will be catheterized. They are also useful in adolescent females (e.g. aged 11-18) and in patients with chronic urinary tract infections.

Vaccines of the invention may be administered to patients at substantially the same time as (e.g. during the same medical consultation or visit to a healthcare professional or vaccination centre) other vaccines e.g. at substantially the same time as a measles vaccine, a mumps vaccine, a rubella vaccine, a MMR vaccine, a varicella vaccine, a MMRV vaccine, a diphtheria vaccine, a tetanus vaccine, a pertussis vaccine, a DTP vaccine, a conjugated H. influenzae type b vaccine, an inactivated poliovirus vaccine, a hepatitis 13 virus vaccine, a meningococcal conjugate vaccine (such as a tetravalent A-C-W135-Y vaccine), a respiratory syncytial virus vaccine, etc.

Nucleic Acid Immunisation

The immunogenic compositions described above include polypeptide antigens. In all cases, however, the polypeptide antigens can be replaced by nucleic acids (typically DNA) encoding those polypeptides, to give compositions, methods and uses based on nucleic acid immunisation. Nucleic acid immunisation is now a developed field (e.g. see references 154 to 161 etc.).

The nucleic acid encoding the immunogen is expressed in vivo after delivery to a patient and the expressed immunogen then stimulates the immune system. The active ingredient will typically take the form of a nucleic acid vector comprising: (i) a promoter; (ii) a sequence encoding the immunogen, operably linked to the promoter; and optionally (iii) a selectable marker. Preferred vectors may further comprise (iv) an origin of replication; and (v) a transcription terminator downstream of and operably linked to (ii). In general, (i) & (v) will be eukaryotic and (iii) & (iv) will be prokaryotic.

Preferred promoters are viral promoters e.g. from cytomegalovirus (CMV). The vector may also include transcriptional regulatory sequences (e.g. enhancers) in addition to the promoter and which interact functionally with the promoter. Preferred vectors include the immediate-early CMV enhancer/promoter, and more preferred vectors also include CMV intron A. The promoter is operably linked to a downstream sequence encoding an immunogen, such that expression of the immunogen-encoding sequence is under the promoter's control.

Where a marker is used, it preferably functions in a microbial host (e.g. in a prokaryote, in a bacteria, in a yeast). The marker is preferably a prokaryotic selectable marker (e.g. transcribed under the control of a prokaryotic promoter). For convenience, typical markers are antibiotic resistance genes.

The vector of the invention is preferably an autonomously replicating episomal or extrachromosomal vector, such as a plasmid.

The vector of the invention preferably comprises an origin of replication. It is preferred that the origin of replication is active in prokaryotes but not in eukaryotes.

Preferred vectors thus include a prokaryotic marker for selection of the vector, a prokaryotic origin of replication, but a eukaryotic promoter for driving transcription of the immunogen-encoding sequence. The vectors will therefore (a) be amplified and selected in prokaryotic hosts without polypeptide expression, but (b) be expressed in eukaryotic hosts without being amplified. This arrangement is ideal for nucleic acid immunization vectors.

The vector of the invention may comprise a eukaryotic transcriptional terminator sequence downstream of the coding sequence. This can enhance transcription levels. Where the coding sequence does not have its own, the vector of the invention preferably comprises a polyadenylation sequence. A preferred polyadenylation sequence is from bovine growth hormone.

The vector of the invention may comprise a multiple cloning site

In addition to sequences encoding the immunogen and a marker, the vector may comprise a second eukaryotic coding sequence. The vector may also comprise an IRES upstream of said second sequence in order to permit translation of a second eukaryotic polypeptide from the same transcript as the immunogen. Alternatively, the immunogen-coding sequence may be downstream of an IRES.

The vector of the invention may comprise unmethylated CpG motifs e.g. unmethylated DNA sequences which have in common a cytosine preceding a guanosine, flanked by two 5′ purines and two 3′ pyrimidines. In their unmethylated form these DNA motifs have been demonstrated to be potent stimulators of several types of immune cell.

Vectors may be delivered in a targeted way. Receptor-mediated DNA delivery techniques are described in, for example, references 162 to 167. Therapeutic compositions containing a nucleic acid are administered in a range of about 100 ng to about 200 mg of DNA for local administration in a gene therapy protocol. Concentration ranges of about 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg of DNA can also be used during a gene therapy protocol. Factors such as method of action (e.g. for enhancing or inhibiting levels of the encoded gene product) and efficacy of transformation and expression are considerations which will affect the dosage required for ultimate efficacy. Where greater expression is desired over a larger area of tissue, larger amounts of vector or the same amounts re-administered in a successive protocol of administrations, or several administrations to different adjacent or close tissue portions may be required to effect a positive therapeutic outcome. In all cases, routine experimentation in clinical trials will determine specific ranges for optimal therapeutic effect.

Vectors can be delivered using gene delivery vehicles. The gene delivery vehicle can be of viral or non-viral origin (see generally references 168 to 171).

Viral-based vectors for delivery of a desired nucleic acid and expression in a desired cell are well known in the art. Exemplary viral-based vehicles include, but are not limited to, recombinant retroviruses (e.g. references 172 to 182), alphavirus-based vectors (e.g. Sindbis virus vectors, Semliki forest virus (ATCC VR-67; ATCC VR-1247), Ross River virus (ATCC VR-373; ATCC VR-1246) and Venezuelan equine encephalitis virus (ATCC VR-923; ATCC VR-1250; ATCC VR 1249; ATCC VR-532); hybrids or chimeras of these viruses may also be used), poxvirus vectors (e.g. vaccinia, fowlpox, canarypox, modified vaccinia Ankara, etc.), adenovirus vectors, and adeno-associated virus (AAV) vectors (e.g. see refs. 183 to 188). Administration of DNA linked to killed adenovirus [189] can also be employed.

Non-viral delivery vehicles and methods can also be employed, including, but not limited to, polycationic condensed DNA linked or unlinked to killed adenovirus alone [e.g. 189], ligand-linked DNA [190], eukaryotic cell delivery vehicles cells [e.g. refs. 191 to 195] and nucleic charge neutralization or fusion with cell membranes. Naked DNA can also be employed. Exemplary naked DNA introduction methods are described in refs. 196 and 197. Liposomes (e.g. immunoliposomes) that can act as gene delivery vehicles are described in refs. 198 to 202. Additional approaches are described in references 203 & 204.

Further non-viral delivery suitable for use includes mechanical delivery systems such as the approach described in ref. 204. Moreover, the coding sequence and the product of expression of such can be delivered through deposition of photopolymerized hydrogel materials or use of ionizing radiation [e.g. refs. 205 & 206]. Other conventional methods for gene delivery that can be used for delivery of the coding sequence include, for example, use of hand-held gene transfer particle gun [207] or use of ionizing radiation for activating transferred genes [205 & 206].

Delivery DNA using PLG {poly(lactide-co-glycolide)} microparticles is a particularly preferred method e.g. by adsorption to the microparticles, which are optionally treated to have a negatively-charged surface (e.g. treated with SDS) or a positively-charged surface (e.g. treated with a cationic detergent, such as CTAB).

General

The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, molecular biology, immunology and pharmacology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., references 208-215, etc.

The term “comprising” encompasses “including” as well as “consisting” e.g. a composition “comprising” X may consist exclusively of X or may include something additional e.g. X+Y.

The term “about” in relation to a numerical value x means, for example, x±10%.

“GI” numbering is used herein. A GI number, or “GenInfo Identifier”, is a series of digits assigned consecutively to each sequence record processed by NCBI when sequences are added to its databases. The GI number bears no resemblance to the accession number of the sequence record. When a sequence is updated (e.g. for correction, or to add more annotation or information) then it receives a new GI number. Thus the sequence associated with a given GI number is never changed.

References to a percentage sequence identity between two amino acid sequences means that, when aligned, that percentage of amino acids are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in section 7.7.18 of ref. 216. A preferred alignment is determined by the Smith-Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2, BLOSUM matrix of 62. The Smith-Waterman homology search algorithm is disclosed in ref. 217.

One of skill in the art would understand that “isolated” means altered “by the hand of man” from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living organism is not “isolated” when in such living organism, but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated,” as the term is used in this disclosure. Further, a polynucleotide or polypeptide that is introduced into an organism by transformation, genetic manipulation or by any other recombinant method would be understood to be “isolated” even if it is still present in said organism, which organism may be living or non-living, except where such transformation, genetic manipulation or other recombinant method produces an organism that is otherwise indistinguishable from the naturally occurring organism.

BRIEF DESCRIPTION OF DRAWINGS

FIG. 1A-FIG. 1K shows a CLUSTALW alignment of SEQ ID NOs: 2 to 16. Different portions of the alignment are shown in FIG. 1A, FIG. 1B, FIG. 1C, FIG. 1D, FIG. 1E, FIG. 1F, FIG. 1G, FIG. 1H, FIG. 1I, FIG. 1J, and FIG. 1K. The N-terminal regions that may be removed to increase solubility while maintaining substantially the same immunogenicity are shown at the bottom of the alignment. The N-terminal region up to the gly-ser linker or gly-ser region is denoted with “G” and the proline-rich region is denoted with “P.”

FIG. 2 shows the amino acid identity between pairs of sequences.

FIG. 3 shows gel analysis of purified protein, with high MW bands visible in the absence of DTT.

FIG. 4A-FIG. 4B shows the Western Blot of pathogenic and non pathogenic E. coli strains using an anti-AcfD (orf3526) serum. FIG. 4A is a Western Blot of the total cell lysate. FIG. 4B is a Western Blot of the supernatant from the culture. The lanes in each of FIG. 4A and FIG. 4B from left to right are as follows: Lane M marker proteins with the molecular weight in kDa of each marker protein shown along the left side of FIG. 4A; 1—IHE3034; 2—CFT073; 3—536; 4—BL21; 5—MG 1655; 6—W3110; 7—NISSLE1917; 8—IHE3034ΔAcfD. As observed from the analysis, pathogenic strains (IHE3034, lane 1; 536, lane 3) express and secrete AcfD (orf3526) while non-pathogenic strains (MG1655, lane 5; W3110, lane 6; Nissle 1917, lane 7) express the protein but its secretion is defective. Strains CFT073 (lane 2) and IHE3034ΔAcfD (lane 8) are used as negative control, since they don't harbor the AcfD (orf3526) gene. BL21 strain (lane 4) is a lab strain used as positive control, since it expresses and secretes AcfD (orf3526).

FIG. 5A-FIG. 5B shows a comparison of solubility of the AcfD (orf3526) protein and various fragments of the protein. FIG. 5A is an SDS-PAGE gradient gel (4-12% MOPS buffer) of samples at 37° C. comparing the pellet (left lane for each protein or fragment) to the supernatant (right lane for each protein or fragment. The lanes from left to right are: Molecular weight markers (191 kDa, 97 kDa and 64 kDa bands are labelled), control bacteria transformed with the pET expression vector with no insert, bacterial expression of 3526 (his tag, leader peptide removed), bacterial expression of L3526 (his tag, full length), bacterial expression of L3526-2stop (full length with a stop codon before His tag), bacterial expression of ΔG3526 (his tag, removal of the N-terminus of AcfD (orf3526) to the flexible glycine-serine linker), and bacterial expression of ΔP3526 (his tag+removal of the N-terminus of AcfD (orf3526) through the proline rich region). FIG. 5B is an SDS-PAGE gradient gel (4-12% MOPS buffer) of samples at 25° C. following the same order for the lanes as FIG. 5A.

FIG. 6A-FIG. 6C shows a comparison of expression and purification of the AcfD (orf3526) protein and various fragments of the protein. FIG. 6A is an SDS-PAGE gel (12% MOPS buffer) of samples at from bacteria expressing 3526 (his tag, leader peptide removed), cultured at 25° C. comparing fractions from various stages of the purification. The lanes from left to right are: M: Molecular weight markers (191 kDa, 97 kDa and 64 kDa bands are labelled), TOT: total bacterial lysate, INS: insoluble fraction of bacterial lysate, SM: soluble fraction of bacterial lysate, FT: flow through from Nickel column; E1, E2, and E3 three elutions with 500 mM imidazole buffer. FIG. 6B is an SDS-PAGE gel (12% MOPS buffer) of samples at from bacteria expressing ΔG3526 (his tag, removal of the N-terminus of AcfD (orf3526) to the flexible glycine-serine linker) cultured at 25° C. comparing fractions from various stages of the purification. The lanes from left to right are: M: Molecular weight markers (191 kDa, 97 kDa and 64 kDa bands are labelled), TOT: total bacterial lysate, INS: insoluble fraction of bacterial lysate, SM: soluble fraction of bacterial lysate, FT: flow through from Nickel column; E1, E2, and E3 three elutions with 500 mM imidazole buffer. FIG. 6C is an SDS-PAGE gel (12% MOPS buffer) of samples from bacteria expressing ΔP3526 (his tag, removal of the N-terminus of AcfD (orf3526) through the proline rich region), cultured at 25° C. comparing fractions from various stages of the purification. The lanes from left to right are: M: Molecular weight markers (191 kDa, 97 kDa and 64 kDa bands are labelled), TOT: total bacterial lysate, INS: insoluble fraction of bacterial lysate, SM: soluble fraction of bacterial lysate, FT: flow through from Nickel column; E1, E2, and E3 three elutions with 500 mM imidazole buffer.

FIG. 7 shows the amino acid identity between additional pairs of sequences. Sixteen Enterohemorrhagic E. coli (EHEC) were not found to have AcfD (orf3526) gene (not shown). The sequences (where represented) from left to right or top to bottom are as follows: 10 non-pathogenic or commensal strains (1: a commensal E. coli strain, 2: DH10B strain, 3: MG1655 strain, 4: W3110 strain (SEQ ID NO:14); 5: HS strain (SEQ ID NO:13); 9: another commensal E. coli strain; and 10: yet another commensal E. coli strain); three NMEC strains (1: NMEC strain RS218; 2: NMEC strain IHE3034 (SEQ ID NO:2); and 3: NMEC strain S88 (SEQ ID NO:141)); one APEC strain (1: APEC 01 strain); six UPEC strains (2: UPEC strain 536 (SEQ ID NO:4); 3: UTI89; 4: UPEC strain F11 (SEQ ID NO:10); 5: UPEC strain IAI39 (SEQ ID NO:133); and 6: UPEC strain UMN026 (SEQ ID NO:137)); three EAEC strains (1: EAEC strain 101-1 (SEQ ID NO:3); 2: EAEC strain O42 (SEQ ID NO:12; and 3: EAEC strain 55989 (SEQ ID NO:129)); one EIEC strain (1: EIEC strain 53638 (SEQ ID NO:5)); four EPEC strains (2: EPEC strain E22 (SEQ ID NO: 8)); 3: EPEC strain E2348/69 (SEQ ID NO:16); and 4: EPEC strain E110019 (SEQ ID NO:7)); three ETEC strains (1: ETEC strain B7A (SEQ ID NO:6); 2: ETEC strain E24377A (SEQ ID NO:9); and 3: ETEC strain H10407 (SEQ ID NO:11)); and one antibiotic resistant strain (1: antibiotic-resistant strain SECEC (SEQ ID NO:15)).

FIG. 8 shows the sequence motifs identified in AcfD (orf3526) including from left to right: a lipidation motif; a proline rich region, a WxxxE motif, a zinc binding motif, and an RGD domain.

FIG. 9 shows the family relationships of the various zinc metalloproteases. The zincins are highlighted with a grey box as the zincin motif is the motif found in AcfD (orf3526) (See FIG. 8). (DD-Carboxypeptidase (SEQ ID NO: 112), Carboxypeptidases (SEQ ID NO: 113), Zincins (SEQ ID NO: 114), Inverzincins (SEQ ID NO: 115), Thermolysin family (SEQ ID NO: 116), Endopeptidase-24.11 family (SEQ ID NO: 117), Angiotensin converting enzyme family (SEQ ID NO: 118), Aminopeptidase family (SEQ ID NO: 119), Neurotoxin family (SEQ ID NO: 120), Endopeptidase-24.15 family (SEQ ID NO: 121), Metzincins (SEQ ID NO: 122), Serralysin family (SEQ ID NO: 123), Astacin family (SEQ ID NO: 124), Reprolysin family (SEQ ID NO: 125), Matrixin family (SEQ ID NO: 126)).

FIG. 10 shows an SDS-PAGE (4-12% gradient, Bis-Tris) of orf3526C expression. The lanes are labelled across the top as follows: (1) Total cell lysate—no IPTG, 6 hours at 25° C.; (2) Total cell lysate—1 mM IPTG, 3 hours at 25° C.; (3) Total cell lysate—1 mM IPTG, 6 hours at 25° C.; (M) Markers (sizes are indicated in kDa along the left side of the gel); (4) soluble fraction after sonication—1 mM IPTG, 3 hours at 25° C.; and (5) soluble fraction after sonication—1 mM IPTG, 6 hours at 25° C.

BRIEF DESCRIPTION OF SEQUENCE LISTING


SEQ
ID
Description
SEQ ID NOs: 1-19 = full length amino acid sequences
1
Amino acid sequence from NMEC strain IHE3034
2
Amino acid sequence from EAEC strain 101-1
(GI: 83587587)
3
Amino acid sequence from UPEC strain 536
(GI: 110643204)
4
Amino acid sequence from EIEC strain 53638
(GI: 75515237)
5
Amino acid sequence from ETEC strain B7A
(GI: 75227618)
6
Amino acid sequence from EPEC strain E110019
(GI: 75239450)
7
Amino acid sequence from EPEC strain E22
(GI: 75259912)
8
Amino acid sequence from ETEC strain E24377A
(GI: 157156747)
9
Amino acid sequence from UPEC strain F11
(GI: 75241179)
10
Amino acid sequence from ETEC strain H10407
11
Amino acid sequence from EAEC strain O42
12
Amino acid sequence from commensal strain HS
(GI: 157162442)
13
Amino acid sequence from commensal strain W3110
(GI: 89109748)
14
Amino acid sequence from antibiotic-resistant strain
SECEC
15
Amino acid sequence from EPEC strain E2348/69
16
Amino acid sequence from EAEC strain 55989
17
Amino acid sequence from UPEC strain IAI39
18
Amino acid sequence from UPEC strain UMN026
19
Amino acid sequence from NMEC strain S88
SEQ ID NOs: 20-38 = C-terminal deletion
amino acid sequences
20
Amino acid sequence from NMEC strain IHE3034 with
C-terminal deletion
21
Amino acid sequence from EAEC strain 101-1
(GI: 83587587) with C-terminal deletion
22
Amino acid sequence from UPEC strain 536
(GI: 110643204) with C-terminal deletion
23
Amino acid sequence from EIEC strain 53638
(GI: 75515237) with C-terminal deletion
24
Amino acid sequence from ETEC strain B7A
(GI: 75227618) with C-terminal deletion
25
Amino acid sequence from EPEC strain E110019
(GI: 75239450) with C-terminal deletion
26
Amino acid sequence from EPEC strain E22
(GI: 75259912) with C-terminal deletion
27
Amino acid sequence from ETEC strain E24377A
(GI: 157156747) with C-terminal deletion
28
Amino acid sequence from UPEC strain F11
(GI: 75241179) with C-terminal deletion
29
Amino acid sequence from ETEC strain H10407 with
C-terminal deletion
30
Amino acid sequence from EAEC strain O42 with
C-terminal deletion
31
Amino acid sequence from commensal strain HS
(GI: 157162442) with C-terminal deletion
32
Amino acid sequence from commensal strain W3110
(GI: 89109748) with C-terminal deletion
33
Amino acid sequence from antibiotic-resistant strain
SECEC with C-terminal deletion
34
Amino acid sequence from EPEC strain E2348/69 with
C-terminal deletion
35
Amino acid sequence from EAEC strain 55989 with
C-terminal deletion
36
Amino acid sequence from UPEC strain IAI39 with
C-terminal deletion
37
Amino acid sequence from UPEC strain UMN026 with
C-terminal deletion
38
Amino acid sequence from NMEC strain S88 with
C-terminal deletion
SEQ ID NOs: 39-57 = N-terminal deletion
amino acid sequences
39
Amino acid sequence from NMEC strain IHE3034 with
N-terminal deletion
40
Amino acid sequence from EAEC strain 101-1
(GI: 83587587) with N-terminal deletion
41
Amino acid sequence from UPEC strain 536
(GI: 110643204) with N-terminal deletion
42
Amino acid sequence from EIEC strain 53638
(GI: 75515237) with N-terminal deletion
43
Amino acid sequence from ETEC strain B7A
(GI: 75227618) with N-terminal deletion
44
Amino acid sequence from EPEC strain E110019
(GI: 75239450) with N-terminal deletion
45
Amino acid sequence from EPEC strain E22
(GI: 75259912) with N-terminal deletion
46
Amino acid sequence from ETEC strain E24377A (GI:
157156747) with N-terminal deletion
47
Amino acid sequence from UPEC strain F11
(GI: 75241179) with N-terminal deletion
48
Amino acid sequence from ETEC strain H10407 with
N-terminal deletion
49
Amino acid sequence from EAEC strain O42 with
N-terminal deletion
50
AMino acid sequence from commensal strain HS
(GI: 157162442) with N-terminal deletion
51
Amino acid sequence from commensal strain W3110
(GI: 89109748) with N-terminal deletion
52
Amino acid sequence from antibiotic-resistant strain
SECEC with N-terminal deletion
53
Amino acid sequence from EPEC strain E2348/69 with
N-terminal deletion
54
Amino acid sequence from EAEC strain 55989 with
N-terminal deletion
55
Amino acid sequence from UPEC strain IAI39 with
N-terminal deletion
56
Amino acid sequence from UPEC strain UMN026 with
N-terminal deletion
57
Amino acid sequence from NMEC strain S88 with
N-terminal deletion
SEQ ID NOs: 58-76 = E1305A point mutation
amino acid sequences
58
Amino acid sequence from NMEC strain IHE3034
with an E1305A point mutation
59
Amino acid sequence from EAEC strain 101-1
(GI: 83587587) with an E1305A point mutation
60
Amino acid sequence from UPEC strain 536
(GI: 110643204) with an E1305A point mutation
61
Amino acid sequence from EIEC strain 53638
(GI: 75515237) with an E1305A point mutation
62
Amino acid sequence from ETEC strain B7A
(GI: 75227618) with an E1305A point mutation
63
Amino acid sequence from EPEC strain E110019
(GI: 75239450) with an E1305A point mutation
64
Amino acid sequence from EPEC strain E22
(GI: 75259912) with an E1305A point mutation
65
Amino acid sequence from ETEC strain E24377A (GI:
157156747) with an E1305A point mutation
66
Amino acid sequence from UPEC strain F11
(GI: 75241179) with an E1305A point mutation
67
Amino acid sequence from ETEC strain H10407 with
an E1305A point mutation
68
Amino acid sequence from EAEC strain O42 with an
E1305A point mutation
69
Amino acid sequence from commensal strain HS
(GI: 157162442) with an E1305A point mutation
70
Amino acid sequence from commensal strain W3110
(GI: 89109748) with an E1305A point mutation
71
Amino acid sequence from antibiotic-resistant strain
SECEC with an E1305A point mutation
72
Amino acid sequence from EPEC strain E2348/69 with an
E1305A point mutation
73
Amino acid sequence from EAEC strain 55989 with an
E1305A point mutation
74
Amino acid sequence from UPEC strain IAI39 with an
E1305A point mutation
75
Amino acid sequence from UPEC strain UMN026 with an
E1305A point mutation
76
Amino acid sequence from NMEC strain S88 with an
E1305A point mutation
SEQ ID NOs: 77-95 = orf3526C fragment
amino acid sequences
77
Amino acid sequence from NMEC strain IHE3034 with
the N-terminal ΔG region and the C-terminal portion
including the zinc-binding motif deleted
78
Amino acid sequence from EAEC strain 101-1
(GI: 83587587) with the N-terminal ΔG region and the
C-terminal portion including the zinc-binding motif
deleted
79
Amino acid sequence from UPEC strain 536
(GI: 110643204) with the N-terminal ΔG region and the
C-terminal portion including the zinc-binding motif deleted
80
Amino acid sequence from EIEC strain 53638 (GI: 75515237)
with the N-terminal ΔG region and the C-terminal portion
including the zinc-binding motif deleted
81
Amino acid sequence from ETEC strain B7A (GI: 75227618)
with the N-terminal ΔG region and the C-terminal portion
including the zinc-binding motif deleted
82
Amino acid sequence from EPEC strain E110019
(GI: 75239450 with the N-terminal ΔG region and the
C-terminal portion including the zinc-binding motif deleted
83
Amino acid sequence from EPEC strain E22 (GI: 75259912)
with the N-terminal ΔG region and the C-terminal portion
including the zinc-binding motif deleted
84
Amino acid sequence from ETEC strain E24377A (GI:
157156747) with the N-terminal ΔG region and the C-terminal
portion including the zinc-binding motif deleted
85
Amino acid sequence from UPEC strain F11 (GI: 75241179)
with the N-terminal ΔG region and the C-terminal portion
including the zinc-binding motif deleted
86
Amino acid sequence from ETEC strain H10407 with the N-
terminal ΔG region and the C-terminal portion including the
zinc-binding motif deleted
87
Amino acid sequence from EAEC strain O42 with the
N-terminal ΔG region and the C-terminal portion including
the zinc-bindingmotif deleted
88
Amino acid sequence from commensal strain HS
(GI: 157162442) with the N-terminal ΔG region and the
C-terminal portion including the zinc-binding motif deleted
89
Amino acid sequence from commensal strain W3110 (GI:
89109748) with the N-terminal ΔG region and the C-terminal
portion including the zinc-binding motif deleted
90
Amino acid sequence from antibiotic-resistant strain SECEC
with the N-terminal ΔG region and the C-terminal portion
including the zinc-binding motif deleted
91
Amino acid sequence from EPEC strain E2348/69 with the N-
terminal ΔG region and the C-terminal portion including the
zinc-binding motif deleted
92
Amino acid sequence from EAEC strain 55989 with the N-
terminal ΔG region and the C-terminal portion including the
zinc-binding motif deleted
93
Amino acid sequence from UPEC strain IAI39 with the
N-terminal ΔG region and the C-terminal portion including
the zinc-binding motif deleted
94
Amino acid sequence from UPEC strain UMN026 with the N-
terminal ΔG region and the C-terminal portion including the
zinc-binding motif deleted
95
Amino acid sequence from NMEC strain S88 with the N-
terminal ΔG region and the C-terminal portion including the
zinc-binding motif deleted
96/97
Zinc binding motifs
 98-109
Primers
110-111
IC31 sequences

MODES FOR CARRYING OUT THE INVENTION

One of the antigens disclosed in reference 5 is annotated as accessory colonization factor D (AcfD) precursor (orf3526) (amino acid SEQ ID NO: 2 herein) from NMEC strain IHE3034. This protein has been expressed and purified, and it confers protection against ExPEC strains in a sepsis animal model.

Sequences were obtained for the orthologs in various other E. coli strains. The amino acid sequence seen in IHE3034 was also seen in strains APECO1 and UTI89, but 14 extra sequences were found (SEQ ID NOs: 3 to 16). FIG. 1 shows an alignment of SEQ ID NOs: 2 to 16. The 30 N-terminal amino acids are 100% conserved, and these include the signal peptide (aa 1-23) and the N-terminus cysteine of the native lipoprotein.

Some strains had a frameshift mutation in the AcfD (orf3526) gene, resulting in no expression of the polypeptide. The acfD gene was totally absent from strains CFT073, EDL933, Sakai and B171.

FIG. 2 shows the % identity between the amino acid sequences. The labels are SEQ ID NOs, except for MG1655, RS218, DH10B, APECO1 and UTI89 where the strain name is used. The lowest level of identity (boxed in FIG. 2) was 85.9%, between SEQ ID NOs: 2 and 4 (both ExPEC strains).

Example 1—Immunogenicity of the Full Length AcfD (Orf3526)

The AcfD (orf3526) sequence from strain IHE3034 was cloned and expressed from a plasmid as a recombinant His-tagged protein without a leader peptide, in an E. coli host. Protein was purified and analysed. Gel filtration showed a much higher molecular weight than predicted based solely on the amino acid sequence. Gel analysis in the absence of DTT, but not in its presence, shows higher molecular weight forms of the protein (FIG. 3). Thus the protein is likely to form oligomers.

Sera raised against AcfD (orf3526) were used in western blots against total cell lysates (FIG. 4(A)) or culture supernatants precipitated with 60% TCA (FIG. 4(B)). The sera recognised a ˜150 kDa protein in lysates from both pathogenic and commensal strains. They did not react with this band in lysates from CFT073 or from an AcfD (orf3526) knockout mutant of IHE3034. Reactivity with proteins in the supernatants indicates that the protein may be secreted.

CD1 mice (5 weeks old) were immunized sub-cutaneously using 20 μg of the antigen plus Freund's adjuvant (or other adjuvant as indicated below). The mice were inoculated at 0, 21, and 35 days. Fourteen days after the third inoculation, the mice were challenged with a lethal dose (LD80) of a pathogenic strain of E. coli. Blood was collected from the tail 24 hours after challenge to evaluate bacteremia. The mortality was monitored for four days post-challenge. The protection rate may be calculated as (% dead in control group (no immunization)−% dead in experimental group (immunized))/% dead in control group×100.


TABLE 1
Sepsis animal model
Survival with
Survival without
Candidates
vaccination (%)
vaccination (%)
P value
20 μg 3526/alum
64/78 (82)
9/80 (11)
0.0001

Thus, the AcfD precursor (orf3526) is an effective candidate for use as a vaccine or vaccine component.

To further demonstrate the utility of the AcfD precursor (orf3526) as a candidate for a vaccine or a vaccine component, the AcfD precursor (orf3526) was tested for its ability to provide cross protection against other pathogenic strains of E. coli using the animal sepsis model as indicated above. The results of these tests are indicated in Table 2 below (with the results from Table 1 included for comparison purposes).


TABLE 2
20 μg 3526/alum
Sepsis animal model
Challenge Strain
Survival with
(percent identity
vaccination
Survival without
to IHE3034)
(%)
vaccination (%)
P value
IHE3034
(100)
64/78 (82) 
9/80 (11)
0.0001
9855/93
(87)
9/16 (56) 
4/15 (26)
0.14
BK658
(98)
4/8 (50)
  1/8 (12.5)
0.28
B616
(100C)
6/8 (78)
0/8 (0)
0.007
536
(86)
6/7 (85)
  3/8 (37.5)
0.11

Thus, the AcfD precursor (orf3526) is an effective candidate for use as a vaccine or vaccine component not just against the strain from which the protein was derived, but also against related strains, thus increasing the utility. Based upon the similarity between the response to the AcfD precursor (orf3526) and the response to the three immunogenic fragments tested below (3526A, 3526B, and 3526C), one would expect that these three fragments would provide similar cross protection as well.

Example 2—Fragments of AcfD (Orf3526) with Increased Solubility

Unexpectedly, AcfD (orf3526) protein displayed low solubility even though the protein is a secreted protein. As shown in FIG. 5(B), removal of the N-terminus of AcfD (orf3526) through the gly-ser linker or gly-ser region significantly increased solubility when expressed at 25° C. (See pK1-ΔG3526 FIG. 5(B)). Similarly removal of the N-terminus of AcfD (orf3526) through the proline rich region significantly increased solubility when expressed at 25° C. (See pK1-ΔP3526 FIG. 5(B)).

To confirm that both fragments had substantially the same immunogenicity as the full length AcfD (orf3526), the fragments were purified. The purified fragments were used in three immunization experiments in mice, adjuvanted with Freund's complete adjuvant. Immunized mice were then challenged with a sublethal dose of E. coli. Immunization with AcfD (orf3526) with the N-terminus through the gly-ser linker or gly-ser region removed protected 100% of the mice from death, whereas death occurred in 90% of the animals in the non-immunized control group. Immunization with AcfD (orf3526) with the N-terminus through the proline rich region removed protected 90% of the mice from death, whereas death occurred in 90% of the animals in the non-immunized control group.

Expression and Purification

Bacteria with one of the three constructs expressing his-tagged variants of AcfD (orf3526) were cultured in 30 ml of medium and induced to express the AcfD (orf3526) variant at 25° C. (AcfD (orf3526) without the leader peptide (3526), AcfD (orf3526) with the N-terminus removed through the gly-ser linker or gly-ser region (ΔG3526), and AcfD (orf3526) with the N-terminus removed through the proline rich region (ΔP3526). The bacteria were harvested and lysed by sonication. The soluble fractions were isolated and loaded on an IMAC column. The column was washed three times with 20 mM imidazole buffer. The AcfD (orf3526) variants were then eluted with three washes of 500 mM imidazole buffer. As shown in FIG. 6, removal of the N-terminus of AcfD (orf3526) through the gly-ser linker or gly-ser region significantly increased solubility and yield of purified protein. The yield obtained was estimated by Bradford assay to be as follows: 0.18 mg of 3526 and 2.34 mg ΔG3526.

Example 3—AcfD (Orf3526) Mutants with Reduced Toxicity

A zinc binding motif was identified in the AcfD (orf3526) protein (See FIG. 8). The zincin zinc metalloprotease motif is also found in StcE (Secreted protease of CI esterase inhibitor from EHEC) which is a protein secreted by EHEC that is involved in the pathogenesis of such E. coli.


StcE
(SEQ ID NO: 96)
HEVGHNYGLGH
AcfD (orf3526)
(SEQ ID NO: 97)
HEVGHNAAETP

Given that this motif is conserved in all variants of AcfD (orf3526) and EHEC was the only pathotype in which AcfD (orf3526) was not identified, it was surmised that AcfD (orf3526) similarly is a zinc metalloprotease involved in the pathogenicity of the E. coli pathotypes in which it is expressed and secreted. Therefore, inactivation of the toxicity of AcfD (orf3526) was sought. One of skill in the art would have no difficulty in modifying AcfD (orf3526) to inactivate the metalloprotease. As the Glu residue of the motif is known to be most important to catalytic activity while the two His residues coordinate the Zinc, the Glu was mutated to Ala as an exemplary mutation inactivating the metalloprotease activity—SEQ ID NOs: 58-76 (See, e.g., Microbiology and Molecular Biology Reviews, September 1998, p. 597-635, Vol. 62, No. 3). In addition, two additional detoxified variants were designed: one with the C-terminus deleted—SEQ ID NOs: 20-38, and one with the N-terminus deleted—SEQ ID NOs: 39-57.

Test of In Vitro Toxicity of Full Length AcfD (orf3526)

Two different cell lines were tested for their ability to assay toxicity of the AcfD (orf3526) protein: human bone marrow endothelial cells (HBMEC) and Chinese hamster ovary cells (CHO cells). For HBMEC, the effect of increasing doses of AcfD (orf3526) protein (0.1 μg/ml, 1 μg/ml, and 10 μg/ml) was compared to TNF-α (as a positive control). The TNF-α treated cells showed an average of ˜22.5% cell death (average of three experiments) while the highest dose of AcfD (orf3526) protein showed only an average of ˜5% cell death (average of three experiments) as compared to the negative control which showed only an average of ˜2.5% cell death (average of three experiments). For CHO cells, the effect of increasing doses of AcfD (orf3526) protein (1 μg/ml, 10 μg/ml, and 100 μg/ml) was compared to TNF-α (as a positive control) by measuring the change in potential difference over time due to the alteration of the cytoskeleton of the CHO cells. At the highest level of AcfD (orf3526) protein test, a significant decrease was detected after 46 hours, but the decrease in response to TNF-α was notably greater.

Thus, while a preferred test for toxicity with a strong signal has not been identified, the fragments identified below still have significant utility. As discussed above, these three fragment should provide a similar degree of cross protection as the full length version tested above. Furthermore, commensal E. coli is a preferred strain for expression of AcfD (orf3526) protein. However, as indicated FIG. 4, commensal E. coli express a version of AcfD (orf3526) protein, but do not secrete the protein. Thus, expression of a fragment of an AcfD (orf3526) protein provides the advantage of allowing separation of the fragment from the endogenous AcfD (orf3526) protein based upon the size difference without needing an affinity purification tag.

Cloning and Expression—3526A and 3526B

Mutants were obtained using GeneTailor site-directed mutagenesis system (Invitrogen). Genes were cloned in pET-21b vectors (Novagen) and transformed in DH5α-T1 chemically competent cells for propagation (Invitrogen). BL21 (DE3) chemically competent cells were used for expression. All candidates were cloned and expressed without the signal sequence and as his-tag fusion proteins, being purified by affinity chromatography.

Primers Used for Amplification of Fragments (Final Column is SEQ ID NO):


3526A
3526F
GGAATTCCATATGTGT
NdeI
 98
GATGGTGGTGGTTCA
3526AR
CCGCTCGAGGTTGTTC
XhoI
 99
ACCACCGATTT
3526B
3526BF
GGAATTCCATATGGAT
NdeI
100
CCGCAAGGGTATCC
3526R
CCGCTCGAGCTCGGCA
XhoI
101
GACATCTTATG

Primers Used for Mutation:


Oligo
Nucleotide 
Sample
name
sequence (5′-3′)
3526E1305A
3526GTF1
ACGACTGGCTGATTTGG
102
CACGCAGTCGGTCATA
3526GTR1
GTGCCAAATCAGCCAGT
103
CGTTCAGCGGCGT

Immunogenicity—3526A and 3526B

To confirm that both fragments and the point mutation had substantially the same immunogenicity as the full length AcfD (orf3526), the fragments were purified. The purified fragments were used in three immunization experiments in mice, adjuvanted with Freund's complete adjuvant. Immunized mice were then challenged with a lethal dose of E. coli. Results of the challenge are shown in Table 3 below.


TABLE 3
Sepsis animal model
Survival with
Survival without
Candidates
vaccination (%)
vaccination (%)
P value
3526A (AcfD—
7/8 (87.5)
1/8 (12.5)
0.01
C-term deletion)
3526B (AcfD—
6/8 (75)  
1/8 (12.5)
0.04
N-term deletion)

Cloning and Expression—ΔG3526C

As an additional confirmation, a construct was designed that combined the ΔG3526 N-terminal deletion that improved solubility with deletion of the C-terminus through the zinc motif (ΔG3526C). Exemplary constructs are provided as SEQ ID NOs: 77 to 95.

A non-his-tagged expression vector for the ΔG3526C (E. coli strain IHE3034—SEQ ID NO:77) construct was obtained by PCR using the primers indicated below (ΔG3526A/C_For and ΔG3526C_NatRev). The amplified PCR fragment was digested with NdeI and XhoI and ligated into a pET-24b(+) vector (Novagen) and transformed in DH5α-T1 chemically competent cells for propagation (Invitrogen). BL21 (DE3) chemically competent cells were used for expression.

A his-tagged expression vector for the ΔG3526C (E. coli strain IHE3034—SEQ ID NO:77) construct was obtained using Polymerase Incomplete Primer Extension (PIPE) using the primers indicated below (ΔG3526A/C_For and ΔG3526C_Nat for 1-PCR and p-pet1 and pet3 for V-PCR of the pET-21b vector (Novagen)). The expression vector was transformed in DH5α-T1 chemically competent cells for propagation (Invitrogen). BL21 (DE3) chemically competent cells were used for expression.

The his-tagged version of ΔG3526C was expressed (See, e.g., FIG. 10) without the signal sequence and purified by affinity chromatography based upon the his-tag.

Primers Used for Amplification of the Non-His-Tagged Fragment (SEQ ID NOs: 104 & 105)


ΔG3526C
ΔG3526A/C_For
gaaggagatatacatatg
(NdeI)
GATACGCCGTCTGTAGAT
TCTGG
ΔG3526C_NatRev
gtggtggtgctcgagTTA
(XhoI)
CCAAATCAGCCAGTCGTT
CAGC

Primers Used for Amplification of the His-Tagged Fragment (I-PCR): SEQ ID NOs: 106 & 107


ΔG3526C
ΔG3526A/C_For
gaaggagatatacatatg
(NdeI)
GATACGCCGTCTGTAGAT
TCTGG
ΔG3526C_Rev
gtggtggtgctcgagCCA
(XhoI)
AATCAGCCAGTCGTTCAG
C

Primers Used for Amplification of the Expression Vector (V-PCR): SEQ ID NOs: 108 & 109


pET-21b
p-pet1
catatgatatctccttcttaaag
TTAAACAAAATTATTTCTAG
p-pet3
CTCGAGCACCACCACCAC

Immunogenicity—ΔG3526C

To confirm that the additional fragment had substantially the same immunogenicity as the full length AcfD (orf3526), the fragment was purified. The purified fragment was then tested as follows. Two groups of 8 CD1 mice (4 weeks old) were immunized s.c. with three doses of antigen ΔG3526C (either 2 μg or 20 μg), formulated in Alum at days 0, 31 and 35. 14 days after last immunization (11 weeks old mice) mice were infected i.p. with pathogenic E. coli strain IHE3034. Blood was collected from the tail after 24 hours to evaluate bacteremia. Mortality was monitored for 4 days after the infection. Protection was calculated as % survival at day 4 and statistical analysis was carried out by Fisher's exact test. Results of the challenge are shown in Table 4 below.


TABLE 4
Sepsis animal model
Candidate:
Survival with
Survival without
ΔG3526C
vaccination (%)
vaccination (%)
P value
 2 μg/alum
13/16 (81)
0/7 (0)
0.0005
20 μg/alum
15/16 (93)
0/7 (0)
0.0001

Cross-Strain Immunogenicity—ΔG3526C

To further confirm the utility of the additional fragment in providing protection against multiple strains, the purified fragment was further tested as follows. CD1 mice (4 weeks old) were immunized s.c. with three doses of antigen ΔG3526C (either 10 μg or 20 μg), formulated in Alum at days 0, 31 and 35. 14 days after last immunization (11 weeks old mice) mice were infected i.p. with the pathogenic E. coli strain as indicated on Table 5. Blood was collected from the tail after 24 hours to evaluate bacteremia. Mortality was monitored for 4 days after the infection. Protection was calculated as % survival at day 4 and statistical analysis was carried out by Fisher's exact test. Results of the challenge are shown in Table 5 below.


TABLE 5
Challenge Strain
Candidate ΔG3526C with Alum
(infectious dose)
20 μg/alum
10 μg/alum
IHE3034
Survival: 15/16 (93%)
Survival: 6/8 (75%)
(1 × 107 CFU)
PE: 93%
PE: 75%
536
Survival: 5/8 (62.5%)
Survival: 6/8 (75%)
  (1 × 107 CFU i.v.)
PE: 50%
PE: 66%
9855/93
Survival: 23/47 (49%) 
(1 × 107 CFU)
PE: 39%
B616
Survival: 6/8 (75%)
Survival: 22/24 (91%) 
(2.5 × 107 CFU)  
PE: 66%
PE: 87%
UR41/S
Survival: 4/8 (50%)
(2.5 × 107 CFU)  
PE: 50%
UR40/R
Survival: 5/8 (62.5%)
   %
(5 × 106 CFU)
PE: 62.5%  
IN22/R
Survival: 7/8 (87.5%)
(1 × 107 CFU)
PE: 80%

It will be understood that the invention has been described by way of example only and modifications may be made whilst remaining within the scope and spirit of the invention.

REFERENCES (THE CONTENTS OF WHICH ARE HEREBY INCORPORATED IN FULL)

  • [1] Kaper et al. (2004) Nat Rev Microbiol. 2(2):123-40.
  • [2] Anjum et al. (2007) Appl Environ Microbiol 73:5692-7.
  • [3] Russo & Johnson (2000) J Infect Dis 181:1753-1754.
  • [4] Smith et al. (2007) Foodborne Pathogens And Disease 4:134-63.
  • [5] WO2006/089264.
  • [6] WO2006/091517.
  • [7] Needleman & Wunsch (1970) J. Mol. Biol. 48, 443-453.
  • [8] Rice et al. (2000) Trends Genet 16:276-277.
  • [9] Geysen et al. (1984) PNAS USA 81:3998-4002.
  • [10] Carter (1994) Methods Mol Biol 36:207-23.
  • [11] Jameson, B A et al. 1988, CABIOS 4(1):181-186.
  • [12] Raddrizzani & Hammer (2000) Brief Bioinform 1(2):179-89.
  • [13] Bublil et al. (2007) Proteins 68(1):294-304.
  • [14] De Lalla et al. (1999) J. Immunol. 163:1725-29.
  • [15] Kwok et al. (2001) Trends Immunol 22:583-88.
  • [16] Brusic et al. (1998) Bioinformatics 14(2):121-30
  • [17] Meister et al. (1995) Vaccine 13(6):581-91.
  • [18] Roberts et al. (1996) AIDS Res Hum Retroviruses 12(7):593-610.
  • [19] Maksyutov & Zagrebelnaya (1993) Comput Appl Biosci 9(3):291-7.
  • [20] Feller & de la Cruz (1991) Nature 349(6311):720-1.
  • [21] Hopp (1993) Peptide Research 6:183-190.
  • [22] Welling et al. (1985) FEBS Lett. 188:215-218.
  • [23] Davenport et al. (1995) Immunogenetics 42:392-297.
  • [24] Tsurui & Takahashi (2007) J Pharmacol Sci. 105(4):299-316.
  • [25] Tong et al. (2007) Brief Bioinform. 8(2):96-108.
  • [26] Schirle et al. (2001) J Immunol Methods. 257(1-2):1-16.
  • [27] Chen et al. (2007) Amino Acids 33(3):423-8.
  • [28] U.S. Pat. No. 5,707,829
  • [29] Current Protocols in Molecular Biology (F. M. Ausubel et al. eds., 1987) Supplement 30.
  • [30] Vaccine Design: The Subunit and Adjuvant Approach (eds. Powell & Newman) Plenum Press 1995 (ISBN 0-306-44867-X).
  • [31] Vaccine Adjuvants: Preparation Methods and Research Protocols (Volume 42 of Methods in Molecular Medicine series). ISBN: 1-59259-083-7. Ed. O'Hagan.
  • [32] U.S. Pat. No. 6,355,271.
  • [33] WO00/23105.
  • [34] WO90/14837.
  • [35] WO90/14837.
  • [36] Podda & Del Giudice (2003) Expert Rev Vaccines 2:197-203.
  • [37] Podda (2001) Vaccine 19: 2673-2680.
  • [38] Vaccine Design: The Subunit and Adjuvant Approach (eds. Powell & Newman) Plenum Press 1995 (ISBN 0-306-44867-X).
  • [39] Vaccine Adjuvants: Preparation Methods and Research Protocols (Volume 42 of Methods in Molecular Medicine series). ISBN: 1-59259-083-7. Ed. O'Hagan.
  • [40] Allison & Byars (1992) Res Immunol 143:519-25.
  • [41] Hariharan et al. (1995) Cancer Res 55:3486-9.
  • [42] US-2007/014805.
  • [43] Suli et al. (2004) Vaccine 22(25-26):3464-9.
  • [44] WO95/11700.
  • [45] U.S. Pat. No. 6,080,725.
  • [46] WO2005/097181.
  • [47] WO2006/113373.
  • [48] Han et al. (2005) Impact of Vitamin E on Immune Function and Infectious Diseases in the Aged at Nutrition, Immune functions and Health EuroConference, Paris, 9-10 Jun. 2005.
  • [49] U.S. Pat. No. 6,630,161.
  • [50] U.S. Pat. No. 5,057,540.
  • [51] WO96/33739.
  • [52] EP-A-0109942.
  • [53] WO96/11711.
  • [54] WO00/07621.
  • [55] Barr et al. (1998) Advanced Drug Delivery Reviews 32:247-271.
  • [56] Sjolanderet et al. (1998) Advanced Drug Delivery Reviews 32:321-338.
  • [57] Niikura et al. (2002) Virology 293:273-280.
  • [58] Lenz et al. (2001) J Immunol 166:5346-5355.
  • [59] Pinto et al. (2003) J Infect Dis 188:327-338.
  • [60] Gerber et al. (2001) J Virol 75:4752-4760.
  • [61] WO03/024480.
  • [62] WO03/024481.
  • [63] Gluck et al. (2002) Vaccine 20:B10-B16.
  • [64] EP-A-0689454.
  • [65] Johnson et al. (1999) Bioorg Med Chem Lett 9:2273-2278.
  • [66] Evans et al. (2003) Expert Rev Vaccines 2:219-229.
  • [67] Meraldi et al. (2003) Vaccine 21:2485-2491.
  • [68] Pajak et al. (2003) Vaccine 21:836-842.
  • [69] Kandimalla et al. (2003) Nucleic Acids Research 31:2393-2400.
  • [70] WO02/26757.
  • [71] WO99/62923.
  • [72] Krieg (2003) Nature Medicine 9:831-835.
  • [73] McCluskie et al. (2002) FEMS Immunology and Medical Microbiology 32:179-185.
  • [74] WO98/40100.
  • [75] U.S. Pat. No. 6,207,646.
  • [76] U.S. Pat. No. 6,239,116.
  • [77] U.S. Pat. No. 6,429,199.
  • [78] Kandimalla et al. (2003) Biochemical Society Transactions 31 (part 3):654-658.
  • [79] Blackwell et al. (2003) J Immunol 170:4061-4068.
  • [80] Krieg (2002) Trends Immunol 23:64-65.
  • [81] WO01/95935.
  • [82] Kandimalla et al. (2003) BBRC 306:948-953.
  • [83] Bhagat et al. (2003) BBRC 300:853-861.
  • [84] WO03/035836.
  • [85] WO01/22972.
  • [86] Schellack et al. (2006) Vaccine 24:5461-72.
  • [87] WO95/17211.
  • [88] WO98/42375.
  • [89] Beignon et al. (2002) Infect Immun 70:3012-3019.
  • [90] Pizza et al. (2001) Vaccine 19:2534-2541.
  • [91] Pizza et al. (2000) Int J Med Microbiol 290:455-461.
  • [92] Scharton-Kersten et al. (2000) Infect Immun 68:5306-5313.
  • [93] Ryan et al. (1999) Infect Immun 67:6270-6280.
  • [94] Partidos et al. (1999) Immunol Lett 67:209-216.
  • [95] Peppoloni et al. (2003) Expert Rev Vaccines 2:285-293.
  • [96] Pine et al. (2002) J Control Release 85:263-270.
  • [97] Tebbey et al. (2000) Vaccine 18:2723-34.
  • [98] Domenighini et al. (1995) Mol Microbiol 15:1165-1167.
  • [99] WO99/40936.
  • [100] WO99/44636.
  • [101] Singh et al] (2001) J Cont Release 70:267-276.
  • [102] WO99/27960.
  • [102] U.S. Pat. No. 6,090,406.
  • [104] U.S. Pat. No. 5,916,588.
  • [105] EP-A-0626169.
  • [106] WO99/52549.
  • [107] WO01/21207.
  • [108] WO01/21152.
  • [109] Andrianov et al. (1998) Biomaterials 19:109-115.
  • [110] Payne et al. (1998) Adv Drug Delivery Review 31:185-196.
  • [111] U.S. Pat. No. 4,680,338.
  • [112] U.S. Pat. No. 4,988,815.
  • [113] WO92/15582.
  • [114] Stanley (2002) Clin Exp Dermatol 27:571-577.
  • [115] Wu et al. (2004) Antiviral Res. 64(2):79-83.
  • [116] Vasilakos et al. (2000) Cell Immunol. 204(1):64-74.
  • [117] U.S. Pat. Nos. 4,689,338, 4,929,624, 5,238,944, 5,266,575, 5,268,376, 5,346,905, 5,352,784, 5,389,640, 5,395,937, 5,482,936, 5,494,916, 5,525,612, 6,083,505, 6,440,992, 6,627,640, 6,656,938, 6,660,735, 6,660,747, 6,664,260, 6,664,264, 6,664,265, 6,667,312, 6,670,372, 6,677,347, 6,677,348, 6,677,349, 6,683,088, 6,703,402, 6,743,920, 6,800,624, 6,809,203, 6,888,000 and 6924293.
  • [118] Jones (2003) Curr Opin Investig Drugs 4:214-218.
  • [119] WO03/011223.
  • [120] Johnson et al. (1999) Bioorg Med Chem Lett 9:2273-2278.
  • [121] Evans et al. (2003) Expert Rev Vaccines 2:219-229.
  • [122] WO2004/060308.
  • [123] WO2004/064759.
  • [124] U.S. Pat. No. 6,924,271.
  • [125] US2005/0070556.
  • [126] U.S. Pat. No. 5,658,731.
  • [127] U.S. Pat. No. 5,011,828.
  • [128] WO2004/87153.
  • [129] U.S. Pat. No. 6,605,617.
  • [130] WO02/18383.
  • [131] WO2004/018455.
  • [132] WO03/082272.
  • [133] Wong et al. (2003) J Clin Pharmacol 43(7):735-42.
  • [134] US2005/0215517.
  • [135] Dyakonova et al. (2004) Int Immunopharmacol 4(13):1615-23.
  • [136] FR-2859633.
  • [137] Signorelli & Hadden (2003) Int Immunopharmacol 3(8):1177-86.
  • [138] WO2004/064715.
  • [139] De Libero et al, Nature Reviews Immunology, 2005, 5: 485-496
  • [140] U.S. Pat. No. 5,936,076.
  • [141] Oki et al, J. Clin. Investig., 113: 1631-1640
  • [142] US2005/0192248
  • [143] Yang et al, Angew. Chem. Int, Ed., 2004, 43: 3818-3822
  • [144] WO2005/102049
  • [145] Goff et al, J. Am. Chem., Soc., 2004, 126: 13602-13603
  • [146] WO03/105769
  • [147] Cooper (1995) Pharm Biotechnol 6:559-80.
  • [148] WO99/11241.
  • [149] WO94/00153.
  • [150] WO98/57659.
  • [151] European patent applications 0835318, 0735898 and 0761231.
  • [152] Durant et al. (2007) Infect Immun 75:1916-25.
  • [153] WO02/081653.
  • [154] Donnelly et al. (1997) Annu Rev Immunol 15:617-648.
  • [155] Strugnell et al. (1997) Immunol Cell Biol 75(4):364-369.
  • [156] Cui (2005) Adv Genet 54:257-89.
  • [157] Robinson & Torres (1997) Seminars in Immunol 9:271-283.
  • [158] Brunham et al. (2000) J Infect Dis 181 Suppl 3:S538-43.
  • [159] Svanholm et al. (2000) Scand J Immunol 51(4):345-53.
  • [160] DNA Vaccination—Genetic Vaccination (1998) eds. Koprowski et al. (ISBN 3540633928).
  • [161] Gene Vaccination: Theory and Practice (1998) ed. Raz (ISBN 3540644288).
  • [162] Findeis et al., Trends Biotechnol. (1993) 11:202
  • [163] Chiou et al. (1994) Gene Therapeutics: Methods And Applications Of Direct Gene Transfer. ed. Wolff
  • [164] Wu et al., J. Biol. Chem. (1988) 263:621
  • [165] Wu et al., J. Biol. Chem. (1994) 269:542
  • [166] Zenke et al., Proc. Natl. Acad. Sci. (USA) (1990) 87:3655
  • [167] Wu et al., J. Biol. Chem. (1991) 266:338
  • [168] Jolly, Cancer Gene Therapy (1994) 1:51
  • [169] Kimura, Human Gene Therapy (1994) 5:845
  • [170] Connelly, Human Gene Therapy (1995) 1:185
  • [171] Kaplitt, Nature Genetics (1994) 6:148
  • [172] WO 90/07936.
  • [173] WO 94/03622.
  • [174] WO 93/25698.
  • [175] WO 93/25234.
  • [176] U.S. Pat. No. 5,219,740.
  • [177] WO 93/11230.
  • [178] WO 93/10218.
  • [179] U.S. Pat. No. 4,777,127.
  • [180] GB Patent No. 2,200,651.
  • [181] EP-A-0345242.
  • [182] WO 91/02805.
  • [183] WO 94/12649.
  • [184] WO 93/03769.
  • [185] WO 93/19191.
  • [186] WO 94/28938.
  • [187] WO 95/11984.
  • [188] WO 95/00655.
  • [189] Curiel, Hum. Gene Ther. (1992) 3:147
  • [190] Wu, J. Biol. Chem. (1989) 264:16985
  • [191] U.S. Pat. No. 5,814,482.
  • [192] WO 95/07994.
  • [193] WO 96/17072.
  • [194] WO 95/30763.
  • [195] WO 97/42338.
  • [196] WO 90/11092.
  • [197] U.S. Pat. No. 5,580,859
  • [198] U.S. Pat. No. 5,422,120
  • [199] WO 95/13796.
  • [200] WO 94/23697.
  • [201] WO 91/14445.
  • [202] EP-0524968.
  • [203] Philip, Mol. Cell Biol. (1994) 14:2411
  • [204] Woffendin, Proc. Natl. Acad. Sci. (1994) 91:11581
  • [205] U.S. Pat. No. 5,206,152.
  • [206] WO 92/11033.
  • [207] U.S. Pat. No. 5,149,655.
  • [208] Gennaro (2000) Remington: The Science and Practice of Pharmacy. 20th edition, ISBN: 0683306472.
  • [209] Methods In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.)
  • [210] Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell, eds, 1986, Blackwell Scientific Publications)
  • [211] Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition (Cold Spring Harbor Laboratory Press).
  • [212] Handbook of Surface and Colloidal Chemistry (Birdi, K. S, ed., CRC Press, 1997)
  • [213] Ausubel et al. (eds) (2002) Short protocols in molecular biology, 5th edition (Current Protocols).
  • [214] Molecular Biology Techniques: An Intensive Laboratory Course, (Ream et al., eds., 1998, Academic Press)
  • [215] PCR (Introduction to Biotechniques Series), 2nd ed. (Newton & Graham eds., 1997, Springer Verlag)
  • [216] Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987) Supplement 30
  • [217] Smith & Waterman (1981) Adv. Appl. Math. 2: 482-489.


SEQUENCE LISTING
The patent contains a lengthy “Sequence Listing” section. A copy of the “Sequence Listing” is available in electronic form from the USPTO web site (). An electronic copy of the “Sequence Listing” will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).

<160> NUMBER OF SEQ ID NOS: 126

<140> CURRENT APPLICATION NUMBER: US/14/525,033

<210> SEQ ID NO 1

<211> LENGTH: 1520

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 1

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Ser Val Asp Ser Gly Ser Gly Thr Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Thr Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Asp Pro Thr Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Gln Arg Val Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser

100 105 110

Asp Gly Phe Thr Phe Thr Pro Gly Asn Thr Val Ser Cys Val Val Gly

115 120 125

Ser Thr Thr Ile Ala Thr Phe Asn Thr Gln Ser Glu Ala Ala Arg Ser

130 135 140

Leu Arg Ala Val Asp Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu

145 150 155 160

Leu Ala Asn Ser Glu Asn Lys Lys Thr Asn Ala Ile Ser Leu Val Thr

165 170 175

Ser Ser Asp Ser Cys Pro Ala Asp Ala Glu Gln Leu Cys Leu Thr Phe

180 185 190

Ser Ser Val Val Asp Arg Ala Arg Phe Glu Lys Leu Tyr Lys Gln Ile

195 200 205

Asp Leu Ala Thr Asp Asn Phe Ser Lys Leu Val Asn Glu Glu Val Glu

210 215 220

Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Thr Val

225 230 235 240

Val Pro Val Thr Thr Glu Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe

245 250 255

Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile

260 265 270

Ile Leu Ser Glu Gly Gln Leu Val Asp Ser Leu Gly Asn Gly Val Ala

275 280 285

Gly Val Asp Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Asp Glu Asn

290 295 300

Gly Lys Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp

305 310 315 320

Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu

325 330 335

Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile

340 345 350

His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp

355 360 365

Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile

370 375 380

Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Asp Glu Gly Asp Gln

385 390 395 400

Asn Val Val Leu Pro Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln

405 410 415

Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn

420 425 430

Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln

435 440 445

Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Gln

450 455 460

Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr Gly

465 470 475 480

Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ser

485 490 495

Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala

500 505 510

Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr

515 520 525

Glu Ala Pro Ser Ile Val Gln Pro Glu Asn Val Thr Arg Asp Thr Ala

530 535 540

Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu Gly Lys

545 550 555 560

Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro

565 570 575

Asn Gly Tyr Ser Trp Gly Gly Gly Val Asn Ser Lys Gly Glu Cys Thr

580 585 590

Leu Ser Gly Asp Ser Asp Asp Met Lys His Phe Met Gln Asn Val Leu

595 600 605

Arg Tyr Leu Ser Asn Asp Ile Trp Gln Pro Asn Thr Lys Ser Ile Met

610 615 620

Thr Val Gly Thr Asn Leu Glu Asn Val Tyr Phe Lys Lys Ala Gly Gln

625 630 635 640

Val Leu Gly Asn Ser Ala Pro Phe Ala Phe His Glu Asp Phe Thr Gly

645 650 655

Ile Thr Val Lys Gln Leu Thr Ser Tyr Gly Asp Leu Asn Pro Glu Glu

660 665 670

Ile Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Trp Ser

675 680 685

Gly Asp Pro Tyr Ala Val Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys

690 695 700

Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly

705 710 715 720

Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu

725 730 735

Ser Ala Ser Ser Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met

740 745 750

Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asp

755 760 765

Arg Val Arg Gln Arg Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr

770 775 780

Pro Ala Ala Asp Gly Ala Gln Pro Pro Tyr Thr Ile Asp Pro Asn Thr

785 790 795 800

Gly Glu Val Thr Trp Lys Tyr Gln Gln Asp Asn Lys Pro Asp Asp Lys

805 810 815

Pro Lys Leu Glu Val Ala Ser Trp Gln Glu Glu Val Glu Gly Lys Gln

820 825 830

Val Thr Arg Tyr Ala Phe Ile Asp Glu Ala Glu Tyr Thr Thr Glu Glu

835 840 845

Ser Leu Glu Ala Ala Lys Ala Lys Ile Phe Glu Lys Phe Pro Gly Leu

850 855 860

Gln Glu Cys Lys Asp Ser Thr Tyr His Tyr Glu Ile Asn Cys Leu Glu

865 870 875 880

Arg Arg Pro Gly Thr Asp Val Pro Val Thr Gly Gly Met Tyr Val Pro

885 890 895

Arg Tyr Thr Gln Leu Asn Leu Asp Ala Asp Thr Ala Lys Ala Met Val

900 905 910

Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu

915 920 925

Leu Tyr Phe Arg Thr Lys Gly Ser Lys Gly Glu Arg Leu Asn Ser Val

930 935 940

Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Asp

945 950 955 960

Thr Lys Tyr Arg Tyr Glu Glu Gly Lys Glu Asp Glu Leu Gly Phe Lys

965 970 975

Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Ala Gly

980 985 990

Gly Thr Lys Cys Ser Ala Asp Leu Lys Lys Ser Leu Val Asp Asn Asn

995 1000 1005

Met Ile Tyr Gly Asp Gly Ser Ser Lys Ala Gly Met Met Asn Pro Ser

1010 1015 1020

Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly

1025 1030 1035 1040

Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro

1045 1050 1055

Gly Ser Val Ser Ala Lys Gly Glu Ser Val Thr Glu Asn Ile Ser Leu

1060 1065 1070

Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly

1075 1080 1085

Leu Trp Ala Pro Ala Gln Gln Asp Val Thr Ile Lys Ser Ser Ala Ser

1090 1095 1100

Val Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg

1105 1110 1115 1120

Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro Arg Val Thr Lys Thr

1125 1130 1135

Tyr Thr Leu Glu Ala Asn Gly Glu Val Thr Phe Lys Val Pro Tyr Gly

1140 1145 1150

Gly Leu Ile Tyr Ile Lys Gly Asp Ser Lys Asp Asp Val Ser Ala Asn

1155 1160 1165

Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Glu

1170 1175 1180

Trp Lys Asn Asp Leu Asp Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser

1185 1190 1195 1200

Ala Ser Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Glu Ala Ser Asn

1205 1210 1215

Phe Thr Gly Gly Val Ala Glu Phe Ala Lys Asp Leu Asp Thr Phe Ala

1220 1225 1230

Ser Ser Met Asn Asp Phe Tyr Gly Arg Asn Asp Glu Asp Gly Lys His

1235 1240 1245

Arg Met Phe Thr Tyr Lys Asn Leu Thr Gly His Lys His Arg Phe Thr

1250 1255 1260

Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val

1265 1270 1275 1280

Met Asn Ser Ser Phe Ser Thr Asn Ser Thr Thr Leu Pro Thr Thr Pro

1285 1290 1295

Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu

1300 1305 1310

Thr Pro Leu Asn Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu

1315 1320 1325

Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala

1330 1335 1340

Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Asp Glu Ser Asn Gly Gln

1345 1350 1355 1360

Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln

1365 1370 1375

Leu Lys Glu Trp Ala Glu Glu Asn Phe Asp Ile Lys Gln Trp Tyr Pro

1380 1385 1390

Asp Gly Glu Leu Pro Lys Phe Tyr Ser Asp Arg Lys Gly Met Lys Gly

1395 1400 1405

Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Asp Val

1410 1415 1420

Gly Asn Ser Thr Phe Gly Gly Lys Asn Tyr Cys Ala Glu Ser Asn Gly

1425 1430 1435 1440

Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln Ala

1445 1450 1455

Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Ser Ala Tyr

1460 1465 1470

Gln Leu Pro Gly Ala Thr Glu Met Ser Phe Gln Gly Gly Val Ser Ser

1475 1480 1485

Ser Ala Tyr Ser Thr Leu Ala Ser Leu Lys Leu Pro Lys Pro Glu Lys

1490 1495 1500

Gly Pro Glu Thr Ile Asn Lys Val Thr Glu His Lys Met Ser Ala Glu

1505 1510 1515 1520

<210> SEQ ID NO 2

<211> LENGTH: 1521

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 2

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Gln Arg Ile Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser

100 105 110

Asp Gly Phe Thr Phe Thr Pro Gly Asp Lys Val Thr Cys Val Ala Gly

115 120 125

Asn Asn Thr Thr Ile Ala Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg

130 135 140

Ser Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala Gln

145 150 155 160

Glu Leu Ala Ala Ser Asp Asp Lys Lys Ser Asn Ala Val Ser Leu Val

165 170 175

Thr Ser Ser Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu Thr

180 185 190

Phe Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln

195 200 205

Ile Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu Val

210 215 220

Glu Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Pro

225 230 235 240

Val Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser

245 250 255

Phe Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu

260 265 270

Ile Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Met Gly Asn Gly Val

275 280 285

Val Gly Val Asn Tyr Tyr Thr Ser Ser Gly Arg Gly Val Thr Gly Glu

290 295 300

Asn Gly Lys Phe Asn Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile

305 310 315 320

Asp Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala

325 330 335

Leu Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu

340 345 350

Ile His Arg Tyr Ser Gln Ala Gly Lys Asn Asp Glu Arg Glu Val Pro

355 360 365

Asp Val Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu

370 375 380

Ile Ile Asn Leu Ser Leu Ser Asn Gly Glu Ala Leu Ser Glu Gly Asp

385 390 395 400

Gln Thr Phe Glu Arg Thr Asn Glu Phe Leu Glu Gln Phe Glu Ser Gly

405 410 415

Gln Ala Lys Glu Ile Asp Thr Ala Ile Cys Asp Ser Leu Gly Gly Cys

420 425 430

Asn Ser Gln Arg Trp Phe Ser Leu Thr Ala Arg Asn Val Asn Glu Gly

435 440 445

Gln Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Lys Asp Tyr

450 455 460

Lys Ser Val Thr Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr

465 470 475 480

Gly Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn

485 490 495

Ala Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu

500 505 510

Ala Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile

515 520 525

Thr Glu Ala Pro Ser Leu Val Glu Pro Glu Asn Val Thr Arg Asp Thr

530 535 540

Ala Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu Gly

545 550 555 560

Lys Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys

565 570 575

Pro Asn Gly Tyr Ser Trp Glu Gly Gly Val Asp Lys Asn Gly Gln Cys

580 585 590

Thr Arg Asn Ser Asp Ser Asn Asp Met Lys His Phe Met Gln Asn Val

595 600 605

Leu Arg Tyr Leu Ser Asp Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser

610 615 620

Met Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Arg His Gly

625 630 635 640

Gln Val Thr Gly Asn Ser Ala Glu Phe Gly Phe His Pro Asp Phe Ala

645 650 655

Gly Ile Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln

660 665 670

Glu Met Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Val

675 680 685

Gly Asn Asp Pro Tyr Ala Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro

690 695 700

Lys Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys

705 710 715 720

Gly Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu

725 730 735

Glu Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser

740 745 750

Met Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro

755 760 765

Asn Arg Val Arg Gln Gln Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg

770 775 780

Tyr Pro Ala Val Asp Gly Ala Leu Pro Tyr Thr Ile Asp Ser Lys Thr

785 790 795 800

Gly Glu Val Lys Trp Lys Tyr Gln Val Glu Asn Lys Pro Asp Asp Lys

805 810 815

Pro Lys Leu Glu Val Ala Ser Trp Leu Glu Asp Val Asp Gly Lys Gln

820 825 830

Glu Thr Arg Tyr Ala Phe Ile Asp Glu Ala Asp His Lys Thr Glu Asp

835 840 845

Ser Leu Lys Ala Ala Lys Ala Lys Ile Phe Glu Lys Phe Pro Gly Leu

850 855 860

Lys Glu Cys Lys Asp Pro Thr Tyr His Tyr Glu Val Asn Cys Leu Glu

865 870 875 880

Tyr Arg Pro Gly Thr Gly Val Pro Val Thr Gly Gly Met Tyr Val Pro

885 890 895

Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp Thr Ala Lys Ala Met Val

900 905 910

Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu

915 920 925

Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser Val

930 935 940

Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Lys

945 950 955 960

Ile Glu Tyr Arg Tyr Glu Asn Asp Lys Asp Asp Glu Leu Gly Phe Lys

965 970 975

Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Thr Gly

980 985 990

Gly Thr Gln Cys Ser Asp Glu Leu Lys Lys Ser Leu Val Asp Asn Asn

995 1000 1005

Met Ile Tyr Gly Glu Lys Ser Val Asn Lys Ala Gly Met Met Asn Pro

1010 1015 1020

Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu

1025 1030 1035 1040

Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr

1045 1050 1055

Pro Gly Ala Val Ser Ala Glu Gly Glu Lys Val Thr Glu Thr Ile Ser

1060 1065 1070

Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr

1075 1080 1085

Gly Leu Trp Ala Pro Ala Gln Lys Glu Val Thr Ile Glu Ser Ser Ala

1090 1095 1100

Ser Val Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly

1105 1110 1115 1120

Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro Lys Val Thr Lys

1125 1130 1135

Thr Tyr Glu Leu Lys Ala Asn Gly Glu Val Lys Phe Thr Val Pro Tyr

1140 1145 1150

Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser Pro Gln Asn Glu Ser Ala

1155 1160 1165

Glu Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly

1170 1175 1180

Ala Trp Lys Asn Ala Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu

1185 1190 1195 1200

Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Glu Ala Ser

1205 1210 1215

Asn Phe Thr Gly Gly Val Ala Glu Phe Ala Lys Asp Leu Asp Thr Phe

1220 1225 1230

Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asn Asp Glu Asp Gly Lys

1235 1240 1245

His Arg Met Phe Thr Tyr Lys Asn Leu Thr Gly His Lys His Arg Phe

1250 1255 1260

Thr Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro

1265 1270 1275 1280

Val Met Asn Ser Ser Phe Ser Thr Asn Ser Thr Thr Leu Pro Thr Thr

1285 1290 1295

Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala

1300 1305 1310

Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val

1315 1320 1325

Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val

1330 1335 1340

Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Gly

1345 1350 1355 1360

Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala

1365 1370 1375

Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Gln Trp Tyr

1380 1385 1390

Pro Glu Gly Asp Leu Pro Lys Phe Tyr Ser Asp Arg Glu Gly Met Lys

1395 1400 1405

Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Glu

1410 1415 1420

Val Gly Lys Thr Lys Phe Gly Glu Arg Asn Tyr Cys Ala Glu Ser Asn

1425 1430 1435 1440

Gly Asn Ala Ala Asp Lys Leu Met Leu Cys Ala Ser Trp Val Ala Gln

1445 1450 1455

Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala

1460 1465 1470

Tyr Gln Leu Pro Gly Ala Ser Glu Met Asn Phe Glu Gly Gly Val Ser

1475 1480 1485

Gln Ser Ala Tyr Glu Thr Leu Ala Ala Leu Asn Leu Pro Lys Pro Gln

1490 1495 1500

Gln Gly Pro Glu Thr Ile Asn Gln Val Thr Glu His Lys Met Ser Ala

1505 1510 1515 1520

Glu

<210> SEQ ID NO 3

<211> LENGTH: 1521

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 3

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Gln Arg Ile Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser

100 105 110

Asp Gly Phe Thr Phe Thr Pro Gly Asp Lys Val Thr Cys Val Ala Gly

115 120 125

Asn Asn Thr Thr Ile Ala Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg

130 135 140

Ser Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala Gln

145 150 155 160

Glu Leu Ala Ala Ser Asp Asp Lys Lys Ser Asn Ala Val Ser Leu Val

165 170 175

Thr Ser Ser Asn Ser Cys Pro Ala Asp Thr Glu Gln Val Cys Leu Thr

180 185 190

Phe Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln

195 200 205

Ile Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu Val

210 215 220

Glu Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Pro

225 230 235 240

Val Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser

245 250 255

Phe Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu

260 265 270

Ile Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Met Gly Asn Gly Val

275 280 285

Val Gly Val Asn Tyr Tyr Thr Ser Ser Gly Arg Gly Val Thr Gly Glu

290 295 300

Asn Gly Lys Phe Asn Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile

305 310 315 320

Asp Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala

325 330 335

Leu Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu

340 345 350

Ile His Arg Tyr Ser Gln Ala Gly Lys Asn Asp Glu Arg Glu Val Pro

355 360 365

Asp Val Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu

370 375 380

Ile Ile Asn Leu Ser Leu Ser Asn Gly Glu Ala Leu Ser Glu Gly Asp

385 390 395 400

Gln Thr Phe Glu Arg Thr Asn Glu Phe Leu Glu Gln Phe Glu Ser Gly

405 410 415

Gln Ala Lys Glu Ile Asp Thr Ala Ile Cys Asp Ser Leu Gly Gly Cys

420 425 430

Asn Ser Gln Arg Trp Phe Ser Leu Thr Ala Arg Asn Val Asn Asp Gly

435 440 445

Gln Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr

450 455 460

Lys Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr

465 470 475 480

Gly Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn

485 490 495

Ala Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu

500 505 510

Ala Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile

515 520 525

Thr Glu Ala Pro Ser Leu Val Glu Pro Glu Asn Val Thr Arg Asp Thr

530 535 540

Ala Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu Gly

545 550 555 560

Lys Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys

565 570 575

Pro Asn Gly Tyr Ser Trp Glu Gly Gly Val Asp Lys Asn Gly Gln Cys

580 585 590

Thr Arg Asn Ser Asp Ser Asn Asp Met Lys His Phe Met Gln Asn Val

595 600 605

Leu Arg Tyr Leu Ser Asp Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser

610 615 620

Met Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Arg His Gly

625 630 635 640

Gln Val Thr Gly Asn Ser Ala Glu Phe Gly Phe His Pro Asp Phe Ala

645 650 655

Gly Ile Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln

660 665 670

Glu Met Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Val

675 680 685

Gly Asn Asp Pro Tyr Ala Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro

690 695 700

Lys Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys

705 710 715 720

Gly Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu

725 730 735

Glu Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser

740 745 750

Met Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro

755 760 765

Asn Arg Val Arg Gln Gln Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg

770 775 780

Tyr Pro Ala Val Asp Gly Ala Leu Pro Tyr Thr Ile Asp Ser Lys Thr

785 790 795 800

Gly Glu Val Lys Trp Lys Tyr Gln Val Glu Asn Lys Pro Asp Asp Lys

805 810 815

Pro Lys Leu Glu Val Ala Ser Trp Leu Glu Asp Val Asp Gly Lys Gln

820 825 830

Glu Thr Arg Tyr Ala Phe Ile Asp Glu Ala Asp His Lys Thr Glu Asp

835 840 845

Ser Leu Lys Ala Ala Lys Ala Lys Ile Phe Glu Lys Phe Pro Gly Leu

850 855 860

Lys Glu Cys Lys Asp Pro Thr Tyr His Tyr Glu Val Asn Cys Leu Glu

865 870 875 880

Tyr Arg Pro Gly Thr Gly Val Pro Val Thr Gly Gly Met Tyr Val Pro

885 890 895

Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp Thr Ala Lys Ala Met Val

900 905 910

Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu

915 920 925

Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser Val

930 935 940

Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Lys

945 950 955 960

Ile Glu Tyr Arg Tyr Glu Asn Asp Lys Asp Asp Glu Leu Gly Phe Lys

965 970 975

Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Thr Gly

980 985 990

Gly Thr Gln Cys Ser Asp Glu Leu Lys Lys Ser Leu Val Asp Asn Asn

995 1000 1005

Met Ile Tyr Gly Glu Lys Ser Val Asn Lys Ala Gly Met Met Asn Pro

1010 1015 1020

Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu

1025 1030 1035 1040

Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr

1045 1050 1055

Pro Gly Ala Val Ser Ala Glu Gly Glu Lys Val Thr Glu Thr Ile Ser

1060 1065 1070

Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr

1075 1080 1085

Gly Leu Trp Ala Pro Ala Gln Lys Glu Val Thr Ile Glu Ser Thr Ala

1090 1095 1100

Ser Val Ala Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly

1105 1110 1115 1120

Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro Lys Val Thr Lys

1125 1130 1135

Thr Tyr Glu Leu Lys Ala Asn Gly Glu Val Lys Phe Thr Val Pro Tyr

1140 1145 1150

Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser Pro Gln Asn Glu Ser Ala

1155 1160 1165

Glu Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly

1170 1175 1180

Ala Trp Lys Asn Ala Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu

1185 1190 1195 1200

Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Glu Ala Ser

1205 1210 1215

Asn Tyr Lys Gly Gly Gln Glu Gln Phe Ala Glu Glu Leu Asp Thr Phe

1220 1225 1230

Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asn Asp Glu Asp Gly Lys

1235 1240 1245

His Arg Met Phe Thr Tyr Lys Asn Leu Thr Gly His Lys His Arg Phe

1250 1255 1260

Thr Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro

1265 1270 1275 1280

Val Met Asn Ser Ser Phe Ser Thr Asn Ser Thr Thr Leu Pro Thr Thr

1285 1290 1295

Pro Leu Asn Asp Trp Leu Ile Trp His Glu Ala Gly His Asn Ala Ala

1300 1305 1310

Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val

1315 1320 1325

Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val

1330 1335 1340

Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Asn

1345 1350 1355 1360

Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala

1365 1370 1375

Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile Thr Lys Trp Tyr

1380 1385 1390

Pro Glu Gly Asn Leu Pro Lys Phe Tyr Ser Glu Arg Glu Gly Met Lys

1395 1400 1405

Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Glu

1410 1415 1420

Val Gly Lys Thr Lys Phe Gly Glu Arg Asn Tyr Cys Ala Glu Ser Asn

1425 1430 1435 1440

Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln

1445 1450 1455

Thr Asp Leu Ser Ala Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala

1460 1465 1470

Tyr Gln Leu Pro Gly Ala Ser Glu Met Asn Phe Glu Gly Gly Val Ser

1475 1480 1485

Gln Ser Ala Tyr Glu Thr Leu Ala Ala Leu Asn Leu Pro Lys Pro Gln

1490 1495 1500

Gln Gly Pro Glu Thr Ile Asn Lys Val Thr Glu Tyr Ser Met Pro Ala

1505 1510 1515 1520

Glu

<210> SEQ ID NO 4

<211> LENGTH: 1520

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 4

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Ile Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Gln Arg Val Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser

100 105 110

Asp Gly Phe Thr Phe Lys Pro Gly Glu Asp Val Thr Cys Val Ala Gly

115 120 125

Asn Thr Thr Ile Ala Thr Phe Asn Thr Gln Ser Glu Ala Ala Arg Ser

130 135 140

Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu

145 150 155 160

Leu Ala Gly Ser Asp Asp Lys Lys Ser Asn Ala Val Ser Leu Val Thr

165 170 175

Ser Ser Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu Thr Phe

180 185 190

Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile

195 200 205

Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu

210 215 220

Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val

225 230 235 240

Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe

245 250 255

Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile

260 265 270

Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Gln Gly Tyr Gly Val Ala

275 280 285

Gly Val Asn Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn

290 295 300

Gly Glu Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp

305 310 315 320

Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu

325 330 335

Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile

340 345 350

His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp

355 360 365

Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile

370 375 380

Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Gly Glu Gly Glu Gln

385 390 395 400

Val Val Asn Leu Pro Asn Glu Phe Ile Glu Gln Phe Asn Thr Gly Gln

405 410 415

Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn

420 425 430

Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln

435 440 445

Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys

450 455 460

Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr Gly

465 470 475 480

Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala

485 490 495

Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala

500 505 510

Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr

515 520 525

Glu Ala Pro Ser Leu Val Glu Pro Glu Asn Val Thr Arg Asp Thr Ala

530 535 540

Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu Gly Lys

545 550 555 560

Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro

565 570 575

Asn Gly Tyr Ser Trp Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr

580 585 590

Leu Asn Ser Asp Pro Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu

595 600 605

Arg Tyr Leu Ser Asp Asp Lys Trp Lys Pro Asp Ala Lys Ala Ser Met

610 615 620

Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Arg His Gly Gln

625 630 635 640

Val Thr Gly Asn Ser Ala Ala Phe Asp Phe His Pro Asp Phe Ala Gly

645 650 655

Ile Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu

660 665 670

Met Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly

675 680 685

Asn Asp Pro Tyr Ala Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys

690 695 700

Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly

705 710 715 720

Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu

725 730 735

Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met

740 745 750

Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asn

755 760 765

Arg Val Arg Gln Gln Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr

770 775 780

Pro Ala Val Asp Gly Ala Leu Pro Tyr Thr Ile Asp Ser Lys Thr Gly

785 790 795 800

Glu Val Lys Trp Lys Tyr Gln Val Glu Asn Lys Pro Asp Asp Lys Pro

805 810 815

Lys Leu Glu Val Ala Ser Trp Leu Glu Asp Val Asp Gly Lys Gln Glu

820 825 830

Thr Arg Tyr Ala Phe Ile Asp Glu Ala Asp His Lys Thr Glu Asp Ser

835 840 845

Leu Lys Ala Ala Lys Glu Lys Ile Phe Ala Ala Phe Pro Gly Leu Lys

850 855 860

Glu Cys Thr Asn Pro Ala Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr

865 870 875 880

Arg Pro Gly Thr Gly Val Pro Val Thr Gly Gly Met Tyr Val Pro Gln

885 890 895

Tyr Thr Gln Leu Ser Leu Asn Ala Asp Thr Ala Lys Ala Met Val Gln

900 905 910

Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu

915 920 925

Tyr Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser Val Asp

930 935 940

Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Asp Thr

945 950 955 960

Ser Tyr Arg Tyr Glu Glu Gly Lys Asn Asp Glu Leu Gly Phe Lys Thr

965 970 975

Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Ala Gly Gly

980 985 990

Thr Lys Cys Ser Ala Asp Leu Lys Lys Ser Leu Val Asp Asn Asn Met

995 1000 1005

Ile Tyr Gly Asp Gly Ser Ser Lys Ala Gly Met Met Asn Pro Ser Tyr

1010 1015 1020

Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg

1025 1030 1035 1040

Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly

1045 1050 1055

Ala Val Ser Glu Glu Gly Gln Asn Val Thr Glu Thr Ile Ser Leu Tyr

1060 1065 1070

Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu

1075 1080 1085

Trp Ala Pro Ala Gln Lys Glu Val Thr Ile Lys Ser Asn Ala Asn Val

1090 1095 1100

Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu

1105 1110 1115 1120

Lys His Glu Val Ala Leu Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr

1125 1130 1135

Ser Leu Asp Ala Ser Gly Thr Val Lys Phe Lys Val Pro Tyr Gly Gly

1140 1145 1150

Leu Ile Tyr Ile Lys Gly Asn Ser Ser Thr Asn Glu Ser Ala Ser Phe

1155 1160 1165

Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Ala Trp

1170 1175 1180

Lys Asn Asp Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Asp

1185 1190 1195 1200

Ala Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Asn Ala Ser Asn Tyr

1205 1210 1215

Thr Gly Gly Leu Glu Gln Phe Ala Asn Asp Leu Asp Thr Phe Ala Ser

1220 1225 1230

Ser Met Asn Asp Phe His Gly Arg Asp Ser Glu Asp Gly Lys His Arg

1235 1240 1245

Met Phe Thr Tyr Lys Asn Leu Pro Gly His Lys His Arg Phe Thr Asn

1250 1255 1260

Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met

1265 1270 1275 1280

Asn Ser Ser Phe Ser Pro Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu

1285 1290 1295

Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu Thr

1300 1305 1310

Pro Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala

1315 1320 1325

Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp

1330 1335 1340

Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Asn Gln Ala

1345 1350 1355 1360

Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu

1365 1370 1375

Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Lys Trp Tyr Pro Asp

1380 1385 1390

Gly Thr Pro Leu Pro Glu Phe Tyr Ser Glu Arg Glu Gly Met Lys Gly

1395 1400 1405

Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Glu Val

1410 1415 1420

Ser Asn Asp Lys Phe Gly Gly Lys Asn Tyr Cys Ala Glu Ser Asn Gly

1425 1430 1435 1440

Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln Thr

1445 1450 1455

Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr

1460 1465 1470

Gln Leu Pro Gly Ala Ser Glu Met Ser Phe Glu Gly Gly Val Ser Gln

1475 1480 1485

Ser Ala Tyr Asn Thr Leu Ala Ser Leu Asp Leu Pro Lys Pro Glu Gln

1490 1495 1500

Gly Pro Glu Thr Ile Asn Gln Val Thr Glu His Lys Met Ser Ala Glu

1505 1510 1515 1520

<210> SEQ ID NO 5

<211> LENGTH: 1522

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 5

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Leu Arg Val Thr Gly Asp Ile Thr Cys Asn Asp Glu Ser

100 105 110

Ser Asp Gly Phe Thr Phe Thr Pro Gly Asp Lys Val Thr Cys Val Ala

115 120 125

Gly Asn Asn Thr Thr Ile Ala Thr Phe Asp Thr Gln Ser Glu Ala Ala

130 135 140

Arg Ser Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala

145 150 155 160

Gln Glu Leu Ala Gly Ser Asp Asn Lys Lys Ser Asn Ala Leu Ser Leu

165 170 175

Val Thr Ser Met Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu

180 185 190

Glu Phe Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys

195 200 205

Gln Ile Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu

210 215 220

Val Glu Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser

225 230 235 240

Pro Val Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala

245 250 255

Ser Phe Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Ser

260 265 270

Glu Ile Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Gln Gly Tyr Gly

275 280 285

Val Ala Gly Val Asn Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Gly

290 295 300

Glu Asn Gly Glu Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly

305 310 315 320

Ile Asp Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile

325 330 335

Ala Leu Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln

340 345 350

Leu Ile His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val

355 360 365

Pro Asp Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn

370 375 380

Glu Ile Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Asp Glu Gly

385 390 395 400

Glu Gln Val Val Asn Leu Pro Asn Glu Phe Ile Glu Gln Phe Lys Thr

405 410 415

Gly Gln Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly

420 425 430

Cys Asn Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp

435 440 445

Gly Gln Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn

450 455 460

Tyr Lys Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe

465 470 475 480

Tyr Gly Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser

485 490 495

Asn Ala Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp

500 505 510

Leu Ala Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr

515 520 525

Ile Thr Glu Ala Pro Ser Leu Val Glu Pro Glu Asn Val Thr Arg Asp

530 535 540

Thr Ala Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu

545 550 555 560

Gly Lys Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg

565 570 575

Cys Pro Asn Gly Tyr Ser Trp Asn Gly Gly Val Asn Lys Asp Gly Gln

580 585 590

Cys Thr Leu Asn Ser Asp Pro Asp Asp Met Lys Asn Phe Met Glu Asn

595 600 605

Val Leu Arg Tyr Leu Ser Asp Asp Lys Trp Thr Pro Asp Ala Lys Ala

610 615 620

Ser Met Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Arg His

625 630 635 640

Gly Gln Val Thr Gly Asn Ser Ala Ala Phe Asp Phe His Pro Asp Phe

645 650 655

Ala Gly Ile Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro

660 665 670

Gln Glu Met Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln

675 680 685

Val Gly Asn Asp Pro Tyr Ala Ile Pro Leu Arg Ala Asp Thr Ser Lys

690 695 700

Pro Lys Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn

705 710 715 720

Lys Gly Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys

725 730 735

Glu Glu Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu

740 745 750

Ser Met Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr

755 760 765

Pro Asn Arg Val Arg Gln Gln Arg Ala Thr Gly Ile Trp Val Tyr Glu

770 775 780

Arg Tyr Pro Ala Val Asp Gly Ala Leu Pro Tyr Thr Ile Asp Ser Lys

785 790 795 800

Thr Gly Glu Val Lys Trp Lys Tyr Gln Val Glu Asn Lys Pro Asp Asp

805 810 815

Lys Pro Lys Leu Glu Val Ala Ser Trp Leu Glu Asp Val Asp Gly Lys

820 825 830

Gln Glu Thr Arg Tyr Ala Phe Ile Asp Glu Ala Asp His Lys Thr Glu

835 840 845

Asp Ser Leu Lys Ala Ala Lys Glu Lys Ile Phe Ala Ala Phe Pro Gly

850 855 860

Leu Lys Glu Cys Thr Asn Pro Ala Tyr His Tyr Glu Val Asn Cys Leu

865 870 875 880

Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr Gly Gly Met Tyr Val

885 890 895

Pro Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp Thr Ala Lys Ala Met

900 905 910

Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His

915 920 925

Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Cys

930 935 940

Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn

945 950 955 960

Asp Thr Ser Tyr Arg Tyr Glu Glu Gly Lys Asn Asp Glu Leu Gly Phe

965 970 975

Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Ala

980 985 990

Gly Gly Thr Lys Cys Ser Ala Asp Leu Lys Lys Ser Leu Val Asp Asn

995 1000 1005

Asn Met Ile Tyr Gly Asp Gly Ser Ser Lys Ala Gly Met Met Asn Pro

1010 1015 1020

Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu

1025 1030 1035 1040

Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr

1045 1050 1055

Pro Gly Ala Val Ser Glu Glu Gly Gln Asn Val Thr Glu Thr Ile Ser

1060 1065 1070

Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr

1075 1080 1085

Gly Leu Trp Ala Pro Ala Gln Lys Glu Val Thr Ile Lys Ser Asn Ala

1090 1095 1100

Asn Val Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly

1105 1110 1115 1120

Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro Arg Val Thr Lys

1125 1130 1135

Thr Tyr Ser Leu Asp Ala Ser Gly Thr Val Lys Phe Lys Val Pro Tyr

1140 1145 1150

Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser Ser Thr Asn Glu Ser Ala

1155 1160 1165

Ser Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly

1170 1175 1180

Ala Trp Lys Asn Asp Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu

1185 1190 1195 1200

Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Asn Ala Ser

1205 1210 1215

Asn Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn Asp Leu Asp Thr Phe

1220 1225 1230

Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp Ser Glu Asp Gly Lys

1235 1240 1245

His Arg Met Phe Thr Tyr Lys Asn Leu Pro Gly His Lys His Arg Phe

1250 1255 1260

Ala Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro

1265 1270 1275 1280

Val Met Asn Ser Ser Phe Ser Pro Asn Ser Thr Thr Leu Pro Thr Thr

1285 1290 1295

Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala

1300 1305 1310

Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val

1315 1320 1325

Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val

1330 1335 1340

Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Gly

1345 1350 1355 1360

Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala

1365 1370 1375

Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Lys Trp Tyr

1380 1385 1390

Pro Asp Gly Thr Pro Leu Pro Glu Phe Tyr Ser Glu Arg Glu Gly Met

1395 1400 1405

Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp

1410 1415 1420

Glu Val Ser Asn Asp Lys Phe Gly Gly Lys Asn Tyr Cys Ala Glu Ser

1425 1430 1435 1440

Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala

1445 1450 1455

Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn

1460 1465 1470

Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met Ser Phe Glu Gly Gly Val

1475 1480 1485

Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu Lys Leu Pro Lys Pro

1490 1495 1500

Glu Gln Gly Pro Glu Thr Ile Asn Lys Val Thr Glu His Lys Met Ser

1505 1510 1515 1520

Val Glu

<210> SEQ ID NO 6

<211> LENGTH: 1520

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 6

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Leu Arg Val Thr Gly Asp Ile Thr Cys Asn Asp Glu Ser

100 105 110

Ser Asp Gly Phe Thr Phe Thr Pro Gly Asp Lys Val Thr Cys Val Ala

115 120 125

Gly Asn Asn Thr Thr Ile Ala Thr Phe Asp Thr Gln Ser Glu Ala Ala

130 135 140

Arg Ser Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala

145 150 155 160

Gln Glu Leu Ala Gly Ser Asp Asn Lys Lys Ser Asn Ala Leu Ser Leu

165 170 175

Val Thr Ser Met Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu

180 185 190

Glu Phe Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys

195 200 205

Gln Ile Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu

210 215 220

Val Glu Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser

225 230 235 240

Pro Val Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala

245 250 255

Ser Phe Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Ser

260 265 270

Glu Ile Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Gln Gly Tyr Gly

275 280 285

Val Ala Gly Val Asn Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Gly

290 295 300

Glu Asn Gly Glu Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly

305 310 315 320

Ile Asp Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile

325 330 335

Ala Leu Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln

340 345 350

Leu Ile His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val

355 360 365

Pro Asp Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn

370 375 380

Glu Ile Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Gly Glu Gly

385 390 395 400

Glu Gln Val Val Asn Leu Pro Asn Glu Phe Ile Glu Gln Phe Lys Thr

405 410 415

Gly Gln Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly

420 425 430

Cys Asn Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp

435 440 445

Gly Gln Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn

450 455 460

Tyr Lys Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe

465 470 475 480

Tyr Gly Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser

485 490 495

Asn Ala Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp

500 505 510

Leu Ala Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Asp Leu Ala Tyr

515 520 525

Ile Thr Glu Ala Pro Ser Ile Val Arg Pro Glu Asn Val Thr Arg Glu

530 535 540

Thr Ala Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Asp

545 550 555 560

Gly Lys Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg

565 570 575

Cys Pro Asn Gly Tyr Ser Trp Asn Gly Gly Val Asn Lys Asp Gly Gln

580 585 590

Cys Thr Leu Asn Ser Asp Pro Asp Asp Met Lys Asn Phe Met Glu Asn

595 600 605

Val Leu Arg Tyr Leu Ser Asn Asp Arg Trp Leu Pro Asp Ala Lys Ser

610 615 620

Ser Met Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Lys His

625 630 635 640

Gly Gln Val Leu Gly Asn Ser Ala Pro Phe Ala Phe His Lys Asp Phe

645 650 655

Thr Gly Ile Thr Val Lys Pro Met Thr Ser Tyr Gly Asn Leu Asn Pro

660 665 670

Asp Glu Val Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln

675 680 685

Trp Gly Ser Asp Pro Tyr Ser Ile Pro Leu Arg Ala Asp Thr Ser Lys

690 695 700

Pro Lys Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Met Asn

705 710 715 720

Lys Gly Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys

725 730 735

Glu Glu Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu

740 745 750

Ser Met Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr

755 760 765

Pro Asp Arg Val Arg Gln Arg Arg Ser Thr Pro Ile Trp Val Tyr Glu

770 775 780

Arg Tyr Pro Ala Val Asp Gly Lys Pro Pro Tyr Thr Ile Asp Asp Thr

785 790 795 800

Thr Lys Glu Val Ile Trp Lys Tyr Gln Gln Glu Asn Lys Pro Asp Asp

805 810 815

Lys Pro Lys Leu Glu Val Ala Ser Trp Gln Glu Glu Val Glu Gly Lys

820 825 830

Gln Val Thr Gln Phe Ala Phe Ile Asp Glu Ala Asp His Lys Thr Pro

835 840 845

Glu Ser Leu Ala Ala Ala Lys Gln Arg Ile Leu Asp Ala Phe Pro Gly

850 855 860

Leu Glu Val Cys Lys Asp Ser Asp Tyr His Tyr Glu Val Asn Cys Leu

865 870 875 880

Glu Tyr Arg Pro Gly Ser Gly Val Pro Val Thr Gly Gly Met Tyr Val

885 890 895

Pro Gln Tyr Thr Gln Leu Asp Leu Gly Ala Asp Thr Ala Lys Ala Met

900 905 910

Leu Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His

915 920 925

Glu Leu Tyr Phe Arg Thr Asn Gly Arg Gln Gly Glu Arg Leu Asn Ser

930 935 940

Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn

945 950 955 960

Glu Thr Lys Tyr Arg Tyr Glu Glu Gly Lys Glu Asp Glu Leu Gly Phe

965 970 975

Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Thr Asn Asn Ala Tyr Val

980 985 990

Gly Thr Gln Cys Ser Ala Glu Leu Lys Lys Ser Leu Ile Asp Asn Lys

995 1000 1005

Met Ile Tyr Gly Glu Glu Ser Ser Lys Ala Gly Met Met Asn Pro Ser

1010 1015 1020

Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly

1025 1030 1035 1040

Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro

1045 1050 1055

Gly Ala Val Ser Glu Glu Gly Gln Asn Val Thr Glu Thr Ile Ser Leu

1060 1065 1070

Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly

1075 1080 1085

Leu Trp Ala Pro Ala Gln Lys Glu Val Thr Ile Lys Ser Asn Ala Asn

1090 1095 1100

Val Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg

1105 1110 1115 1120

Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro Arg Val Thr Lys Thr

1125 1130 1135

Tyr Ser Leu Asp Ala Ser Gly Thr Val Lys Phe Lys Val Pro Tyr Gly

1140 1145 1150

Gly Leu Ile Tyr Ile Lys Gly Asn Ser Ser Thr Asn Glu Ser Ala Ser

1155 1160 1165

Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Ala

1170 1175 1180

Trp Lys Asn Asp Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser

1185 1190 1195 1200

Asp Ala Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Asn Ala Ser Asn

1205 1210 1215

Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn Asp Leu Asp Thr Phe Ala

1220 1225 1230

Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp Ser Glu Ser Gly Lys His

1235 1240 1245

Arg Met Phe Thr Tyr Lys Asn Leu Thr Gly His Lys His Arg Phe Ala

1250 1255 1260

Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val

1265 1270 1275 1280

Met Asn Ser Ser Phe Ser Pro Asn Ser Thr Thr Leu Pro Thr Thr Pro

1285 1290 1295

Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu

1300 1305 1310

Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu

1315 1320 1325

Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala

1330 1335 1340

Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Gly Gln

1345 1350 1355 1360

Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln

1365 1370 1375

Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Lys Trp Tyr Pro

1380 1385 1390

Glu Gly Glu Leu Pro Lys Phe Phe Ser Asp Arg Glu Gly Met Lys Gly

1395 1400 1405

Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Asp Val

1410 1415 1420

Gly Asn Lys Thr Phe Gly Gly Lys Asn Tyr Cys Ala Glu Ser Asn Gly

1425 1430 1435 1440

Asn Ala Ala Asp Ser Leu Met Leu Cys Ala Ser Trp Val Ala Gln Thr

1445 1450 1455

Asp Leu Ser Ala Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr

1460 1465 1470

Gln Leu Pro Gly Ala Thr Glu Met Ser Phe Glu Gly Gly Val Ser Gln

1475 1480 1485

Ser Ala Tyr Ser Thr Leu Ala Ser Leu Lys Leu Pro Lys Pro Glu Gln

1490 1495 1500

Gly Pro Glu Thr Ile Asn Lys Val Thr Glu His Lys Met Ser Leu Glu

1505 1510 1515 1520

<210> SEQ ID NO 7

<211> LENGTH: 1521

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 7

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Leu Arg Val Thr Gly Asp Ile Thr Cys Asn Asp Glu Ser

100 105 110

Ser Asp Gly Phe Thr Phe Thr Pro Gly Asp Lys Val Thr Cys Val Ala

115 120 125

Gly Asn Asn Thr Thr Ile Ala Thr Phe Asp Thr Gln Ser Glu Ala Ala

130 135 140

Arg Ser Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala

145 150 155 160

Gln Glu Leu Ala Gly Ser Asp Asn Lys Lys Ser Asn Ala Leu Ser Leu

165 170 175

Val Thr Ser Met Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu

180 185 190

Glu Phe Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys

195 200 205

Gln Ile Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu

210 215 220

Val Glu Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser

225 230 235 240

Pro Val Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala

245 250 255

Ser Phe Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Ser

260 265 270

Glu Ile Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Gln Gly Tyr Gly

275 280 285

Val Ala Gly Val Asn Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Gly

290 295 300

Glu Asn Gly Glu Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly

305 310 315 320

Ile Asp Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile

325 330 335

Ala Leu Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln

340 345 350

Leu Ile His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val

355 360 365

Pro Asp Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn

370 375 380

Glu Ile Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Asp Glu Gly

385 390 395 400

Glu Gln Val Val Asn Leu Pro Asn Glu Phe Ile Glu Gln Phe Lys Thr

405 410 415

Gly Gln Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly

420 425 430

Cys Asn Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp

435 440 445

Gly Gln Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn

450 455 460

Tyr Lys Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe

465 470 475 480

Tyr Gly Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser

485 490 495

Asn Ala Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp

500 505 510

Leu Ala Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr

515 520 525

Ile Thr Glu Ala Pro Ser Leu Val Glu Pro Glu Asn Val Thr Arg Asp

530 535 540

Thr Ala Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu

545 550 555 560

Gly Lys Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg

565 570 575

Cys Pro Asn Gly Tyr Ser Trp Asn Gly Gly Val Asn Lys Asp Gly Gln

580 585 590

Cys Thr Leu Asn Ser Asp Pro Asp Asp Met Lys Asn Phe Met Glu Asn

595 600 605

Val Leu Arg Tyr Leu Ser Asp Asp Lys Trp Thr Pro Asp Ala Lys Ala

610 615 620

Ser Met Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Arg His

625 630 635 640

Gly Gln Val Thr Gly Asn Ser Ala Ala Phe Asp Phe His Pro Asp Phe

645 650 655

Ala Gly Ile Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro

660 665 670

Gln Glu Met Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln

675 680 685

Val Gly Asn Asp Pro Tyr Ala Ile Pro Leu Arg Ala Asp Thr Ser Lys

690 695 700

Pro Lys Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn

705 710 715 720

Lys Gly Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys

725 730 735

Glu Glu Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu

740 745 750

Ser Met Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr

755 760 765

Pro Asn Arg Val Arg Gln Gln Arg Ala Thr Gly Ile Trp Val Tyr Glu

770 775 780

Arg Tyr Pro Ala Val Asp Gly Ala Leu Pro Tyr Thr Ile Asp Ser Lys

785 790 795 800

Thr Gly Glu Val Lys Trp Lys Tyr Gln Val Glu Asn Lys Pro Asp Asp

805 810 815

Lys Pro Lys Leu Glu Val Ala Ser Trp Leu Glu Asp Val Asp Gly Lys

820 825 830

Gln Glu Thr Arg Tyr Ala Phe Ile Asp Glu Ala Asp His Lys Thr Glu

835 840 845

Asp Ser Leu Lys Ala Ala Lys Glu Lys Ile Phe Ala Ala Phe Pro Gly

850 855 860

Leu Lys Glu Cys Thr Asn Pro Ala Tyr His Tyr Glu Val Asn Cys Leu

865 870 875 880

Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr Gly Gly Met Tyr Val

885 890 895

Pro Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp Thr Ala Lys Ala Met

900 905 910

Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His

915 920 925

Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser

930 935 940

Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn

945 950 955 960

Asp Thr Ser Tyr Arg Tyr Glu Glu Gly Lys Asn Asp Glu Leu Gly Phe

965 970 975

Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Ala

980 985 990

Gly Gly Thr Lys Cys Ser Ala Asp Leu Lys Lys Ser Leu Val Asp Asn

995 1000 1005

Asn Met Ile Tyr Gly Asp Gly Ser Ser Lys Ala Gly Met Met Asn Pro

1010 1015 1020

Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu

1025 1030 1035 1040

Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr

1045 1050 1055

Pro Gly Ala Val Ser Glu Glu Gly Gln Asn Val Thr Glu Thr Ile Ser

1060 1065 1070

Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr

1075 1080 1085

Gly Leu Trp Ala Pro Ala Gln Lys Glu Val Thr Ile Lys Ser Asn Ala

1090 1095 1100

Asn Val Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly

1105 1110 1115 1120

Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro Arg Val Thr Lys

1125 1130 1135

Thr Tyr Ser Leu Asp Ala Ser Gly Thr Val Lys Phe Lys Val Pro Tyr

1140 1145 1150

Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser Ser Thr Asn Glu Ser Ala

1155 1160 1165

Ser Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly

1170 1175 1180

Ala Trp Lys Asn Asp Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu

1185 1190 1195 1200

Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Asn Ala Ser

1205 1210 1215

Asn Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn Asp Leu Asp Thr Phe

1220 1225 1230

Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp Glu Thr Ser Gly Lys

1235 1240 1245

His Arg Met Phe Thr Tyr Lys Asn Leu Thr Gly His Lys His Arg Phe

1250 1255 1260

Thr Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro

1265 1270 1275 1280

Val Met Asn Ser Ser Phe Ser Thr Asn Ser Thr Thr Leu Pro Thr Thr

1285 1290 1295

Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala

1300 1305 1310

Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val

1315 1320 1325

Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val

1330 1335 1340

Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Gly

1345 1350 1355 1360

Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala

1365 1370 1375

Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Lys Trp Tyr

1380 1385 1390

Pro Glu Gly Glu Leu Pro Lys Phe Phe Ser Asp Arg Glu Gly Met Lys

1395 1400 1405

Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Asp

1410 1415 1420

Val Gly Asp Lys Thr Phe Gly Gly Lys Asn Tyr Cys Ala Glu Ser Asn

1425 1430 1435 1440

Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln

1445 1450 1455

Thr Asp Leu Ser Ala Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala

1460 1465 1470

Tyr Gln Leu Pro Gly Ala Thr Glu Met Ser Phe Glu Gly Gly Val Ser

1475 1480 1485

Gln Ser Ala Tyr Ser Thr Leu Ala Ser Leu Lys Leu Pro Lys Pro Glu

1490 1495 1500

Gln Gly Pro Glu Thr Ile Asn Lys Val Thr Glu His Lys Met Ser Leu

1505 1510 1515 1520

Glu

<210> SEQ ID NO 8

<211> LENGTH: 1521

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 8

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Leu Arg Val Thr Gly Asp Ile Thr Cys Asn Asp Glu Ser

100 105 110

Ser Asp Gly Phe Thr Phe Thr Pro Gly Asp Lys Val Thr Cys Val Ala

115 120 125

Gly Asn Asn Thr Thr Ile Ala Thr Phe Asp Thr Gln Ser Glu Ala Ala

130 135 140

Arg Ser Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala

145 150 155 160

Gln Glu Leu Ala Gly Ser Asp Asn Lys Lys Ser Asn Ala Leu Ser Leu

165 170 175

Val Thr Ser Met Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu

180 185 190

Glu Phe Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys

195 200 205

Gln Ile Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu

210 215 220

Val Glu Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser

225 230 235 240

Pro Val Val Pro Ala Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala

245 250 255

Ser Phe Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr

260 265 270

Glu Ile Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Gln Gly Asp Gly

275 280 285

Val Val Gly Val Asn Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Gly

290 295 300

Glu Asn Gly Glu Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly

305 310 315 320

Ile Asp Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile

325 330 335

Ala Leu Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln

340 345 350

Leu Ile His Arg Tyr Ser Lys Ala Gly Gln Asn His Thr Arg Val Val

355 360 365

Pro Asp Glu Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn

370 375 380

Glu Ile Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Gly Glu Gly

385 390 395 400

Glu Gln Val Val Asn Leu Pro Asn Glu Phe Ile Glu Gln Phe Lys Thr

405 410 415

Gly Gln Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly

420 425 430

Cys Asn Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp

435 440 445

Gly Lys Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn

450 455 460

Tyr Lys Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe

465 470 475 480

Tyr Gly Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser

485 490 495

Asn Ala Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp

500 505 510

Leu Ala Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr

515 520 525

Ile Thr Glu Ala Pro Ser Ile Val Arg Pro Glu Asn Val Thr Arg Glu

530 535 540

Thr Ala Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Asp

545 550 555 560

Gly Lys Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg

565 570 575

Cys Pro Asn Gly Tyr Ser Trp Asn Gly Gly Val Asn Lys Asp Gly Gln

580 585 590

Cys Thr Leu Asn Ser Asp Pro Asp Asp Met Lys Asn Phe Met Glu Asn

595 600 605

Val Leu Arg Tyr Leu Ser Asp Asp Lys Trp Thr Pro Asp Ala Lys Ala

610 615 620

Ser Met Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Arg His

625 630 635 640

Gly Gln Val Thr Gly Asn Ser Ala Ala Phe Asp Phe His Pro Asp Phe

645 650 655

Ala Gly Ile Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro

660 665 670

Gln Glu Met Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln

675 680 685

Val Gly Asn Asp Pro Tyr Ala Ile Pro Leu Arg Ala Asp Thr Ser Lys

690 695 700

Pro Lys Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn

705 710 715 720

Lys Gly Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys

725 730 735

Glu Glu Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu

740 745 750

Ser Met Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr

755 760 765

Pro Asn Arg Val Arg Gln Arg Arg Ser Thr Pro Ile Trp Val Tyr Glu

770 775 780

Arg Tyr Pro Ala Val Asp Gly Lys Pro Pro Tyr Thr Ile Asp Asp Thr

785 790 795 800

Thr Lys Glu Val Ile Trp Lys Tyr Gln Gln Glu Asn Lys Pro Asp Asp

805 810 815

Lys Pro Lys Leu Glu Val Ala Ser Trp Gln Glu Glu Val Glu Gly Lys

820 825 830

Gln Val Thr Gln Phe Ala Phe Ile Asp Glu Ala Asp His Lys Thr Pro

835 840 845

Glu Ser Leu Ala Ala Ala Lys Gln Arg Ile Leu Asp Ala Phe Pro Gly

850 855 860

Leu Glu Val Cys Lys Asp Ser Asp Tyr His Tyr Glu Val Asn Cys Leu

865 870 875 880

Glu Tyr Arg Pro Gly Thr Asp Val Pro Val Thr Gly Gly Met Tyr Val

885 890 895

Pro Gln Tyr Thr Gln Leu Asp Leu Ser Ala Asp Thr Ala Lys Ala Met

900 905 910

Leu Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His

915 920 925

Glu Leu Tyr Phe Arg Thr Asn Gly Arg Gln Gly Glu Arg Leu Asn Ser

930 935 940

Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn

945 950 955 960

Glu Thr Lys Tyr Arg Tyr Glu Glu Gly Lys Glu Asp Glu Leu Gly Phe

965 970 975

Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Thr Asn Asn Ala Tyr Val

980 985 990

Gly Thr Gln Cys Ser Ala Glu Leu Lys Lys Ser Leu Ile Asp Asn Lys

995 1000 1005

Met Ile Tyr Gly Glu Glu Ser Ser Lys Ala Gly Met Met Asn Pro Ser

1010 1015 1020

Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly

1025 1030 1035 1040

Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro

1045 1050 1055

Gly Val Val Asn Thr Asn Gly Glu Thr Val Thr Gln Asn Ile Asn Leu

1060 1065 1070

Tyr Ser Ala Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly

1075 1080 1085

Leu Trp Ala Pro Ala Gln Gln Glu Val Ser Ile Glu Ser Lys Ala Thr

1090 1095 1100

Val Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg

1105 1110 1115 1120

Glu Lys His Glu Val Ser Leu Asn Arg Pro Pro Arg Val Thr Lys Thr

1125 1130 1135

Tyr Asp Leu Lys Ala Asn Asp Lys Val Thr Phe Lys Val Pro Tyr Gly

1140 1145 1150

Gly Leu Ile Tyr Ile Lys Gly Asp Ser Lys Glu Val Gln Ser Ala Asp

1155 1160 1165

Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Lys

1170 1175 1180

Trp Gln His Asp Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser

1185 1190 1195 1200

Ala Ser Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Asn Ala Ser Asn

1205 1210 1215

Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn Asp Leu Asp Thr Phe Ala

1220 1225 1230

Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp Ser Glu Asp Gly Lys His

1235 1240 1245

Arg Met Phe Thr Tyr Lys Asn Leu Pro Gly His Lys His Arg Phe Ala

1250 1255 1260

Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val

1265 1270 1275 1280

Met Asn Ser Ser Phe Ser Pro Asn Ser Thr Thr Leu Pro Thr Thr Pro

1285 1290 1295

Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu

1300 1305 1310

Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu

1315 1320 1325

Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala

1330 1335 1340

Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Gly Gln

1345 1350 1355 1360

Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln

1365 1370 1375

Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Lys Trp Tyr Pro

1380 1385 1390

Asp Gly Thr Pro Leu Pro Glu Phe Tyr Ser Glu Arg Glu Gly Met Lys

1395 1400 1405

Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Glu

1410 1415 1420

Val Ser Asn Asp Lys Phe Gly Gly Lys Asn Tyr Cys Ala Glu Ser Asn

1425 1430 1435 1440

Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln

1445 1450 1455

Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala

1460 1465 1470

Tyr Gln Leu Pro Gly Ala Ser Glu Met Ser Phe Glu Gly Gly Val Ser

1475 1480 1485

Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu Lys Leu Pro Lys Pro Glu

1490 1495 1500

Gln Gly Pro Glu Thr Ile Asn Lys Val Thr Glu His Lys Met Ser Val

1505 1510 1515 1520

Glu

<210> SEQ ID NO 9

<211> LENGTH: 1520

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 9

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Ser Val Asp Ser Gly Ser Gly Thr Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Thr Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Asp Pro Thr Pro Asp Pro Asp Pro Glu Pro

65 70 75 80

Thr Pro Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu

85 90 95

Thr Leu Gly Gly Ser Gln Arg Val Thr Gly Ala Thr Cys Asn Gly Glu

100 105 110

Ser Ser Asp Gly Phe Thr Phe Thr Pro Gly Asn Thr Val Ser Cys Val

115 120 125

Val Gly Ser Thr Thr Ile Ala Thr Phe Asn Thr Gln Ser Glu Ala Ala

130 135 140

Arg Ser Leu Arg Ala Val Asp Lys Val Ser Phe Ser Leu Glu Asp Ala

145 150 155 160

Gln Glu Leu Ala Asn Ser Glu Asn Lys Lys Thr Asn Ala Ile Ser Leu

165 170 175

Val Thr Ser Ser Asp Ser Cys Pro Ala Asp Ala Glu Gln Leu Cys Leu

180 185 190

Thr Phe Ser Ser Val Val Asp Arg Ala Arg Phe Glu Lys Leu Tyr Lys

195 200 205

Gln Ile Asp Leu Ala Thr Asp Asn Phe Ser Lys Leu Val Asn Glu Glu

210 215 220

Val Glu Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser

225 230 235 240

Thr Val Val Pro Val Thr Thr Glu Gly Thr Lys Pro Asp Leu Asn Ala

245 250 255

Ser Phe Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr

260 265 270

Glu Ile Ile Leu Ser Glu Gly Gln Leu Val Asp Ser Leu Gly Asn Gly

275 280 285

Val Ala Gly Val Asp Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Asp

290 295 300

Glu Asn Gly Lys Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly

305 310 315 320

Ile Asp Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile

325 330 335

Ala Leu Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln

340 345 350

Leu Ile His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val

355 360 365

Pro Asp Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn

370 375 380

Glu Ile Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Asp Glu Gly

385 390 395 400

Asp Gln Asn Val Val Leu Pro Asn Glu Phe Ile Glu Gln Phe Lys Thr

405 410 415

Gly Gln Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asn Gly

420 425 430

Cys Asn Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp

435 440 445

Gly Gln Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn

450 455 460

Tyr Gln Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe

465 470 475 480

Tyr Gly Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser

485 490 495

Asn Ala Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp

500 505 510

Leu Ala Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr

515 520 525

Ile Thr Glu Ala Pro Ser Ile Val Gln Pro Glu Asn Val Thr Arg Asp

530 535 540

Thr Ala Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Asp

545 550 555 560

Gly Lys Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg

565 570 575

Cys Pro Asn Gly Tyr Ser Trp Gly Gly Gly Val Asn Ser Lys Gly Glu

580 585 590

Cys Thr Leu Ser Gly Asp Ser Asp Asp Met Lys His Phe Met Gln Asn

595 600 605

Val Leu Arg Tyr Leu Ser Asn Asp Ile Trp Gln Pro Asn Thr Lys Ser

610 615 620

Ile Met Thr Val Gly Thr Asn Leu Glu Asn Val Tyr Phe Lys Lys Ala

625 630 635 640

Gly Gln Val Leu Gly Asn Ser Ala Pro Phe Ala Phe His Glu Asp Phe

645 650 655

Thr Gly Ile Thr Val Lys Gln Leu Thr Ser Tyr Gly Asp Leu Asn Pro

660 665 670

Glu Glu Ile Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln

675 680 685

Trp Ser Gly Asp Pro Tyr Ala Val Pro Leu Arg Ala Asp Thr Ser Lys

690 695 700

Pro Lys Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn

705 710 715 720

Lys Gly Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys

725 730 735

Glu Glu Ser Ala Ser Ser Phe Val Arg Leu Leu Asp Ala Ala Gly Leu

740 745 750

Ser Met Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr

755 760 765

Pro Asp Arg Val Arg Gln Gln Arg Glu Lys Gly Ile Trp Val Tyr Glu

770 775 780

Arg Tyr Pro Phe Val Asp Gly Lys Pro Pro Tyr Thr Ile Asp Glu Thr

785 790 795 800

Thr Lys Glu Val Ile Trp Lys Tyr Gln Gln Asp Asn Lys Pro Asp Asp

805 810 815

Lys Pro Lys Leu Glu Val Ala Ser Trp Leu Glu Asp Val Asp Gly Lys

820 825 830

Gln Val Lys Arg Tyr Ala Phe Ile Asp Glu Ala Glu His Glu Thr Asn

835 840 845

Glu Ser Leu Glu Ala Ala Lys Ala Lys Ile Ile Lys Ala Phe Pro Gly

850 855 860

Leu Glu Glu Cys Lys Asp Pro Thr Tyr His Tyr Glu Val Asn Cys Leu

865 870 875 880

Glu Tyr Arg Pro Gly Thr Asn Val Pro Val Thr Gly Gly Met Tyr Val

885 890 895

Pro Arg Tyr Thr Gln Leu Asn Leu Ser Ala Asp Thr Ala Lys Ala Met

900 905 910

Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His

915 920 925

Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser

930 935 940

Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn

945 950 955 960

Glu Ile Glu Tyr Ser Tyr Asp Ser Ser Lys Glu Asp Glu Leu Gly Phe

965 970 975

Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Thr

980 985 990

Lys Gly Thr Leu Cys Ser Ala Glu Leu Lys Gln Ser Leu Ile Asp Asn

995 1000 1005

Lys Met Ile Tyr Gly Glu Gly Ser Lys Ala Gly Met Met Asn Pro Ser

1010 1015 1020

Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly

1025 1030 1035 1040

Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro

1045 1050 1055

Gly Ala Val Ser Val Gly Gly Glu Glu Val Thr Glu Thr Ile Ser Leu

1060 1065 1070

Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly

1075 1080 1085

Leu Trp Ala Pro Ala Gln Lys Glu Val Thr Ile Lys Ser Asn Ala Asn

1090 1095 1100

Val Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg

1105 1110 1115 1120

Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro Arg Val Thr Lys Thr

1125 1130 1135

Tyr Ser Leu Asp Ala Ser Gly Thr Val Lys Phe Lys Val Pro Tyr Gly

1140 1145 1150

Gly Leu Ile Tyr Ile Lys Gly Asn Ser Ser Thr Asn Glu Ser Ala Ser

1155 1160 1165

Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Ala

1170 1175 1180

Trp Lys Asn Asp Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser

1185 1190 1195 1200

Ala Ser Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Asn Ala Ser Asn

1205 1210 1215

Tyr Thr Gly Gly Leu Asp Gln Phe Ala Lys Asp Leu Asp Thr Phe Ala

1220 1225 1230

Ser Ser Met Asn Asp Phe Tyr Gly Arg Asn Asp Glu Asp Gly Lys His

1235 1240 1245

Arg Met Phe Thr Tyr Lys Asn Leu Thr Gly His Lys His Arg Phe Thr

1250 1255 1260

Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val

1265 1270 1275 1280

Met Asn Ser Ser Phe Ser Thr Asn Ser Thr Thr Leu Pro Thr Thr Pro

1285 1290 1295

Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu

1300 1305 1310

Thr Pro Leu Asn Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu

1315 1320 1325

Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala

1330 1335 1340

Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Asp Glu Ser Asn Gly Gln

1345 1350 1355 1360

Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln

1365 1370 1375

Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile Thr Lys Trp Tyr Pro

1380 1385 1390

Asp Gly Lys Leu Pro Ala Phe Tyr Ser Glu Arg Glu Gly Met Lys Gly

1395 1400 1405

Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Asp Val

1410 1415 1420

Gly Asn Ser Thr Phe Gly Gly Lys Asn Tyr Cys Ala Glu Ser Asn Gly

1425 1430 1435 1440

Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln Thr

1445 1450 1455

Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr

1460 1465 1470

Gln Leu Pro Gly Ala Ala Glu Met Ser Phe Glu Gly Gly Val Ser Ser

1475 1480 1485

Ser Ala Tyr Ser Thr Leu Ala Ser Leu Asn Leu Pro Lys Pro Glu Lys

1490 1495 1500

Gly Pro Glu Thr Ile Asn Lys Val Thr Glu His Lys Met Ser Ala Glu

1505 1510 1515 1520

<210> SEQ ID NO 10

<211> LENGTH: 1519

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 10

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Ile Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Gln Arg Val Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser

100 105 110

Asp Gly Phe Thr Phe Lys Pro Gly Glu Asp Val Thr Cys Val Ala Gly

115 120 125

Asn Thr Thr Ile Ala Thr Phe Asn Thr Gln Ser Glu Ala Ala Arg Ser

130 135 140

Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu

145 150 155 160

Leu Ala Gly Ser Asp Asp Lys Lys Ser Asn Ala Val Ser Leu Val Thr

165 170 175

Ser Ser Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu Thr Phe

180 185 190

Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile

195 200 205

Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu

210 215 220

Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val

225 230 235 240

Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe

245 250 255

Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile

260 265 270

Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Gln Gly Tyr Gly Val Ala

275 280 285

Gly Val Asn Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn

290 295 300

Gly Glu Phe Ser Phe Ser Trp Gly Glu Ala Ile Ser Phe Gly Ile Asp

305 310 315 320

Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu

325 330 335

Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile

340 345 350

His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp

355 360 365

Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile

370 375 380

Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Gly Glu Gly Glu Gln

385 390 395 400

Val Val Asn Leu Pro Asn Glu Phe Ile Glu Gln Phe Asn Thr Gly Gln

405 410 415

Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn

420 425 430

Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln

435 440 445

Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys

450 455 460

Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr Gly

465 470 475 480

Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala

485 490 495

Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala

500 505 510

Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr

515 520 525

Glu Ala Pro Ser Ile Val Arg Pro Glu Asn Val Thr Arg Glu Thr Ala

530 535 540

Ser Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Asp Gly Lys

545 550 555 560

Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro

565 570 575

Asn Gly Tyr Ser Trp Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr

580 585 590

Leu Asn Ser Asp Pro Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu

595 600 605

Arg Tyr Leu Ser Asn Asp Arg Trp Leu Pro Asp Ala Lys Ser Ser Met

610 615 620

Thr Val Gly Thr Asn Leu Glu Thr Val Tyr Phe Lys Lys His Gly Gln

625 630 635 640

Val Leu Gly Asn Ser Ala Pro Phe Ala Phe His Lys Asp Phe Thr Gly

645 650 655

Ile Thr Val Lys Pro Met Thr Ser Tyr Gly Asn Leu Asn Pro Asp Glu

660 665 670

Val Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Trp Gly

675 680 685

Ser Asp Pro Tyr Ser Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys

690 695 700

Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Met Asn Lys Gly

705 710 715 720

Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu

725 730 735

Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met

740 745 750

Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asp

755 760 765

Arg Val Arg Gln Arg Arg Ser Thr Pro Ile Trp Val Tyr Glu Arg Tyr

770 775 780

Pro Ala Val Asp Gly Lys Pro Pro Tyr Thr Ile Asp Asp Thr Thr Lys

785 790 795 800

Glu Val Ile Trp Lys Tyr Gln Gln Glu Asn Lys Pro Asp Asp Lys Pro

805 810 815

Lys Leu Glu Val Ala Ser Trp Gln Glu Glu Val Glu Gly Lys Gln Val

820 825 830

Thr Gln Phe Ala Phe Ile Asp Glu Ala Asp His Lys Thr Pro Glu Ser

835 840 845

Leu Ala Ala Ala Lys Gln Arg Ile Leu Asp Ala Phe Pro Gly Leu Glu

850 855 860

Val Cys Lys Asp Ser Asp Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr

865 870 875 880

Arg Pro Gly Thr Asp Val Pro Val Thr Gly Gly Met Tyr Val Pro Gln

885 890 895

Tyr Thr Gln Leu Asp Leu Ser Ala Asp Thr Ala Lys Ala Met Leu Gln

900 905 910

Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu

915 920 925

Tyr Phe Arg Thr Asn Gly Arg Gln Gly Glu Arg Leu Asn Ser Val Asp

930 935 940

Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Glu Thr

945 950 955 960

Lys Tyr Arg Tyr Glu Glu Gly Lys Glu Asp Glu Leu Gly Phe Lys Thr

965 970 975

Phe Thr Glu Phe Leu Asn Cys Tyr Thr Asn Asn Ala Tyr Val Gly Thr

980 985 990

Gln Cys Ser Ala Glu Leu Lys Lys Ser Leu Ile Asp Asn Lys Met Ile

995 1000 1005

Tyr Gly Glu Glu Ser Ser Lys Ala Gly Met Met Asn Pro Ser Tyr Pro

1010 1015 1020

Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser

1025 1030 1035 1040

Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Val

1045 1050 1055

Val Asn Thr Asn Gly Glu Thr Val Thr Gln Asn Ile Asn Leu Tyr Ser

1060 1065 1070

Ala Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp

1075 1080 1085

Ala Pro Ala Gln Gln Glu Val Ser Ile Glu Ser Lys Ser Thr Val Pro

1090 1095 1100

Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys

1105 1110 1115 1120

His Glu Val Ser Leu Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr Asp

1125 1130 1135

Leu Lys Ala Asn Asp Lys Val Thr Phe Lys Val Pro Tyr Gly Gly Leu

1140 1145 1150

Ile Tyr Ile Lys Gly Asp Ser Lys Glu Val Gln Ser Ala Asp Phe Thr

1155 1160 1165

Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Lys Trp Gln

1170 1175 1180

His Asp Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Ala Ser

1185 1190 1195 1200

Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Asn Ala Ser Asn Tyr Thr

1205 1210 1215

Gly Gly Leu Glu Gln Phe Ala Asn Asp Leu Asp Thr Phe Ala Ser Ser

1220 1225 1230

Met Asn Asp Phe Tyr Gly Arg Asp Ser Glu Asp Gly Lys His Arg Met

1235 1240 1245

Phe Thr Tyr Lys Asn Leu Pro Gly His Lys His Arg Phe Ala Asn Asp

1250 1255 1260

Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn

1265 1270 1275 1280

Ser Ser Phe Ser Pro Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn

1285 1290 1295

Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu Thr Pro

1300 1305 1310

Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu

1315 1320 1325

Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp

1330 1335 1340

Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Gly Gln Ala Trp

1345 1350 1355 1360

Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys

1365 1370 1375

Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Lys Trp Tyr Pro Asp Gly

1380 1385 1390

Thr Pro Leu Pro Glu Phe Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp

1395 1400 1405

Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Glu Val Ser

1410 1415 1420

Asn Asp Lys Phe Gly Gly Lys Asn Tyr Cys Ala Glu Ser Asn Gly Asn

1425 1430 1435 1440

Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln Thr Asp

1445 1450 1455

Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln

1460 1465 1470

Leu Pro Gly Ala Ser Glu Met Ser Phe Glu Gly Gly Val Ser Gln Ser

1475 1480 1485

Ala Tyr Asn Thr Leu Ala Ser Leu Asp Leu Pro Lys Pro Glu Gln Gly

1490 1495 1500

Pro Glu Thr Ile Asn Gln Val Thr Glu His Lys Met Ser Ala Glu

1505 1510 1515

<210> SEQ ID NO 11

<211> LENGTH: 1523

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 11

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Gln Arg Ile Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser

100 105 110

Asp Gly Phe Thr Phe Thr Pro Gly Asp Lys Val Thr Cys Val Ala Gly

115 120 125

Asn Asn Thr Thr Ile Ala Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg

130 135 140

Ser Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala Gln

145 150 155 160

Glu Leu Ala Ala Ser Asp Asp Lys Lys Ser Asn Ala Val Ser Leu Val

165 170 175

Thr Ser Ser Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu Thr

180 185 190

Phe Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln

195 200 205

Ile Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu Val

210 215 220

Glu Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Pro

225 230 235 240

Val Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser

245 250 255

Phe Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu

260 265 270

Ile Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Met Gly Asn Gly Val

275 280 285

Val Gly Val Asn Tyr Tyr Thr Ser Ser Gly Arg Gly Val Thr Gly Glu

290 295 300

Asn Gly Lys Phe Asn Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile

305 310 315 320

Asp Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala

325 330 335

Leu Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu

340 345 350

Ile His Arg Tyr Ser Gln Ala Gly Lys Asn Asp Glu Arg Glu Val Pro

355 360 365

Asp Val Val Arg Lys Val Phe Ala Ala Tyr Pro Asn Val Ile Asn Glu

370 375 380

Ile Ile Asn Leu Ser Leu Ser Asn Gly Glu Ala Leu Ser Glu Gly Asp

385 390 395 400

Gln Thr Phe Glu Arg Thr Asn Glu Phe Leu Glu Gln Phe Glu Ser Gly

405 410 415

Gln Ala Lys Glu Ile Asp Thr Ala Ile Cys Asp Ser Leu Gly Gly Cys

420 425 430

Asn Ser Gln Arg Trp Phe Ser Leu Thr Ala Arg Asn Val Asn Glu Gly

435 440 445

Gln Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Lys Asp Tyr

450 455 460

Lys Ser Val Thr Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr

465 470 475 480

Gly Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn

485 490 495

Ala Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu

500 505 510

Ala Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile

515 520 525

Thr Glu Ala Pro Ser Leu Val Glu Pro Glu Asn Val Thr Arg Asp Thr

530 535 540

Ala Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu Gly

545 550 555 560

Lys Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys

565 570 575

Pro Asn Gly Tyr Ser Trp Glu Gly Gly Val Asp Lys Asn Gly Gln Cys

580 585 590

Thr Arg Asn Ser Asp Ser Asn Asp Met Lys His Phe Met Gln Asn Val

595 600 605

Leu Arg Tyr Leu Ser Asn Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser

610 615 620

Met Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Arg His Gly

625 630 635 640

Gln Val Thr Gly Asn Ser Ala Glu Phe Gly Phe His Pro Asp Phe Ala

645 650 655

Gly Ile Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln

660 665 670

Lys Met Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Val

675 680 685

Gly Gly Asp Pro Tyr Ala Val Pro Leu Arg Ala Asp Thr Ser Lys Pro

690 695 700

Lys Leu Ser Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys

705 710 715 720

Gly Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu

725 730 735

Glu Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser

740 745 750

Met Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro

755 760 765

Asp Arg Val Arg Gln Arg Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg

770 775 780

Tyr Pro Val Val Glu Gly Glu Leu Pro Tyr Thr Ile Asp Ser Lys Thr

785 790 795 800

Gly Lys Val Thr Trp Lys Tyr Gln Ile Asp Asn Lys Pro Asp Lys Lys

805 810 815

Pro Lys Leu Glu Val Ala Ser Trp Gln Glu Glu Val Asp Gly Lys Gln

820 825 830

Val Thr Gln Phe Ala Phe Ile Asp Glu Ala Asp His Lys Thr Thr Glu

835 840 845

Ser Leu Asp Ala Ala Lys Lys Lys Ile Leu Glu Lys Phe Lys Gly Leu

850 855 860

Glu Glu Cys Lys Asp Ser Thr Tyr His Tyr Glu Ile Asn Cys Leu Glu

865 870 875 880

Tyr Arg Pro Gly Thr Asn Val Pro Ala Thr Gly Gly Met Tyr Val Pro

885 890 895

Arg Tyr Thr Gln Leu Asn Leu Ser Ala Asp Thr Ala Lys Ala Met Val

900 905 910

Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu

915 920 925

Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser Val

930 935 940

Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Glu

945 950 955 960

Ile Glu Tyr Ser Tyr Asp Ser Ser Lys Glu Asp Glu Leu Gly Phe Lys

965 970 975

Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Thr Gly

980 985 990

Gly Thr Gln Cys Ser Asp Glu Leu Lys Lys Ser Leu Val Asp Asn Asn

995 1000 1005

Met Ile Tyr Gly Glu Lys Ser Val Asn Lys Ala Gly Met Met Asn Pro

1010 1015 1020

Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu

1025 1030 1035 1040

Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr

1045 1050 1055

Pro Gly Ala Val Ser Glu Glu Gly Gln Glu Val Thr Glu Ser Ile Ser

1060 1065 1070

Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr

1075 1080 1085

Gly Leu Trp Ala Pro Ala Gln Lys Glu Val Thr Ile Lys Ser Asn Ala

1090 1095 1100

Asp Val Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly

1105 1110 1115 1120

Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro Lys Val Thr Lys

1125 1130 1135

Thr Tyr Glu Leu Lys Ala Asn Gly Glu Val Lys Phe Thr Val Pro Tyr

1140 1145 1150

Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser Lys Glu Asn Asn Lys Ser

1155 1160 1165

Ala Ser Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asn

1170 1175 1180

Gly Ala Trp Lys Asn Ala Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu

1185 1190 1195 1200

Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Glu Ala

1205 1210 1215

Ser Asn Phe Thr Gly Gly Val Ala Glu Phe Ala Lys Asp Leu Asp Thr

1220 1225 1230

Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asn Asp Glu Asp Gly

1235 1240 1245

Lys His Arg Met Phe Thr Tyr Lys Asn Leu Thr Gly His Lys His Arg

1250 1255 1260

Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr

1265 1270 1275 1280

Pro Val Met Asn Ser Ser Phe Ser Thr Asn Ser Thr Thr Leu Pro Thr

1285 1290 1295

Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala

1300 1305 1310

Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn

1315 1320 1325

Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg

1330 1335 1340

Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn

1345 1350 1355 1360

Asn Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr

1365 1370 1375

Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Lys Trp

1380 1385 1390

Tyr Pro Asp Gly Thr Pro Leu Pro Glu Phe Tyr Ser Glu Arg Glu Gly

1395 1400 1405

Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly

1410 1415 1420

Asp Glu Val Ser Asn Asp Lys Phe Gly Gly Arg Asn Tyr Cys Ala Glu

1425 1430 1435 1440

Ser Asn Gly Asn Thr Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val

1445 1450 1455

Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala

1460 1465 1470

Asn Ala Tyr Gln Leu Pro Gly Ala Thr Glu Met Ser Phe Glu Gly Gly

1475 1480 1485

Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu Asp Leu Pro Lys

1490 1495 1500

Pro Lys Gln Gly Pro Glu Thr Ile Asn Lys Val Thr Glu Tyr Ser Met

1505 1510 1515 1520

Pro Ala Glu

<210> SEQ ID NO 12

<211> LENGTH: 1518

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 12

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Ile Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Gln Arg Val Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser

100 105 110

Asp Gly Phe Thr Phe Lys Pro Gly Glu Asp Val Thr Cys Val Ala Gly

115 120 125

Asn Thr Thr Ile Ala Thr Phe Asn Thr Gln Ser Glu Ala Ala Arg Ser

130 135 140

Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu

145 150 155 160

Leu Ala Gly Ser Asp Asp Lys Lys Ser Asn Ala Val Ser Leu Val Thr

165 170 175

Ser Ser Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu Thr Phe

180 185 190

Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile

195 200 205

Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu

210 215 220

Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val

225 230 235 240

Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe

245 250 255

Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile

260 265 270

Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Gln Gly Tyr Gly Val Ala

275 280 285

Gly Val Asn Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn

290 295 300

Gly Glu Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp

305 310 315 320

Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu

325 330 335

Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile

340 345 350

His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp

355 360 365

Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile

370 375 380

Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Gly Glu Gly Glu Gln

385 390 395 400

Val Val Asn Leu Pro Asn Glu Phe Ile Glu Gln Phe Asn Thr Gly Gln

405 410 415

Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn

420 425 430

Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln

435 440 445

Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys

450 455 460

Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr Gly

465 470 475 480

Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala

485 490 495

Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala

500 505 510

Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr

515 520 525

Glu Ala Pro Ser Ile Val Arg Pro Glu Asn Val Thr Arg Glu Thr Ala

530 535 540

Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Asp Gly Lys

545 550 555 560

Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro

565 570 575

Asn Gly Tyr Ser Trp Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr

580 585 590

Leu Asn Ser Asp Pro Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu

595 600 605

Arg Tyr Leu Ser Asn Asp Arg Trp Leu Pro Asp Ala Lys Ser Asn Met

610 615 620

Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Lys His Gly Gln

625 630 635 640

Val Thr Gly Asn Ser Ala Ala Phe Gly Phe His Pro Asp Phe Ala Gly

645 650 655

Ile Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu

660 665 670

Met Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly

675 680 685

Asn Asp Pro Tyr Ala Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys

690 695 700

Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Met Asn Lys Gly

705 710 715 720

Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu

725 730 735

Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met

740 745 750

Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asp

755 760 765

Arg Val Arg Gln Arg Arg Ser Thr Pro Ile Trp Val Tyr Glu Arg Tyr

770 775 780

Pro Ala Val Asp Gly Lys Pro Pro Tyr Thr Ile Asp Asp Thr Thr Lys

785 790 795 800

Glu Val Ile Trp Lys Tyr Gln Gln Glu Asn Lys Pro Asp Asp Lys Pro

805 810 815

Lys Leu Glu Val Ala Ser Trp Gln Glu Glu Val Glu Gly Lys Gln Val

820 825 830

Thr Gln Phe Ala Phe Ile Asp Glu Ala Asp His Lys Thr Pro Glu Ser

835 840 845

Leu Ala Ala Ala Lys Lys Arg Ile Leu Asp Ala Phe Pro Gly Leu Glu

850 855 860

Glu Cys Lys Asp Ser Asp Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr

865 870 875 880

Arg Pro Gly Thr Gly Val Pro Val Thr Gly Gly Met Tyr Val Pro Gln

885 890 895

Tyr Thr Gln Leu Ser Leu Asn Ala Asp Thr Ala Lys Ala Met Val Gln

900 905 910

Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu

915 920 925

Tyr Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser Val Asp

930 935 940

Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Lys Ile

945 950 955 960

Glu Tyr Arg Tyr Glu Asn Asp Lys Asp Asp Glu Leu Gly Phe Lys Thr

965 970 975

Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asn Ala Tyr Asp Gly Gly

980 985 990

Thr Gln Cys Ser Ala Glu Leu Lys Gln Ser Leu Ile Asp Asn Lys Met

995 1000 1005

Ile Tyr Gly Glu Gly Ser Lys Ala Gly Met Met Asn Pro Ser Tyr Pro

1010 1015 1020

Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser

1025 1030 1035 1040

Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ala

1045 1050 1055

Val Ser Ala Glu Gly Glu Glu Val Thr Glu Thr Ile Asn Leu Tyr Ser

1060 1065 1070

Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp

1075 1080 1085

Ala Pro Ala Gln Gln Glu Val Ser Ile Lys Ser Asn Ala Lys Val Pro

1090 1095 1100

Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys

1105 1110 1115 1120

His Glu Val Ala Leu Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr Ser

1125 1130 1135

Leu Asp Ala Ser Gly Thr Val Lys Phe Lys Val Pro Tyr Gly Gly Leu

1140 1145 1150

Ile Tyr Ile Lys Ser Asp Ser Lys Glu Glu Lys Ser Ala Asn Phe Thr

1155 1160 1165

Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Lys Trp Lys

1170 1175 1180

Asn Asp Leu Lys Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Ala Ser

1185 1190 1195 1200

Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Glu Ala Ser Asn Tyr Lys

1205 1210 1215

Gly Gly Leu Lys Gln Phe Ala Glu Asp Leu Asp Thr Phe Ala Ser Ser

1220 1225 1230

Met Asn Asp Phe Tyr Gly Arg Asp Gly Glu Ser Gly Lys His Arg Met

1235 1240 1245

Phe Thr Tyr Glu Ala Leu Thr Gly His Lys His Arg Phe Thr Asn Asp

1250 1255 1260

Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn

1265 1270 1275 1280

Ser Ser Phe Ser Pro Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn

1285 1290 1295

Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu Thr Pro

1300 1305 1310

Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu

1315 1320 1325

Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp

1330 1335 1340

Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Gly Gln Ala Trp

1345 1350 1355 1360

Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys

1365 1370 1375

Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Gln Trp Tyr Pro Glu Gly

1380 1385 1390

Ser Leu Pro Ala Phe Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp Asn

1395 1400 1405

Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Asp Val Gly Asn

1410 1415 1420

Asp Lys Phe Gly Asn Arg Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala

1425 1430 1435 1440

Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu

1445 1450 1455

Ser Ala Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu

1460 1465 1470

Pro Gly Ala Thr Glu Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala

1475 1480 1485

Tyr Asn Thr Leu Ala Ser Leu Asp Leu Pro Lys Pro Lys Gln Gly Pro

1490 1495 1500

Glu Thr Ile Asn Lys Val Thr Glu Tyr Ser Met Pro Ala Glu

1505 1510 1515

<210> SEQ ID NO 13

<211> LENGTH: 1520

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 13

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Ile Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Gln Arg Val Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser

100 105 110

Asp Gly Phe Thr Phe Lys Pro Gly Glu Asp Val Thr Cys Val Ala Gly

115 120 125

Asn Thr Thr Ile Ala Thr Phe Asn Thr Gln Ser Glu Ala Ala Arg Ser

130 135 140

Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu

145 150 155 160

Leu Ala Gly Ser Asp Asp Lys Lys Ser Asn Ala Val Ser Leu Val Thr

165 170 175

Ser Ser Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu Thr Phe

180 185 190

Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile

195 200 205

Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu

210 215 220

Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val

225 230 235 240

Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe

245 250 255

Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile

260 265 270

Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Gln Gly Tyr Gly Val Ala

275 280 285

Gly Val Asn Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn

290 295 300

Gly Glu Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp

305 310 315 320

Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu

325 330 335

Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile

340 345 350

His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp

355 360 365

Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile

370 375 380

Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Gly Glu Gly Glu Gln

385 390 395 400

Val Val Asn Leu Pro Asn Glu Phe Ile Glu Gln Phe Asn Thr Gly Gln

405 410 415

Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn

420 425 430

Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln

435 440 445

Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys

450 455 460

Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr Gly

465 470 475 480

Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala

485 490 495

Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala

500 505 510

Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr

515 520 525

Glu Ala Pro Ser Leu Val Glu Pro Glu Asn Val Thr Arg Asp Thr Ala

530 535 540

Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu Gly Lys

545 550 555 560

Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro

565 570 575

Asn Gly Tyr Ser Trp Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr

580 585 590

Leu Asn Ser Asp Pro Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu

595 600 605

Arg Tyr Leu Ser Asp Asp Lys Trp Lys Pro Asp Ala Lys Ala Ser Met

610 615 620

Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Arg His Gly Gln

625 630 635 640

Val Thr Gly Asn Ser Ala Ala Phe Asp Phe His Pro Asp Phe Ala Gly

645 650 655

Ile Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu

660 665 670

Met Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly

675 680 685

Asn Asp Pro Tyr Ala Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys

690 695 700

Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly

705 710 715 720

Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu

725 730 735

Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met

740 745 750

Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asn

755 760 765

Arg Val Arg Gln Gln Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr

770 775 780

Pro Ala Val Asp Gly Ala Leu Pro Tyr Thr Ile Asp Ser Lys Thr Gly

785 790 795 800

Glu Val Lys Trp Lys Tyr Gln Val Glu Asn Lys Pro Asp Asp Lys Pro

805 810 815

Lys Leu Glu Val Ala Ser Trp Leu Glu Asp Val Asp Gly Lys Gln Glu

820 825 830

Thr Arg Tyr Ala Phe Ile Asp Glu Ala Asp His Lys Thr Glu Asp Ser

835 840 845

Leu Lys Ala Ala Lys Glu Lys Ile Phe Ala Ala Phe Pro Gly Leu Lys

850 855 860

Glu Cys Thr Asn Pro Ala Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr

865 870 875 880

Arg Pro Gly Thr Gly Val Pro Val Thr Gly Gly Met Tyr Val Pro Gln

885 890 895

Tyr Thr Gln Leu Ser Leu Asn Ala Asp Thr Ala Lys Ala Met Val Gln

900 905 910

Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu

915 920 925

Tyr Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser Val Asp

930 935 940

Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Asp Thr

945 950 955 960

Ser Tyr Arg Tyr Glu Glu Gly Lys Asn Asp Glu Leu Gly Phe Lys Thr

965 970 975

Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Ala Gly Gly

980 985 990

Thr Lys Cys Ser Ala Asp Leu Lys Lys Ser Leu Val Asp Asn Asn Met

995 1000 1005

Ile Tyr Gly Asp Gly Ser Ser Lys Ala Gly Met Met Asn Pro Ser Tyr

1010 1015 1020

Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg

1025 1030 1035 1040

Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly

1045 1050 1055

Ala Val Ser Glu Glu Gly Gln Asn Val Thr Glu Thr Ile Ser Leu Tyr

1060 1065 1070

Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu

1075 1080 1085

Trp Ala Pro Ala Gln Lys Glu Val Thr Ile Lys Ser Asn Ala Asn Val

1090 1095 1100

Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu

1105 1110 1115 1120

Lys His Glu Val Ala Leu Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr

1125 1130 1135

Ser Leu Asp Ala Ser Gly Thr Val Lys Phe Lys Val Pro Tyr Gly Gly

1140 1145 1150

Leu Ile Tyr Ile Lys Gly Asn Ser Ser Thr Asn Glu Ser Ala Ser Phe

1155 1160 1165

Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Ala Trp

1170 1175 1180

Lys Asn Asp Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Asp

1185 1190 1195 1200

Ala Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Asn Ala Ser Asn Tyr

1205 1210 1215

Thr Gly Gly Leu Glu Gln Phe Ala Asn Asp Leu Asp Thr Phe Ala Ser

1220 1225 1230

Ser Met Asn Asp Phe Tyr Gly Arg Asp Ser Glu Asp Gly Lys His Arg

1235 1240 1245

Met Phe Thr Tyr Lys Asn Leu Pro Gly His Lys His Arg Phe Thr Asn

1250 1255 1260

Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met

1265 1270 1275 1280

Asn Ser Ser Phe Ser Pro Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu

1285 1290 1295

Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu Thr

1300 1305 1310

Pro Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala

1315 1320 1325

Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp

1330 1335 1340

Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Asn Gln Ala

1345 1350 1355 1360

Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu

1365 1370 1375

Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Lys Trp Tyr Pro Asp

1380 1385 1390

Gly Thr Pro Leu Pro Glu Phe Tyr Ser Glu Arg Glu Gly Met Lys Gly

1395 1400 1405

Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Glu Val

1410 1415 1420

Ser Asn Asp Lys Phe Gly Gly Lys Asn Tyr Cys Ala Glu Ser Asn Gly

1425 1430 1435 1440

Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln Thr

1445 1450 1455

Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr

1460 1465 1470

Gln Leu Pro Gly Ala Ser Glu Met Ser Phe Glu Gly Gly Val Ser Gln

1475 1480 1485

Ser Ala Tyr Asn Thr Leu Ala Ser Leu Asp Leu Pro Lys Pro Glu Gln

1490 1495 1500

Gly Pro Glu Thr Ile Asn Gln Val Thr Glu His Lys Met Ser Ala Glu

1505 1510 1515 1520

<210> SEQ ID NO 14

<211> LENGTH: 1518

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 14

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Ile Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Gln Arg Val Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser

100 105 110

Asp Gly Phe Thr Phe Lys Pro Gly Glu Asp Val Thr Cys Val Ala Gly

115 120 125

Asn Thr Thr Ile Ala Thr Phe Asn Thr Gln Ser Glu Ala Ala Arg Ser

130 135 140

Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu

145 150 155 160

Leu Ala Gly Ser Asp Asp Lys Lys Ser Asn Ala Val Ser Leu Val Thr

165 170 175

Ser Ser Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu Thr Phe

180 185 190

Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile

195 200 205

Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu

210 215 220

Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val

225 230 235 240

Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe

245 250 255

Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile

260 265 270

Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Gln Gly Tyr Gly Val Ala

275 280 285

Gly Val Asn Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn

290 295 300

Gly Glu Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp

305 310 315 320

Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu

325 330 335

Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile

340 345 350

His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val Pro Glu

355 360 365

Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile

370 375 380

Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Gly Glu Gly Glu Gln

385 390 395 400

Val Val Asn Leu Pro Asn Glu Phe Ile Glu Gln Phe Asn Thr Gly Gln

405 410 415

Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn

420 425 430

Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln

435 440 445

Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys

450 455 460

Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr Gly

465 470 475 480

Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala

485 490 495

Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala

500 505 510

Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr

515 520 525

Glu Ala Pro Ser Ile Val Arg Pro Glu Asn Val Thr Arg Glu Thr Ala

530 535 540

Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Asp Gly Lys

545 550 555 560

Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro

565 570 575

Asn Gly Tyr Ser Trp Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr

580 585 590

Leu Asn Ser Asp Pro Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu

595 600 605

Arg Tyr Leu Ser Asn Asp Arg Trp Leu Pro Asp Ala Lys Ser Asn Met

610 615 620

Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Lys His Gly Gln

625 630 635 640

Val Thr Gly Asn Ser Ala Ala Phe Gly Phe His Pro Asp Phe Ala Gly

645 650 655

Ile Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu

660 665 670

Met Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly

675 680 685

Asn Asp Pro Tyr Ala Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys

690 695 700

Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Met Asn Lys Gly

705 710 715 720

Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu

725 730 735

Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met

740 745 750

Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asp

755 760 765

Arg Val Arg Gln Arg Arg Ser Thr Pro Ile Trp Val Tyr Glu Arg Tyr

770 775 780

Pro Ala Val Asp Gly Lys Pro Pro Tyr Thr Ile Asp Asp Thr Thr Lys

785 790 795 800

Glu Val Ile Trp Lys Tyr Gln Gln Glu Asn Lys Pro Asp Asp Lys Pro

805 810 815

Lys Leu Glu Val Ala Ser Trp Gln Glu Glu Val Glu Gly Lys Gln Val

820 825 830

Thr Gln Phe Ala Phe Ile Asp Glu Ala Asp His Lys Thr Pro Glu Ser

835 840 845

Leu Ala Ala Ala Lys Lys Arg Ile Leu Asp Ala Phe Pro Gly Leu Glu

850 855 860

Glu Cys Lys Asp Ser Asp Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr

865 870 875 880

Arg Pro Gly Thr Gly Val Pro Val Thr Gly Gly Met Tyr Val Pro Gln

885 890 895

Tyr Thr Gln Leu Ser Leu Asn Ala Asp Thr Ala Lys Ala Met Val Gln

900 905 910

Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu

915 920 925

Tyr Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser Val Asp

930 935 940

Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Lys Ile

945 950 955 960

Glu Tyr Arg Tyr Glu Asn Asp Lys Asp Asp Glu Leu Gly Phe Lys Thr

965 970 975

Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asn Ala Tyr Asp Gly Gly

980 985 990

Thr Gln Cys Ser Ala Glu Leu Lys Gln Ser Leu Ile Asp Asn Lys Met

995 1000 1005

Ile Tyr Gly Glu Gly Ser Lys Ala Gly Met Met Asn Pro Ser Tyr Pro

1010 1015 1020

Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser

1025 1030 1035 1040

Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ala

1045 1050 1055

Val Ser Ala Glu Gly Glu Glu Val Thr Glu Thr Ile Asn Leu Tyr Ser

1060 1065 1070

Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp

1075 1080 1085

Ala Pro Ala Gln Gln Glu Val Ser Ile Lys Ser Asn Ala Lys Val Pro

1090 1095 1100

Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys

1105 1110 1115 1120

His Glu Val Ala Leu Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr Ser

1125 1130 1135

Leu Asp Ala Ser Gly Thr Val Lys Phe Lys Val Pro Tyr Gly Gly Leu

1140 1145 1150

Ile Tyr Ile Lys Ser Asp Ser Lys Glu Glu Lys Ser Ala Asn Phe Thr

1155 1160 1165

Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Lys Trp Lys

1170 1175 1180

Asn Asp Leu Lys Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Ala Ser

1185 1190 1195 1200

Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Glu Ala Ser Asn Tyr Lys

1205 1210 1215

Gly Gly Leu Lys Gln Phe Ala Glu Asp Leu Asp Thr Phe Ala Ser Ser

1220 1225 1230

Met Asn Asp Phe Tyr Gly Arg Asp Gly Glu Ser Gly Lys His Arg Met

1235 1240 1245

Phe Thr Tyr Glu Ala Leu Thr Gly His Lys His Arg Phe Thr Asn Asp

1250 1255 1260

Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn

1265 1270 1275 1280

Ser Ser Phe Ser Pro Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn

1285 1290 1295

Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu Thr Pro

1300 1305 1310

Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu

1315 1320 1325

Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp

1330 1335 1340

Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Gly Gln Ala Trp

1345 1350 1355 1360

Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys

1365 1370 1375

Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Gln Trp Tyr Pro Glu Gly

1380 1385 1390

Ser Leu Pro Ala Phe Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp Asn

1395 1400 1405

Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Asp Val Gly Asn

1410 1415 1420

Asp Lys Phe Gly Asn Arg Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala

1425 1430 1435 1440

Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu

1445 1450 1455

Ser Ala Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu

1460 1465 1470

Pro Gly Ala Thr Glu Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala

1475 1480 1485

Tyr Asn Thr Leu Ala Ser Leu Asp Leu Pro Lys Pro Glu Gln Gly Pro

1490 1495 1500

Glu Thr Ile Asn Gln Val Thr Glu His Lys Met Ser Ala Glu

1505 1510 1515

<210> SEQ ID NO 15

<211> LENGTH: 1524

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 15

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Pro Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Asp Pro Thr Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Gln Arg Ile Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser

100 105 110

Asp Gly Phe Thr Phe Thr Pro Gly Asp Lys Val Thr Cys Val Ala Gly

115 120 125

Asn Asn Thr Thr Ile Ala Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg

130 135 140

Ser Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala Gln

145 150 155 160

Glu Leu Ala Ala Ser Asp Asp Lys Lys Ser Asn Ala Val Ser Leu Val

165 170 175

Thr Ser Ser Asn Ser Cys Pro Ala Asp Thr Glu Gln Val Cys Leu Thr

180 185 190

Phe Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln

195 200 205

Ile Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu Val

210 215 220

Glu Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Pro

225 230 235 240

Val Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser

245 250 255

Phe Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu

260 265 270

Ile Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Gln Gly Tyr Gly Val

275 280 285

Ala Gly Val Asn Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Gly Glu

290 295 300

Asn Gly Glu Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile

305 310 315 320

Asp Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala

325 330 335

Leu Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu

340 345 350

Ile His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val Pro

355 360 365

Asp Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu

370 375 380

Ile Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Asp Glu Gly Asp

385 390 395 400

Gln Asn Val Val Leu Pro Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly

405 410 415

Gln Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys

420 425 430

Asn Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp Gly

435 440 445

Gln Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Lys Asp Tyr

450 455 460

Lys Ser Val Thr Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr

465 470 475 480

Gly Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn

485 490 495

Ala Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu

500 505 510

Ala Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile

515 520 525

Thr Glu Ala Pro Ser Ile Val Gln Pro Glu Asn Val Thr Arg Asp Thr

530 535 540

Ala Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu Gly

545 550 555 560

Lys Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys

565 570 575

Pro Asn Gly Tyr Ser Trp Asn Gly Gly Val Asn Lys Asp Gly Gln Cys

580 585 590

Thr Leu Ser Gly Asp Ser Asp Asp Met Lys His Phe Met Gln Asn Val

595 600 605

Leu Arg Tyr Leu Ser Asp Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser

610 615 620

Met Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Arg His Gly

625 630 635 640

Gln Val Thr Gly Asn Ser Ala Glu Phe Gly Phe His Pro Asp Phe Ala

645 650 655

Gly Ile Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln

660 665 670

Glu Met Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Val

675 680 685

Gly Asn Asp Pro Tyr Ala Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro

690 695 700

Lys Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys

705 710 715 720

Gly Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu

725 730 735

Glu Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser

740 745 750

Met Ala Leu Asn Lys Ser Val Val Asn Thr Asp Pro Gln Gly Tyr Pro

755 760 765

Asn Arg Val Arg Gln Gln Arg Glu Lys Gly Ile Trp Val Tyr Glu Arg

770 775 780

Tyr Pro Ala Val Asp Ser Ala Gln Pro Pro Tyr Thr Ile Asp Pro Asp

785 790 795 800

Thr Gly Lys Val Thr Trp Lys Tyr Gln Glu Glu Gly Lys Pro Asp Asp

805 810 815

Lys Pro Lys Leu Glu Val Ala Ser Trp Gln Glu Asp Val Asp Gly Lys

820 825 830

Gln Val Thr Arg Tyr Ala Phe Ile Asp Glu Ala Glu His Ser Thr Glu

835 840 845

Glu Ser Leu Glu Ala Ala Lys Ala Lys Ile Phe Glu Lys Phe Pro Gly

850 855 860

Leu Gln Glu Cys Lys Asp Ser Thr Tyr His Tyr Glu Ile Asn Cys Leu

865 870 875 880

Glu Arg Arg Pro Gly Thr Asp Val Pro Val Thr Gly Gly Met Tyr Val

885 890 895

Pro Arg Tyr Thr Gln Leu Asn Leu Asp Ala Asp Thr Ala Lys Ala Met

900 905 910

Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His

915 920 925

Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser

930 935 940

Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn

945 950 955 960

Lys Ile Glu Tyr Arg Tyr Glu Asn Asp Lys Asp Asp Glu Leu Gly Phe

965 970 975

Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asn Ala Tyr Ser

980 985 990

Glu Gly Thr Gln Cys Ser Ala Asp Leu Lys Lys Ser Leu Val Asp Asn

995 1000 1005

Asn Met Ile Tyr Gly Asp Gly Ser Ser Lys Ala Gly Met Met Asn Pro

1010 1015 1020

Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu

1025 1030 1035 1040

Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr

1045 1050 1055

Pro Gly Ala Val Ser Ala Glu Gly Glu Lys Val Thr Glu Thr Ile Ser

1060 1065 1070

Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr

1075 1080 1085

Gly Leu Trp Ala Pro Ala Gln Gln Glu Val Thr Ile Glu Ser Thr Ala

1090 1095 1100

Ser Val Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly

1105 1110 1115 1120

Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro Lys Val Thr Lys

1125 1130 1135

Thr Tyr Asp Leu Lys Ala Asn Asp Lys Val Thr Phe Lys Val Pro Tyr

1140 1145 1150

Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser Pro Lys Asn Glu Ser Ala

1155 1160 1165

Glu Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly

1170 1175 1180

Glu Trp Lys Asn Ala Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu

1185 1190 1195 1200

Ser Asp Ser Phe Val Tyr Thr Ala Pro Lys Asn Asn Leu Asn Ala Ser

1205 1210 1215

Asn Tyr Ser Asn Tyr Thr Asp Gly Val Ala Glu Phe Ala Lys Glu Leu

1220 1225 1230

Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp Gly Glu

1235 1240 1245

Ser Gly Asn His Arg Met Phe Thr Tyr Lys Ala Leu Thr Gly His Lys

1250 1255 1260

His Arg Phe Ala Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser

1265 1270 1275 1280

Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr Asn Ser Thr Thr Leu

1285 1290 1295

Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly His

1300 1305 1310

Asn Ala Ala Glu Thr Pro Leu Asn Val Pro Gly Ala Thr Glu Val Ala

1315 1320 1325

Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met

1330 1335 1340

Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Asp Glu

1345 1350 1355 1360

Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu

1365 1370 1375

Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Glu Asn Phe Asp Ile Lys

1380 1385 1390

Gln Trp Tyr Pro Asp Gly Glu Leu Pro Lys Phe Tyr Ser Asp Arg Lys

1395 1400 1405

Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg

1410 1415 1420

Gly Asp Asp Val Ser Asn Asp Lys Phe Gly Gly Arg Asn Tyr Cys Ala

1425 1430 1435 1440

Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp

1445 1450 1455

Val Ala Gln Ala Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly

1460 1465 1470

Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met Ser Phe Glu Gly

1475 1480 1485

Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ala Met His Leu Ser

1490 1495 1500

Lys Pro Glu Lys Gly Pro Glu Thr Ile Asn Lys Val Thr Glu Tyr Ser

1505 1510 1515 1520

Met Pro Ala Glu

<210> SEQ ID NO 16

<211> LENGTH: 1521

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 16

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Leu Arg Val Thr Gly Asp Ile Thr Cys Asn Asp Glu Ser

100 105 110

Ser Asp Gly Phe Thr Phe Thr Pro Gly Asp Lys Val Thr Cys Val Ala

115 120 125

Gly Asn Asn Thr Thr Ile Ala Thr Phe Asp Thr Gln Ser Glu Ala Ala

130 135 140

Arg Ser Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala

145 150 155 160

Gln Glu Leu Ala Gly Ser Asp Asn Lys Lys Ser Asn Ala Leu Ser Leu

165 170 175

Val Thr Ser Met Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu

180 185 190

Glu Phe Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys

195 200 205

Gln Ile Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu

210 215 220

Val Glu Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser

225 230 235 240

Pro Val Val Pro Ala Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala

245 250 255

Ser Phe Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr

260 265 270

Glu Ile Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Gln Gly Asp Gly

275 280 285

Val Val Gly Val Asn Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Gly

290 295 300

Glu Asn Gly Glu Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly

305 310 315 320

Ile Asp Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile

325 330 335

Ala Leu Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln

340 345 350

Leu Ile His Arg Tyr Ser Lys Ala Gly Gln Asn His Thr Arg Val Val

355 360 365

Pro Asp Glu Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn

370 375 380

Glu Ile Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Gly Glu Gly

385 390 395 400

Glu Gln Val Val Asn Leu Pro Asn Glu Phe Ile Glu Gln Phe Lys Thr

405 410 415

Gly Gln Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly

420 425 430

Cys Asn Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp

435 440 445

Gly Gln Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn

450 455 460

Tyr Lys Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe

465 470 475 480

Tyr Gly Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser

485 490 495

Asn Ala Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp

500 505 510

Leu Ala Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr

515 520 525

Ile Thr Glu Ala Pro Ser Ile Val Arg Pro Glu Asn Val Thr Arg Glu

530 535 540

Thr Ala Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Asp

545 550 555 560

Gly Lys Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg

565 570 575

Cys Pro Asn Gly Tyr Ser Trp Asn Gly Gly Val Asn Lys Asp Gly Gln

580 585 590

Cys Thr Leu Asn Ser Asp Pro Asp Asp Met Lys Asn Phe Met Glu Asn

595 600 605

Val Leu Arg Tyr Leu Ser Asn Asp Arg Trp Leu Pro Asp Ala Lys Ser

610 615 620

Ser Met Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Lys His

625 630 635 640

Gly Gln Val Leu Gly Asn Ser Ala Pro Phe Ala Phe His Lys Asp Phe

645 650 655

Thr Gly Ile Thr Val Lys Pro Met Thr Ser Tyr Gly Asn Leu Asn Pro

660 665 670

Asp Glu Val Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln

675 680 685

Trp Gly Ser Asp Pro Tyr Ser Ile Pro Leu Arg Ala Asp Thr Ser Lys

690 695 700

Pro Lys Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Met Asn

705 710 715 720

Lys Gly Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys

725 730 735

Glu Glu Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu

740 745 750

Ser Met Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr

755 760 765

Pro Asp Arg Val Arg Gln Arg Arg Ser Thr Pro Ile Trp Val Tyr Glu

770 775 780

Arg Tyr Pro Ala Val Asp Gly Lys Pro Pro Tyr Thr Ile Asp Asp Thr

785 790 795 800

Thr Lys Glu Val Ile Trp Lys Tyr Gln Gln Glu Asn Lys Pro Asp Asp

805 810 815

Lys Pro Lys Leu Glu Val Ala Ser Trp Gln Glu Glu Val Glu Gly Lys

820 825 830

Gln Val Thr Gln Phe Ala Phe Ile Asp Glu Ala Asp His Lys Thr Pro

835 840 845

Glu Ser Leu Ala Ala Ala Lys Gln Arg Ile Leu Asp Ala Phe Pro Gly

850 855 860

Leu Glu Val Cys Lys Asp Ser Asp Tyr His Tyr Glu Val Asn Cys Leu

865 870 875 880

Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr Gly Gly Met Tyr Val

885 890 895

Pro Gln Tyr Thr Gln Leu Asp Leu Gly Ala Asp Thr Ala Lys Ala Met

900 905 910

Leu Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His

915 920 925

Glu Leu Tyr Phe Arg Thr Asn Gly Leu Gln Gly Glu Arg Leu Asn Ser

930 935 940

Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn

945 950 955 960

Glu Thr Lys Tyr Arg Tyr Glu Glu Gly Lys Glu Asp Glu Leu Gly Phe

965 970 975

Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Thr Asn Asn Ala Tyr Val

980 985 990

Gly Thr Gln Cys Ser Ala Glu Leu Lys Lys Ser Leu Ile Asp Asn Lys

995 1000 1005

Met Ile Tyr Gly Glu Glu Ser Ser Lys Ala Gly Met Met Asn Pro Ser

1010 1015 1020

Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly

1025 1030 1035 1040

Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro

1045 1050 1055

Gly Val Val Asn Thr Asn Gly Glu Thr Val Thr Gln Asn Ile Asn Leu

1060 1065 1070

Tyr Ser Ala Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly

1075 1080 1085

Leu Trp Ala Pro Ala Gln Gln Glu Val Ser Ile Glu Ser Lys Ala Thr

1090 1095 1100

Val Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg

1105 1110 1115 1120

Glu Lys His Glu Val Ser Leu Asn Arg Pro Pro Arg Val Thr Lys Thr

1125 1130 1135

Tyr Asp Leu Lys Ala Asn Asp Lys Val Thr Phe Lys Val Pro Tyr Gly

1140 1145 1150

Gly Leu Ile Tyr Ile Lys Gly Asp Ser Lys Glu Val Gln Ser Ala Asp

1155 1160 1165

Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Lys

1170 1175 1180

Trp Gln His Asp Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser

1185 1190 1195 1200

Ala Ser Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Asn Ala Ser Asn

1205 1210 1215

Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn Asp Leu Asp Thr Phe Ala

1220 1225 1230

Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp Ser Glu Asp Gly Lys His

1235 1240 1245

Arg Met Phe Thr Tyr Lys Asn Leu Pro Gly His Lys His Arg Phe Ala

1250 1255 1260

Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val

1265 1270 1275 1280

Met Asn Ser Ser Phe Ser Pro Asn Ser Thr Thr Leu Pro Thr Thr Pro

1285 1290 1295

Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu

1300 1305 1310

Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu

1315 1320 1325

Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala

1330 1335 1340

Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Gly Gln

1345 1350 1355 1360

Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln

1365 1370 1375

Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Lys Trp Tyr Pro

1380 1385 1390

Asp Gly Thr Pro Leu Pro Glu Phe Tyr Ser Glu Arg Glu Gly Met Lys

1395 1400 1405

Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Glu

1410 1415 1420

Val Ser Asn Asp Lys Phe Gly Gly Lys Asn Tyr Cys Ala Glu Ser Asn

1425 1430 1435 1440

Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln

1445 1450 1455

Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala

1460 1465 1470

Tyr Gln Leu Pro Gly Ala Thr Glu Met Ser Phe Glu Gly Gly Val Ser

1475 1480 1485

Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu Asn Leu Pro Lys Pro Lys

1490 1495 1500

Gln Gly Pro Glu Thr Ile Asn Lys Val Thr Glu Tyr Ser Met Pro Ala

1505 1510 1515 1520

Glu

<210> SEQ ID NO 17

<211> LENGTH: 1518

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 17

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Glu Pro

65 70 75 80

Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly

85 90 95

Ser Gln Arg Val Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly

100 105 110

Phe Thr Phe Thr Pro Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr

115 120 125

Thr Ile Ala Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg

130 135 140

Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala

145 150 155 160

Ala Ser Asp Asp Lys Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser

165 170 175

Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser

180 185 190

Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu

195 200 205

Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn

210 215 220

Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro

225 230 235 240

Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser

245 250 255

Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu

260 265 270

Ser Glu Gly Arg Leu Val Asp Ser Met Gly Asn Gly Val Val Gly Val

275 280 285

Asn Tyr Tyr Thr Ser Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Lys

290 295 300

Phe Asn Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe

305 310 315 320

Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu

325 330 335

Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg

340 345 350

Tyr Ser Gln Ala Gly Lys Asn Asp Glu Arg Glu Val Pro Asp Val Val

355 360 365

Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn

370 375 380

Leu Ser Leu Ser Asn Gly Glu Ala Leu Ser Glu Gly Asp Gln Thr Phe

385 390 395 400

Glu Arg Thr Asn Glu Phe Leu Glu Gln Phe Glu Ser Gly Gln Ala Lys

405 410 415

Glu Ile Asp Thr Ala Ile Cys Asp Ser Leu Gly Gly Cys Asn Ser Gln

420 425 430

Arg Trp Phe Ser Leu Thr Ala Arg Asn Val Asn Glu Gly Gln Ile Gln

435 440 445

Gly Val Ile Asn Lys Leu Trp Gly Val Asp Lys Asp Tyr Lys Ser Val

450 455 460

Thr Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr

465 470 475 480

Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe

485 490 495

Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly

500 505 510

Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala

515 520 525

Pro Ser Leu Val Glu Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe

530 535 540

Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met

545 550 555 560

Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly

565 570 575

Tyr Ser Trp Glu Gly Gly Val Asp Lys Asn Gly Gln Cys Thr Arg Asn

580 585 590

Ser Asp Ser Asn Asp Met Lys His Phe Met Gln Asn Val Leu Arg Tyr

595 600 605

Leu Ser Asp Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val

610 615 620

Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr

625 630 635 640

Gly Asn Ser Ala Glu Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser

645 650 655

Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro

660 665 670

Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp

675 680 685

Pro Tyr Ala Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr

690 695 700

Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser

705 710 715 720

Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala

725 730 735

Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu

740 745 750

Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asn Arg Val

755 760 765

Arg Gln Gln Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro Ala

770 775 780

Val Asp Gly Ala Leu Pro Tyr Thr Ile Asp Ser Lys Thr Gly Glu Val

785 790 795 800

Lys Trp Lys Tyr Gln Val Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu

805 810 815

Glu Val Ala Ser Trp Leu Glu Asp Val Asp Gly Lys Gln Glu Thr Arg

820 825 830

Tyr Ala Phe Ile Asp Glu Ala Asp His Lys Thr Glu Asp Ser Leu Lys

835 840 845

Ala Ala Lys Ala Lys Ile Phe Glu Lys Phe Pro Gly Leu Lys Glu Cys

850 855 860

Lys Asp Pro Thr Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro

865 870 875 880

Gly Thr Gly Val Pro Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr

885 890 895

Gln Leu Ser Leu Asn Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala

900 905 910

Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe

915 920 925

Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser Val Asp Leu Glu

930 935 940

Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Lys Ile Glu Tyr

945 950 955 960

Arg Tyr Glu Asn Asp Lys Asp Asp Glu Leu Gly Phe Lys Thr Phe Thr

965 970 975

Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Thr Gly Gly Thr Gln

980 985 990

Cys Ser Asp Glu Leu Lys Lys Ser Leu Val Asp Asn Asn Met Ile Tyr

995 1000 1005

Gly Glu Lys Ser Val Asn Lys Ala Gly Met Met Asn Pro Ser Tyr Pro

1010 1015 1020

Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser

1025 1030 1035 1040

Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ala

1045 1050 1055

Val Ser Ala Glu Gly Glu Lys Val Thr Glu Thr Ile Ser Leu Tyr Ser

1060 1065 1070

Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp

1075 1080 1085

Ala Pro Ala Gln Lys Glu Val Thr Ile Glu Ser Ser Ala Ser Val Pro

1090 1095 1100

Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys

1105 1110 1115 1120

His Glu Val Ala Leu Asn Arg Pro Pro Lys Val Thr Lys Thr Tyr Asp

1125 1130 1135

Leu Lys Ala Asn Asp Lys Val Thr Phe Lys Val Pro Tyr Gly Gly Leu

1140 1145 1150

Ile Tyr Ile Lys Gly Asn Ser Pro Lys Asn Glu Ser Ala Glu Phe Thr

1155 1160 1165

Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Glu Trp Lys

1170 1175 1180

Asn Ala Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Asp Ala

1185 1190 1195 1200

Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Glu Ala Ser Asn Phe Thr

1205 1210 1215

Gly Gly Val Ala Glu Phe Ala Lys Asp Leu Asp Thr Phe Ala Ser Ser

1220 1225 1230

Met Asn Asp Phe Tyr Gly Arg Asn Asp Glu Asp Gly Lys His Arg Met

1235 1240 1245

Phe Thr Tyr Lys Asn Leu Thr Gly His Lys His Arg Phe Thr Asn Asp

1250 1255 1260

Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn

1265 1270 1275 1280

Ser Ser Phe Ser Thr Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn

1285 1290 1295

Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu Thr Pro

1300 1305 1310

Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu

1315 1320 1325

Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp

1330 1335 1340

Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Gly Gln Ala Trp

1345 1350 1355 1360

Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys

1365 1370 1375

Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Gln Trp Tyr Pro Glu Gly

1380 1385 1390

Asp Leu Pro Lys Phe Tyr Ser Asp Arg Glu Gly Met Lys Gly Trp Asn

1395 1400 1405

Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Asp Val Gly Lys

1410 1415 1420

Thr Lys Phe Gly Glu Arg Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala

1425 1430 1435 1440

Ala Asp Lys Leu Met Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu

1445 1450 1455

Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu

1460 1465 1470

Pro Gly Ala Ser Glu Met Asn Phe Glu Gly Gly Val Ser Gln Ser Ala

1475 1480 1485

Tyr Glu Thr Leu Ala Ala Leu Asn Leu Pro Lys Pro Gln Gln Gly Pro

1490 1495 1500

Glu Thr Ile Asn Gln Val Thr Glu His Lys Met Ser Ala Glu

1505 1510 1515

<210> SEQ ID NO 18

<211> LENGTH: 1520

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 18

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Glu Pro Ile Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Gln Arg Val Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser

100 105 110

Asp Gly Phe Thr Phe Thr Pro Gly Glu Asp Val Thr Cys Val Ala Gly

115 120 125

Asn Thr Thr Ile Ala Thr Phe Asn Thr Gln Ser Glu Ala Ala Arg Ser

130 135 140

Leu Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu

145 150 155 160

Leu Ala Ala Ser Asp Asn Lys Lys Ser Asn Ala Val Ser Leu Val Thr

165 170 175

Ser Ser Asn Ser Cys Pro Ala Asp Thr Glu Gln Val Cys Leu Thr Phe

180 185 190

Ser Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile

195 200 205

Asp Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu

210 215 220

Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val

225 230 235 240

Val Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe

245 250 255

Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile

260 265 270

Ile Leu Ser Glu Gly Arg Leu Val Asp Ser Gln Gly Tyr Gly Val Ala

275 280 285

Gly Val Asn Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn

290 295 300

Gly Glu Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp

305 310 315 320

Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu

325 330 335

Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile

340 345 350

His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp

355 360 365

Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile

370 375 380

Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Asp Glu Gly Glu Gln

385 390 395 400

Val Val Asn Leu Pro Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln

405 410 415

Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn

420 425 430

Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln

435 440 445

Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Ser Tyr Lys

450 455 460

Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr Gly

465 470 475 480

Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala

485 490 495

Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala

500 505 510

Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr

515 520 525

Glu Ala Pro Ser Ile Val Arg Pro Glu Asn Val Thr Arg Glu Thr Ala

530 535 540

Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Lys Gly Lys

545 550 555 560

Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro

565 570 575

Asn Gly Tyr Ser Trp Glu Gly Gly Val Asp Lys Asn Gly Gln Cys Thr

580 585 590

Arg Asn Ser Asp Ser Asn Asp Met Lys His Phe Met Gln Asn Val Leu

595 600 605

Arg Tyr Leu Ser Asn Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser Met

610 615 620

Thr Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Arg His Gly Gln

625 630 635 640

Val Thr Gly Asn Ser Ala Glu Phe Gly Phe His Pro Asp Phe Ala Gly

645 650 655

Ile Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Lys

660 665 670

Met Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly

675 680 685

Gly Asp Pro Tyr Ala Val Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys

690 695 700

Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Met Asn Lys Gly

705 710 715 720

Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu

725 730 735

Ser Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met

740 745 750

Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asp

755 760 765

Arg Val Arg Gln Arg Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr

770 775 780

Pro Val Val Glu Gly Glu Leu Pro Tyr Thr Ile Asp Ser Lys Thr Gly

785 790 795 800

Lys Val Thr Trp Lys Tyr Gln Ile Asp Asn Lys Pro Asp Lys Lys Pro

805 810 815

Lys Leu Glu Val Ala Ser Trp Gln Glu Glu Val Asp Gly Lys Gln Val

820 825 830

Thr Gln Phe Ala Phe Ile Asp Glu Ala Asp His Lys Thr Thr Glu Ser

835 840 845

Leu Asp Ala Ala Lys Lys Lys Ile Leu Glu Lys Phe Lys Gly Leu Glu

850 855 860

Glu Cys Lys Asp Ser Thr Tyr His Tyr Glu Ile Asn Cys Leu Glu Tyr

865 870 875 880

Arg Pro Gly Thr Asn Val Pro Val Thr Gly Gly Met Tyr Val Pro Arg

885 890 895

Tyr Thr Gln Leu Asn Leu Ser Ala Asp Thr Ala Lys Ala Met Val Gln

900 905 910

Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu

915 920 925

Tyr Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser Val Asp

930 935 940

Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Glu Ile

945 950 955 960

Glu Tyr Ser Tyr Asp Ser Ser Lys Glu Asp Glu Leu Gly Phe Lys Thr

965 970 975

Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Thr Gly Gly

980 985 990

Thr Gln Cys Ser Asp Glu Leu Lys Lys Ser Leu Val Asp Asn Asn Met

995 1000 1005

Ile Tyr Gly Glu Lys Ser Val Asn Lys Ala Gly Met Met Asn Pro Ser

1010 1015 1020

Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly

1025 1030 1035 1040

Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro

1045 1050 1055

Gly Ala Val Ser Ala Glu Gly Glu Lys Val Thr Glu Thr Ile Ser Leu

1060 1065 1070

Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly

1075 1080 1085

Leu Trp Ala Pro Ala Gln Lys Glu Val Thr Ile Glu Ser Ser Ala Ser

1090 1095 1100

Val Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg

1105 1110 1115 1120

Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro Lys Val Thr Lys Thr

1125 1130 1135

Tyr Asp Leu Lys Ala Asn Asp Lys Val Thr Phe Lys Val Pro Tyr Gly

1140 1145 1150

Gly Leu Ile Tyr Ile Lys Gly Asn Ser Pro Lys Asn Glu Ser Ala Glu

1155 1160 1165

Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Glu

1170 1175 1180

Trp Lys Asn Ala Leu Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser

1185 1190 1195 1200

Asp Ala Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Glu Ala Ser Asn

1205 1210 1215

Phe Thr Gly Gly Val Ala Glu Phe Ala Lys Asp Leu Asp Thr Phe Ala

1220 1225 1230

Ser Ser Met Asn Asp Phe Tyr Gly Arg Asn Asp Glu Asp Gly Lys His

1235 1240 1245

Arg Met Phe Thr Tyr Lys Asn Leu Thr Gly His Lys His Arg Phe Thr

1250 1255 1260

Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val

1265 1270 1275 1280

Met Asn Ser Ser Phe Ser Thr Asn Ser Thr Thr Leu Pro Thr Thr Pro

1285 1290 1295

Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu

1300 1305 1310

Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu

1315 1320 1325

Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala

1330 1335 1340

Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu Glu Ser Asn Gly Gln

1345 1350 1355 1360

Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln

1365 1370 1375

Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile Lys Thr Trp Tyr Pro

1380 1385 1390

Asp Gly Asn Leu Pro Ala Phe Tyr Ser Glu Arg Glu Gly Met Lys Gly

1395 1400 1405

Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Glu Val

1410 1415 1420

Gly Lys Thr Lys Phe Gly Glu Arg Asn Tyr Cys Ala Glu Ser Asn Gly

1425 1430 1435 1440

Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln Thr

1445 1450 1455

Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr

1460 1465 1470

Gln Leu Pro Gly Ala Ser Glu Met Asn Phe Glu Gly Gly Val Ser Gln

1475 1480 1485

Ser Ala Tyr Glu Thr Leu Ala Ala Leu Asn Leu Pro Lys Pro Gln Gln

1490 1495 1500

Gly Pro Glu Thr Ile Asn Gln Val Thr Glu His Lys Met Ser Ala Glu

1505 1510 1515 1520

<210> SEQ ID NO 19

<211> LENGTH: 1520

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 19

Met Asn Lys Lys Phe Lys Tyr Lys Lys Ser Leu Leu Ala Ala Ile Leu

1 5 10 15

Ser Ala Thr Leu Leu Ala Gly Cys Asp Gly Gly Gly Ser Gly Ser Ser

20 25 30

Ser Asp Thr Pro Ser Val Asp Ser Gly Ser Gly Thr Leu Pro Glu Val

35 40 45

Lys Pro Asp Pro Thr Pro Thr Pro Glu Pro Thr Pro Glu Pro Thr Pro

50 55 60

Asp Pro Glu Pro Thr Pro Asp Pro Thr Pro Asp Pro Glu Pro Thr Pro

65 70 75 80

Glu Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu

85 90 95

Gly Gly Ser Gln Arg Val Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser

100 105 110

Asp Gly Phe Thr Phe Thr Pro Gly Asn Thr Val Ser Cys Val Val Gly

115 120 125

Ser Thr Thr Ile Ala Thr Phe Asn Thr Gln Ser Glu Ala Ala Arg Ser

130 135 140

Leu Arg Ala Val Asp Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu

145 150 155 160

Leu Ala Asn Ser Glu Asn Lys Lys Thr Asn Ala Ile Ser Leu Val Thr

165 170 175

Ser Ser Asp Ser Cys Pro Ala Asp Ala Glu Gln Leu Cys Leu Thr Phe

180 185 190

Ser Ser Val Val Asp Arg Ala Arg Phe Glu Lys Leu Tyr Lys Gln Ile

195 200 205

Asp Leu Ala Thr Asp Asn Phe Ser Lys Leu Val Asn Glu Glu Val Glu

210 215 220

Asn Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Thr Val

225 230 235 240

Val Pro Val Thr Thr Glu Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe

245 250 255

Val Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile

260 265 270

Ile Leu Ser Glu Gly Gln Leu Val Asp Ser Leu Gly Asn Gly Val Ala

275 280 285

Gly Val Asp Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Asp Glu Asn

290 295 300

Gly Lys Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp

305 310 315 320

Thr Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu

325 330 335

Thr Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile

340 345 350

His Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp

355 360 365

Asp Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile

370 375 380

Ile Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Asp Glu Gly Asp Gln

385 390 395 400

Asn Val Val Leu Pro Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln

405 410 415

Ala Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn

420 425 430

Glu Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln

435 440 445

Ile Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Gln

450 455 460

Ser Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr Gly

465 470 475 480

Ser Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ser

485 490 495

Ala Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala

500 505 510

Phe Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr

515 520 525

Glu Ala Pro Ser Ile Val Gln Pro Glu Asn Val Thr Arg Asp Thr Ala

530 535 540

Thr Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu Gly Lys

545 550 555 560

Leu Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro

565 570 575

Asn Gly Tyr Ser Trp Gly Gly Gly Val Asn Ser Lys Gly Glu Cys Thr

580 585 590

Leu Ser Gly Asp Ser Asp Asp Met Lys His Phe Met Gln Asn Val Leu

595 600 605

Arg Tyr Leu Ser Asn Asp Ile Trp Gln Pro Asn Thr Lys Ser Ile Met

610 615 620

Thr Val Gly Thr Asn Leu Glu Asn Val Tyr Phe Lys Lys Ala Gly Gln

625 630 635 640

Val Leu Gly Asn Ser Ala Pro Phe Ala Phe His Glu Asp Phe Thr Gly

645 650 655

Ile Thr Val Lys Gln Leu Thr Ser Tyr Gly Asp Leu Asn Pro Glu Glu

660 665 670

Ile Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Trp Ser

675 680 685

Gly Asp Pro Tyr Ala Val Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys

690 695 700

Leu Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly

705 710 715 720

Gly Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu

725 730 735

Ser Ala Ser Ser Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met

740 745 750

Ala Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asp

755 760 765

Arg Val Arg Gln Arg Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr

770 775 780

Pro Ala Ala Asp Gly Ala Gln Pro Pro Tyr Thr Ile Asp Pro Asn Thr

785 790 795 800

Gly Glu Val Thr Trp Lys Tyr Gln Gln Asp Asn Lys Pro Asp Asp Lys

805 810 815

Pro Lys Leu Glu Val Ala Ser Trp Gln Glu Glu Val Glu Gly Lys Gln

820 825 830

Val Thr Arg Tyr Ala Phe Ile Asp Glu Ala Glu Tyr Thr Thr Glu Glu

835 840 845

Ser Leu Glu Ala Ala Lys Ala Lys Ile Phe Glu Lys Phe Pro Gly Leu

850 855 860

Gln Glu Cys Lys Asp Ser Thr Tyr His Tyr Glu Ile Asn Cys Leu Glu

865 870 875 880

Arg Arg Pro Gly Thr Asp Val Pro Val Thr Gly Gly Met Tyr Val Pro

885 890 895

Arg Tyr Thr Gln Leu Asn Leu Asp Ala Asp Thr Ala Lys Ala Met Val

900 905 910

Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu

915 920 925

Leu Tyr Phe Arg Thr Lys Gly Ser Lys Gly Glu Arg Leu Asn Ser Val

930 935 940

Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Asp

945 950 955 960

Thr Lys Tyr Arg Tyr Glu Glu Gly Lys Glu Asp Glu Leu Gly Phe Lys

965 970 975

Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Ala Gly

980 985 990

Gly Thr Lys Cys Ser Ala Asp Leu Lys Lys Ser Leu Val Asp Asn Asn

995 1000 1005

Met Ile Tyr Gly Asp Gly Ser Ser Lys Ala Gly Met Met Asn Pro Ser

1010 1015 1020

Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly

1025 1030 1035 1040

Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro

1045 1050 1055

Gly Ser Val Ser Ala Lys Gly Glu Ser Val Thr Glu Asn Ile Ser Leu

1060 1065 1070

Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly

1075 1080 1085

Leu Trp Ala Pro Ala Gln Gln Asp Val Thr Ile Lys Ser Ser Ala Ser

1090 1095 1100

Val Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg

1105 1110 1115 1120

Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro Arg Val Thr Lys Thr

1125 1130 1135

Tyr Thr Leu Glu Ala Asn Gly Glu Val Thr Phe Lys Val Pro Tyr Gly

1140 1145 1150

Gly Leu Ile Tyr Ile Lys Gly Asp Ser Lys Asp Asp Val Ser Ala Asn

1155 1160 1165

Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Glu

1170 1175 1180

Trp Lys Asn Asp Leu Asp Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser

1185 1190 1195 1200

Ala Ser Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Glu Ala Ser Asn

1205 1210 1215

Phe Thr Gly Gly Val Ala Glu Phe Ala Lys Asp Leu Asp Thr Phe Ala

1220 1225 1230

Ser Ser Met Asn Asp Phe Tyr Gly Arg Asn Asp Glu Asp Gly Lys His

1235 1240 1245

Arg Met Phe Thr Tyr Lys Asn Leu Thr Gly His Lys His Arg Phe Thr

1250 1255 1260

Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val

1265 1270 1275 1280

Met Asn Ser Ser Phe Ser Thr Asn Ser Thr Thr Leu Pro Thr Thr Pro

1285 1290 1295

Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly His Asn Ala Ala Glu

1300 1305 1310

Thr Pro Leu Asn Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu

1315 1320 1325

Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala

1330 1335 1340

Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Asp Glu Ser Asn Gly Gln

1345 1350 1355 1360

Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln

1365 1370 1375

Leu Lys Glu Trp Ala Glu Glu Asn Phe Asp Ile Lys Gln Trp Tyr Pro

1380 1385 1390

Asp Gly Glu Leu Pro Lys Phe Tyr Ser Asp Arg Lys Gly Met Lys Gly

1395 1400 1405

Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Asp Val

1410 1415 1420

Gly Asn Ser Thr Phe Gly Gly Lys Asn Tyr Cys Ala Glu Ser Asn Gly

1425 1430 1435 1440

Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln Ala

1445 1450 1455

Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Ser Ala Tyr

1460 1465 1470

Gln Leu Pro Gly Ala Thr Glu Met Ser Phe Gln Gly Gly Val Ser Ser

1475 1480 1485

Ser Ala Tyr Ser Thr Leu Ala Ser Leu Lys Leu Pro Lys Pro Glu Lys

1490 1495 1500

Gly Pro Glu Thr Ile Asn Lys Val Thr Glu His Lys Met Ser Ala Glu

1505 1510 1515 1520

<210> SEQ ID NO 20

<211> LENGTH: 738

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 20

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Ser Val Asp

1 5 10 15

Ser Gly Ser Gly Thr Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Thr

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Asp

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Asn Thr Val Ser Cys Val Val Gly Ser Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Asp Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Asn Ser Glu Asn Lys

130 135 140

Lys Thr Asn Ala Ile Ser Leu Val Thr Ser Ser Asp Ser Cys Pro Ala

145 150 155 160

Asp Ala Glu Gln Leu Cys Leu Thr Phe Ser Ser Val Val Asp Arg Ala

165 170 175

Arg Phe Glu Lys Leu Tyr Lys Gln Ile Asp Leu Ala Thr Asp Asn Phe

180 185 190

Ser Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Thr Val Val Pro Val Thr Thr Glu Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Gln Leu

245 250 255

Val Asp Ser Leu Gly Asn Gly Val Ala Gly Val Asp Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Asp Glu Asn Gly Lys Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Asp Glu Gly Asp Gln Asn Val Val Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Gln Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ser Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val Gln

500 505 510

Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Gly Gly

545 550 555 560

Gly Val Asn Ser Lys Gly Glu Cys Thr Leu Ser Gly Asp Ser Asp Asp

565 570 575

Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asn Asp Ile

580 585 590

Trp Gln Pro Asn Thr Lys Ser Ile Met Thr Val Gly Thr Asn Leu Glu

595 600 605

Asn Val Tyr Phe Lys Lys Ala Gly Gln Val Leu Gly Asn Ser Ala Pro

610 615 620

Phe Ala Phe His Glu Asp Phe Thr Gly Ile Thr Val Lys Gln Leu Thr

625 630 635 640

Ser Tyr Gly Asp Leu Asn Pro Glu Glu Ile Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Trp Ser Gly Asp Pro Tyr Ala Val Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Ser Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn

<210> SEQ ID NO 21

<211> LENGTH: 739

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 21

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Ile Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala Thr

100 105 110

Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys

115 120 125

Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Ala Ser Asp Asp

130 135 140

Lys Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro

145 150 155 160

Ala Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser

165 170 175

Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu

180 185 190

Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp

195 200 205

Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro

210 215 220

Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu

225 230 235 240

Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg

245 250 255

Leu Val Asp Ser Met Gly Asn Gly Val Val Gly Val Asn Tyr Tyr Thr

260 265 270

Ser Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Lys Phe Asn Phe Ser

275 280 285

Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser

290 295 300

Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu

305 310 315 320

Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Gln Ala

325 330 335

Gly Lys Asn Asp Glu Arg Glu Val Pro Asp Val Val Arg Lys Val Phe

340 345 350

Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser

355 360 365

Asn Gly Glu Ala Leu Ser Glu Gly Asp Gln Thr Phe Glu Arg Thr Asn

370 375 380

Glu Phe Leu Glu Gln Phe Glu Ser Gly Gln Ala Lys Glu Ile Asp Thr

385 390 395 400

Ala Ile Cys Asp Ser Leu Gly Gly Cys Asn Ser Gln Arg Trp Phe Ser

405 410 415

Leu Thr Ala Arg Asn Val Asn Glu Gly Gln Ile Gln Gly Val Ile Asn

420 425 430

Lys Leu Trp Gly Val Asp Lys Asp Tyr Lys Ser Val Thr Lys Phe His

435 440 445

Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg

450 455 460

Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met

465 470 475 480

Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala

485 490 495

Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu Val

500 505 510

Glu Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe

515 520 525

Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn

530 535 540

Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Glu

545 550 555 560

Gly Gly Val Asp Lys Asn Gly Gln Cys Thr Arg Asn Ser Asp Ser Asn

565 570 575

Asp Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asp Asp

580 585 590

Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu

595 600 605

Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala

610 615 620

Glu Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu

625 630 635 640

Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu

645 650 655

Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile

660 665 670

Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val

675 680 685

Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met

690 695 700

Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val

705 710 715 720

Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val

725 730 735

Val Asn Asn

<210> SEQ ID NO 22

<211> LENGTH: 739

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 22

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Ile Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala Thr

100 105 110

Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys

115 120 125

Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Ala Ser Asp Asp

130 135 140

Lys Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro

145 150 155 160

Ala Asp Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser

165 170 175

Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu

180 185 190

Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp

195 200 205

Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro

210 215 220

Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu

225 230 235 240

Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg

245 250 255

Leu Val Asp Ser Met Gly Asn Gly Val Val Gly Val Asn Tyr Tyr Thr

260 265 270

Ser Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Lys Phe Asn Phe Ser

275 280 285

Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser

290 295 300

Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu

305 310 315 320

Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Gln Ala

325 330 335

Gly Lys Asn Asp Glu Arg Glu Val Pro Asp Val Val Arg Lys Val Phe

340 345 350

Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser

355 360 365

Asn Gly Glu Ala Leu Ser Glu Gly Asp Gln Thr Phe Glu Arg Thr Asn

370 375 380

Glu Phe Leu Glu Gln Phe Glu Ser Gly Gln Ala Lys Glu Ile Asp Thr

385 390 395 400

Ala Ile Cys Asp Ser Leu Gly Gly Cys Asn Ser Gln Arg Trp Phe Ser

405 410 415

Leu Thr Ala Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn

420 425 430

Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe His

435 440 445

Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg

450 455 460

Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met

465 470 475 480

Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala

485 490 495

Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu Val

500 505 510

Glu Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe

515 520 525

Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn

530 535 540

Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Glu

545 550 555 560

Gly Gly Val Asp Lys Asn Gly Gln Cys Thr Arg Asn Ser Asp Ser Asn

565 570 575

Asp Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asp Asp

580 585 590

Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu

595 600 605

Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala

610 615 620

Glu Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu

625 630 635 640

Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu

645 650 655

Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile

660 665 670

Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val

675 680 685

Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met

690 695 700

Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val

705 710 715 720

Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val

725 730 735

Val Asn Asn

<210> SEQ ID NO 23

<211> LENGTH: 738

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 23

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Ile Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Lys Pro

85 90 95

Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp Asp Lys

130 135 140

Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala

145 150 155 160

Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys

165 170 175

Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe

180 185 190

Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu

245 250 255

Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Asn Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu Val Glu

500 505 510

Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Asn Gly

545 550 555 560

Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro Asp Asp

565 570 575

Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asp Asp Lys

580 585 590

Trp Lys Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu Asp

595 600 605

Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala Ala

610 615 620

Phe Asp Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu Ser

625 630 635 640

Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn

<210> SEQ ID NO 24

<211> LENGTH: 740

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 24

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Leu Arg Val Thr

65 70 75 80

Gly Asp Ile Thr Cys Asn Asp Glu Ser Ser Asp Gly Phe Thr Phe Thr

85 90 95

Pro Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala

100 105 110

Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu

115 120 125

Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp

130 135 140

Asn Lys Lys Ser Asn Ala Leu Ser Leu Val Thr Ser Met Asn Ser Cys

145 150 155 160

Pro Ala Asn Thr Glu Gln Val Cys Leu Glu Phe Ser Ser Val Ile Glu

165 170 175

Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu

180 185 190

Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr

195 200 205

Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr

210 215 220

Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala

225 230 235 240

Glu Gln Phe Tyr Gln Tyr Gln Pro Ser Glu Ile Ile Leu Ser Glu Gly

245 250 255

Arg Leu Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr

260 265 270

Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe

275 280 285

Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly

290 295 300

Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp

305 310 315 320

Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr

325 330 335

Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val

340 345 350

Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu

355 360 365

Ser Asn Gly Ala Thr Leu Asp Glu Gly Glu Gln Val Val Asn Leu Pro

370 375 380

Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp

385 390 395 400

Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe

405 410 415

Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile

420 425 430

Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe

435 440 445

His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala

450 455 460

Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu

465 470 475 480

Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg

485 490 495

Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu

500 505 510

Val Glu Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro

515 520 525

Phe Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly

530 535 540

Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp

545 550 555 560

Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro

565 570 575

Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asp

580 585 590

Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn

595 600 605

Leu Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser

610 615 620

Ala Ala Phe Asp Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His

625 630 635 640

Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile

645 650 655

Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala

660 665 670

Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp

675 680 685

Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile

690 695 700

Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe

705 710 715 720

Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser

725 730 735

Val Val Asn Asn

740

<210> SEQ ID NO 25

<211> LENGTH: 740

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 25

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Leu Arg Val Thr

65 70 75 80

Gly Asp Ile Thr Cys Asn Asp Glu Ser Ser Asp Gly Phe Thr Phe Thr

85 90 95

Pro Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala

100 105 110

Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu

115 120 125

Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp

130 135 140

Asn Lys Lys Ser Asn Ala Leu Ser Leu Val Thr Ser Met Asn Ser Cys

145 150 155 160

Pro Ala Asn Thr Glu Gln Val Cys Leu Glu Phe Ser Ser Val Ile Glu

165 170 175

Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu

180 185 190

Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr

195 200 205

Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr

210 215 220

Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala

225 230 235 240

Glu Gln Phe Tyr Gln Tyr Gln Pro Ser Glu Ile Ile Leu Ser Glu Gly

245 250 255

Arg Leu Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr

260 265 270

Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe

275 280 285

Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly

290 295 300

Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp

305 310 315 320

Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr

325 330 335

Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val

340 345 350

Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu

355 360 365

Ser Asn Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro

370 375 380

Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp

385 390 395 400

Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe

405 410 415

Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile

420 425 430

Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe

435 440 445

His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala

450 455 460

Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu

465 470 475 480

Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg

485 490 495

Ala Trp Asp Lys Asn Asp Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile

500 505 510

Val Arg Pro Glu Asn Val Thr Arg Glu Thr Ala Thr Phe Asn Leu Pro

515 520 525

Phe Ile Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly

530 535 540

Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp

545 550 555 560

Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro

565 570 575

Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asn

580 585 590

Asp Arg Trp Leu Pro Asp Ala Lys Ser Ser Met Thr Val Gly Thr Asn

595 600 605

Leu Asp Thr Val Tyr Phe Lys Lys His Gly Gln Val Leu Gly Asn Ser

610 615 620

Ala Pro Phe Ala Phe His Lys Asp Phe Thr Gly Ile Thr Val Lys Pro

625 630 635 640

Met Thr Ser Tyr Gly Asn Leu Asn Pro Asp Glu Val Pro Leu Leu Ile

645 650 655

Leu Asn Gly Phe Glu Tyr Val Thr Gln Trp Gly Ser Asp Pro Tyr Ser

660 665 670

Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp

675 680 685

Val Thr Asp Leu Ile Ala Tyr Met Asn Lys Gly Gly Ser Val Leu Ile

690 695 700

Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe

705 710 715 720

Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser

725 730 735

Val Val Asn Asn

740

<210> SEQ ID NO 26

<211> LENGTH: 740

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 26

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Leu Arg Val Thr

65 70 75 80

Gly Asp Ile Thr Cys Asn Asp Glu Ser Ser Asp Gly Phe Thr Phe Thr

85 90 95

Pro Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala

100 105 110

Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu

115 120 125

Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp

130 135 140

Asn Lys Lys Ser Asn Ala Leu Ser Leu Val Thr Ser Met Asn Ser Cys

145 150 155 160

Pro Ala Asn Thr Glu Gln Val Cys Leu Glu Phe Ser Ser Val Ile Glu

165 170 175

Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu

180 185 190

Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr

195 200 205

Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr

210 215 220

Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala

225 230 235 240

Glu Gln Phe Tyr Gln Tyr Gln Pro Ser Glu Ile Ile Leu Ser Glu Gly

245 250 255

Arg Leu Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr

260 265 270

Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe

275 280 285

Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly

290 295 300

Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp

305 310 315 320

Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr

325 330 335

Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val

340 345 350

Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu

355 360 365

Ser Asn Gly Ala Thr Leu Asp Glu Gly Glu Gln Val Val Asn Leu Pro

370 375 380

Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp

385 390 395 400

Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe

405 410 415

Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile

420 425 430

Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe

435 440 445

His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala

450 455 460

Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu

465 470 475 480

Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg

485 490 495

Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu

500 505 510

Val Glu Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro

515 520 525

Phe Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly

530 535 540

Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp

545 550 555 560

Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro

565 570 575

Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asp

580 585 590

Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn

595 600 605

Leu Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser

610 615 620

Ala Ala Phe Asp Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His

625 630 635 640

Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile

645 650 655

Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala

660 665 670

Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp

675 680 685

Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile

690 695 700

Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe

705 710 715 720

Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser

725 730 735

Val Val Asn Asn

740

<210> SEQ ID NO 27

<211> LENGTH: 740

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 27

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Leu Arg Val Thr

65 70 75 80

Gly Asp Ile Thr Cys Asn Asp Glu Ser Ser Asp Gly Phe Thr Phe Thr

85 90 95

Pro Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala

100 105 110

Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu

115 120 125

Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp

130 135 140

Asn Lys Lys Ser Asn Ala Leu Ser Leu Val Thr Ser Met Asn Ser Cys

145 150 155 160

Pro Ala Asn Thr Glu Gln Val Cys Leu Glu Phe Ser Ser Val Ile Glu

165 170 175

Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu

180 185 190

Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr

195 200 205

Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Ala Thr Thr

210 215 220

Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala

225 230 235 240

Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly

245 250 255

Arg Leu Val Asp Ser Gln Gly Asp Gly Val Val Gly Val Asn Tyr Tyr

260 265 270

Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe

275 280 285

Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly

290 295 300

Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp

305 310 315 320

Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Lys

325 330 335

Ala Gly Gln Asn His Thr Arg Val Val Pro Asp Glu Val Arg Lys Val

340 345 350

Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu

355 360 365

Ser Asn Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro

370 375 380

Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp

385 390 395 400

Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe

405 410 415

Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Lys Ile Gln Gly Val Ile

420 425 430

Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe

435 440 445

His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala

450 455 460

Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu

465 470 475 480

Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg

485 490 495

Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile

500 505 510

Val Arg Pro Glu Asn Val Thr Arg Glu Thr Ala Thr Phe Asn Leu Pro

515 520 525

Phe Ile Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly

530 535 540

Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp

545 550 555 560

Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro

565 570 575

Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asp

580 585 590

Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn

595 600 605

Leu Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser

610 615 620

Ala Ala Phe Asp Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His

625 630 635 640

Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile

645 650 655

Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala

660 665 670

Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp

675 680 685

Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile

690 695 700

Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe

705 710 715 720

Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser

725 730 735

Val Val Asn Asn

740

<210> SEQ ID NO 28

<211> LENGTH: 740

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 28

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Ser Val Asp

1 5 10 15

Ser Gly Ser Gly Thr Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Thr

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Asp

35 40 45

Pro Thr Pro Asp Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu

50 55 60

Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg

65 70 75 80

Val Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe

85 90 95

Thr Pro Gly Asn Thr Val Ser Cys Val Val Gly Ser Thr Thr Ile Ala

100 105 110

Thr Phe Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Asp

115 120 125

Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Asn Ser Glu

130 135 140

Asn Lys Lys Thr Asn Ala Ile Ser Leu Val Thr Ser Ser Asp Ser Cys

145 150 155 160

Pro Ala Asp Ala Glu Gln Leu Cys Leu Thr Phe Ser Ser Val Val Asp

165 170 175

Arg Ala Arg Phe Glu Lys Leu Tyr Lys Gln Ile Asp Leu Ala Thr Asp

180 185 190

Asn Phe Ser Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr

195 200 205

Asp Lys Ala Pro Ser Thr His Thr Ser Thr Val Val Pro Val Thr Thr

210 215 220

Glu Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala

225 230 235 240

Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly

245 250 255

Gln Leu Val Asp Ser Leu Gly Asn Gly Val Ala Gly Val Asp Tyr Tyr

260 265 270

Thr Asn Ser Gly Arg Gly Val Thr Asp Glu Asn Gly Lys Phe Ser Phe

275 280 285

Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly

290 295 300

Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp

305 310 315 320

Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr

325 330 335

Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val

340 345 350

Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu

355 360 365

Ser Asn Gly Ala Thr Leu Asp Glu Gly Asp Gln Asn Val Val Leu Pro

370 375 380

Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp

385 390 395 400

Thr Ala Ile Cys Ala Lys Thr Asn Gly Cys Asn Glu Ala Arg Trp Phe

405 410 415

Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile

420 425 430

Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Gln Ser Val Ser Lys Phe

435 440 445

His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala

450 455 460

Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu

465 470 475 480

Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg

485 490 495

Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile

500 505 510

Val Gln Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro

515 520 525

Phe Ile Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly

530 535 540

Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp

545 550 555 560

Gly Gly Gly Val Asn Ser Lys Gly Glu Cys Thr Leu Ser Gly Asp Ser

565 570 575

Asp Asp Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asn

580 585 590

Asp Ile Trp Gln Pro Asn Thr Lys Ser Ile Met Thr Val Gly Thr Asn

595 600 605

Leu Glu Asn Val Tyr Phe Lys Lys Ala Gly Gln Val Leu Gly Asn Ser

610 615 620

Ala Pro Phe Ala Phe His Glu Asp Phe Thr Gly Ile Thr Val Lys Gln

625 630 635 640

Leu Thr Ser Tyr Gly Asp Leu Asn Pro Glu Glu Ile Pro Leu Leu Ile

645 650 655

Leu Asn Gly Phe Glu Tyr Val Thr Gln Trp Ser Gly Asp Pro Tyr Ala

660 665 670

Val Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp

675 680 685

Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile

690 695 700

Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Ser Phe

705 710 715 720

Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser

725 730 735

Val Val Asn Asn

740

<210> SEQ ID NO 29

<211> LENGTH: 738

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 29

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Ile Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Lys Pro

85 90 95

Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp Asp Lys

130 135 140

Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala

145 150 155 160

Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys

165 170 175

Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe

180 185 190

Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu

245 250 255

Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser Trp

275 280 285

Gly Glu Ala Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Asn Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val Arg

500 505 510

Pro Glu Asn Val Thr Arg Glu Thr Ala Ser Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Asn Gly

545 550 555 560

Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro Asp Asp

565 570 575

Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asn Asp Arg

580 585 590

Trp Leu Pro Asp Ala Lys Ser Ser Met Thr Val Gly Thr Asn Leu Glu

595 600 605

Thr Val Tyr Phe Lys Lys His Gly Gln Val Leu Gly Asn Ser Ala Pro

610 615 620

Phe Ala Phe His Lys Asp Phe Thr Gly Ile Thr Val Lys Pro Met Thr

625 630 635 640

Ser Tyr Gly Asn Leu Asn Pro Asp Glu Val Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Trp Gly Ser Asp Pro Tyr Ser Ile Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Met Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn

<210> SEQ ID NO 30

<211> LENGTH: 739

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 30

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Ile Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala Thr

100 105 110

Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys

115 120 125

Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Ala Ser Asp Asp

130 135 140

Lys Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro

145 150 155 160

Ala Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser

165 170 175

Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu

180 185 190

Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp

195 200 205

Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro

210 215 220

Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu

225 230 235 240

Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg

245 250 255

Leu Val Asp Ser Met Gly Asn Gly Val Val Gly Val Asn Tyr Tyr Thr

260 265 270

Ser Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Lys Phe Asn Phe Ser

275 280 285

Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser

290 295 300

Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu

305 310 315 320

Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Gln Ala

325 330 335

Gly Lys Asn Asp Glu Arg Glu Val Pro Asp Val Val Arg Lys Val Phe

340 345 350

Ala Ala Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser

355 360 365

Asn Gly Glu Ala Leu Ser Glu Gly Asp Gln Thr Phe Glu Arg Thr Asn

370 375 380

Glu Phe Leu Glu Gln Phe Glu Ser Gly Gln Ala Lys Glu Ile Asp Thr

385 390 395 400

Ala Ile Cys Asp Ser Leu Gly Gly Cys Asn Ser Gln Arg Trp Phe Ser

405 410 415

Leu Thr Ala Arg Asn Val Asn Glu Gly Gln Ile Gln Gly Val Ile Asn

420 425 430

Lys Leu Trp Gly Val Asp Lys Asp Tyr Lys Ser Val Thr Lys Phe His

435 440 445

Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg

450 455 460

Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met

465 470 475 480

Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala

485 490 495

Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu Val

500 505 510

Glu Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe

515 520 525

Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn

530 535 540

Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Glu

545 550 555 560

Gly Gly Val Asp Lys Asn Gly Gln Cys Thr Arg Asn Ser Asp Ser Asn

565 570 575

Asp Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asn Asp

580 585 590

Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu

595 600 605

Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala

610 615 620

Glu Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu

625 630 635 640

Ser Ser Tyr Gly Asp Leu Asp Pro Gln Lys Met Pro Leu Leu Ile Leu

645 650 655

Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Gly Asp Pro Tyr Ala Val

660 665 670

Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Ser Gln Gln Asp Val

675 680 685

Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met

690 695 700

Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val

705 710 715 720

Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val

725 730 735

Val Asn Asn

<210> SEQ ID NO 31

<211> LENGTH: 738

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 31

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Ile Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Lys Pro

85 90 95

Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp Asp Lys

130 135 140

Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala

145 150 155 160

Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys

165 170 175

Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe

180 185 190

Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu

245 250 255

Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Asn Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val Arg

500 505 510

Pro Glu Asn Val Thr Arg Glu Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Asn Gly

545 550 555 560

Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro Asp Asp

565 570 575

Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asn Asp Arg

580 585 590

Trp Leu Pro Asp Ala Lys Ser Asn Met Thr Val Gly Thr Asn Leu Asp

595 600 605

Thr Val Tyr Phe Lys Lys His Gly Gln Val Thr Gly Asn Ser Ala Ala

610 615 620

Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu Ser

625 630 635 640

Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Met Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn

<210> SEQ ID NO 32

<211> LENGTH: 738

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 32

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Ile Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Lys Pro

85 90 95

Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp Asp Lys

130 135 140

Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala

145 150 155 160

Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys

165 170 175

Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe

180 185 190

Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu

245 250 255

Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Asn Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu Val Glu

500 505 510

Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Asn Gly

545 550 555 560

Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro Asp Asp

565 570 575

Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asp Asp Lys

580 585 590

Trp Lys Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu Asp

595 600 605

Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala Ala

610 615 620

Phe Asp Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu Ser

625 630 635 640

Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn

<210> SEQ ID NO 33

<211> LENGTH: 738

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 33

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Ile Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Lys Pro

85 90 95

Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp Asp Lys

130 135 140

Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala

145 150 155 160

Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys

165 170 175

Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe

180 185 190

Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu

245 250 255

Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Glu Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Asn Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val Arg

500 505 510

Pro Glu Asn Val Thr Arg Glu Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Asn Gly

545 550 555 560

Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro Asp Asp

565 570 575

Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asn Asp Arg

580 585 590

Trp Leu Pro Asp Ala Lys Ser Asn Met Thr Val Gly Thr Asn Leu Asp

595 600 605

Thr Val Tyr Phe Lys Lys His Gly Gln Val Thr Gly Asn Ser Ala Ala

610 615 620

Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu Ser

625 630 635 640

Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Met Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn

<210> SEQ ID NO 34

<211> LENGTH: 739

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 34

Cys Asp Gly Gly Gly Ser Gly Pro Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Asp

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Ile Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala Thr

100 105 110

Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys

115 120 125

Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Ala Ser Asp Asp

130 135 140

Lys Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro

145 150 155 160

Ala Asp Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser

165 170 175

Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu

180 185 190

Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp

195 200 205

Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro

210 215 220

Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu

225 230 235 240

Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg

245 250 255

Leu Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr

260 265 270

Asn Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser

275 280 285

Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser

290 295 300

Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu

305 310 315 320

Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr

325 330 335

Gly Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe

340 345 350

Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser

355 360 365

Asn Gly Ala Thr Leu Asp Glu Gly Asp Gln Asn Val Val Leu Pro Asn

370 375 380

Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp Thr

385 390 395 400

Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser

405 410 415

Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn

420 425 430

Lys Leu Trp Gly Val Asp Lys Asp Tyr Lys Ser Val Thr Lys Phe His

435 440 445

Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg

450 455 460

Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met

465 470 475 480

Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala

485 490 495

Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val

500 505 510

Gln Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe

515 520 525

Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn

530 535 540

Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Asn

545 550 555 560

Gly Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Ser Gly Asp Ser Asp

565 570 575

Asp Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asp Asp

580 585 590

Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu

595 600 605

Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala

610 615 620

Glu Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu

625 630 635 640

Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu

645 650 655

Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile

660 665 670

Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val

675 680 685

Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met

690 695 700

Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val

705 710 715 720

Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val

725 730 735

Val Asn Thr

<210> SEQ ID NO 35

<211> LENGTH: 740

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 35

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Leu Arg Val Thr

65 70 75 80

Gly Asp Ile Thr Cys Asn Asp Glu Ser Ser Asp Gly Phe Thr Phe Thr

85 90 95

Pro Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala

100 105 110

Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu

115 120 125

Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp

130 135 140

Asn Lys Lys Ser Asn Ala Leu Ser Leu Val Thr Ser Met Asn Ser Cys

145 150 155 160

Pro Ala Asn Thr Glu Gln Val Cys Leu Glu Phe Ser Ser Val Ile Glu

165 170 175

Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu

180 185 190

Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr

195 200 205

Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Ala Thr Thr

210 215 220

Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala

225 230 235 240

Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly

245 250 255

Arg Leu Val Asp Ser Gln Gly Asp Gly Val Val Gly Val Asn Tyr Tyr

260 265 270

Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe

275 280 285

Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly

290 295 300

Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp

305 310 315 320

Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Lys

325 330 335

Ala Gly Gln Asn His Thr Arg Val Val Pro Asp Glu Val Arg Lys Val

340 345 350

Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu

355 360 365

Ser Asn Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro

370 375 380

Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp

385 390 395 400

Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe

405 410 415

Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile

420 425 430

Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe

435 440 445

His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala

450 455 460

Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu

465 470 475 480

Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg

485 490 495

Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile

500 505 510

Val Arg Pro Glu Asn Val Thr Arg Glu Thr Ala Thr Phe Asn Leu Pro

515 520 525

Phe Ile Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly

530 535 540

Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp

545 550 555 560

Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro

565 570 575

Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asn

580 585 590

Asp Arg Trp Leu Pro Asp Ala Lys Ser Ser Met Thr Val Gly Thr Asn

595 600 605

Leu Asp Thr Val Tyr Phe Lys Lys His Gly Gln Val Leu Gly Asn Ser

610 615 620

Ala Pro Phe Ala Phe His Lys Asp Phe Thr Gly Ile Thr Val Lys Pro

625 630 635 640

Met Thr Ser Tyr Gly Asn Leu Asn Pro Asp Glu Val Pro Leu Leu Ile

645 650 655

Leu Asn Gly Phe Glu Tyr Val Thr Gln Trp Gly Ser Asp Pro Tyr Ser

660 665 670

Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp

675 680 685

Val Thr Asp Leu Ile Ala Tyr Met Asn Lys Gly Gly Ser Val Leu Ile

690 695 700

Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe

705 710 715 720

Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser

725 730 735

Val Val Asn Asn

740

<210> SEQ ID NO 36

<211> LENGTH: 736

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 36

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Glu Pro Glu Pro Glu Pro Val Pro Thr

50 55 60

Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr Gly Ala

65 70 75 80

Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro Gly Glu

85 90 95

Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe Asp Thr

100 105 110

Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val Ser Phe

115 120 125

Ser Leu Glu Asp Ala Gln Glu Leu Ala Ala Ser Asp Asp Lys Lys Ser

130 135 140

Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala Asn Thr

145 150 155 160

Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys Arg Phe

165 170 175

Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe Lys Lys

180 185 190

Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys Ala Pro

195 200 205

Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly Thr Lys

210 215 220

Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln Phe Tyr

225 230 235 240

Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu Val Asp

245 250 255

Ser Met Gly Asn Gly Val Val Gly Val Asn Tyr Tyr Thr Ser Ser Gly

260 265 270

Arg Gly Val Thr Gly Glu Asn Gly Lys Phe Asn Phe Ser Trp Gly Glu

275 280 285

Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val Arg Gly

290 295 300

Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val Arg Gly

305 310 315 320

Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Gln Ala Gly Lys Asn

325 330 335

Asp Glu Arg Glu Val Pro Asp Val Val Arg Lys Val Phe Ala Glu Tyr

340 345 350

Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn Gly Glu

355 360 365

Ala Leu Ser Glu Gly Asp Gln Thr Phe Glu Arg Thr Asn Glu Phe Leu

370 375 380

Glu Gln Phe Glu Ser Gly Gln Ala Lys Glu Ile Asp Thr Ala Ile Cys

385 390 395 400

Asp Ser Leu Gly Gly Cys Asn Ser Gln Arg Trp Phe Ser Leu Thr Ala

405 410 415

Arg Asn Val Asn Glu Gly Gln Ile Gln Gly Val Ile Asn Lys Leu Trp

420 425 430

Gly Val Asp Lys Asp Tyr Lys Ser Val Thr Lys Phe His Val Phe His

435 440 445

Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly Gln Ala

450 455 460

Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala Arg Asn

465 470 475 480

Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp Asp Lys

485 490 495

Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu Val Glu Pro Glu

500 505 510

Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe Ile Ser Leu

515 520 525

Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn Pro His Tyr

530 535 540

Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Glu Gly Gly Val

545 550 555 560

Asp Lys Asn Gly Gln Cys Thr Arg Asn Ser Asp Ser Asn Asp Met Lys

565 570 575

His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asp Asp Lys Trp Thr

580 585 590

Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu Asp Thr Val

595 600 605

Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala Glu Phe Gly

610 615 620

Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu Ser Ser Tyr

625 630 635 640

Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu Asn Gly Phe

645 650 655

Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile Pro Leu Arg

660 665 670

Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr Asp Leu

675 680 685

Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met Glu Asn Val

690 695 700

Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg Leu Leu

705 710 715 720

Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val Asn Asn

725 730 735

<210> SEQ ID NO 37

<211> LENGTH: 738

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 37

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Ile Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Ala Ser Asp Asn Lys

130 135 140

Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala

145 150 155 160

Asp Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys

165 170 175

Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe

180 185 190

Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu

245 250 255

Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Asp Glu Gly Glu Gln Val Val Asn Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Ser Tyr Lys Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val Arg

500 505 510

Pro Glu Asn Val Thr Arg Glu Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Lys Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Glu Gly

545 550 555 560

Gly Val Asp Lys Asn Gly Gln Cys Thr Arg Asn Ser Asp Ser Asn Asp

565 570 575

Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asn Asp Lys

580 585 590

Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu Asp

595 600 605

Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala Glu

610 615 620

Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu Ser

625 630 635 640

Ser Tyr Gly Asp Leu Asp Pro Gln Lys Met Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Val Gly Gly Asp Pro Tyr Ala Val Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Met Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn

<210> SEQ ID NO 38

<211> LENGTH: 738

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 38

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Ser Val Asp

1 5 10 15

Ser Gly Ser Gly Thr Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Thr

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Asp

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Asn Thr Val Ser Cys Val Val Gly Ser Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Asp Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Asn Ser Glu Asn Lys

130 135 140

Lys Thr Asn Ala Ile Ser Leu Val Thr Ser Ser Asp Ser Cys Pro Ala

145 150 155 160

Asp Ala Glu Gln Leu Cys Leu Thr Phe Ser Ser Val Val Asp Arg Ala

165 170 175

Arg Phe Glu Lys Leu Tyr Lys Gln Ile Asp Leu Ala Thr Asp Asn Phe

180 185 190

Ser Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Thr Val Val Pro Val Thr Thr Glu Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Gln Leu

245 250 255

Val Asp Ser Leu Gly Asn Gly Val Ala Gly Val Asp Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Asp Glu Asn Gly Lys Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Asp Glu Gly Asp Gln Asn Val Val Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Gln Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ser Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val Gln

500 505 510

Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Gly Gly

545 550 555 560

Gly Val Asn Ser Lys Gly Glu Cys Thr Leu Ser Gly Asp Ser Asp Asp

565 570 575

Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asn Asp Ile

580 585 590

Trp Gln Pro Asn Thr Lys Ser Ile Met Thr Val Gly Thr Asn Leu Glu

595 600 605

Asn Val Tyr Phe Lys Lys Ala Gly Gln Val Leu Gly Asn Ser Ala Pro

610 615 620

Phe Ala Phe His Glu Asp Phe Thr Gly Ile Thr Val Lys Gln Leu Thr

625 630 635 640

Ser Tyr Gly Asp Leu Asn Pro Glu Glu Ile Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Trp Ser Gly Asp Pro Tyr Ala Val Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Ser Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn

<210> SEQ ID NO 39

<211> LENGTH: 759

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 39

Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ala Thr Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Ala Asp Gly Ala Gln Pro Pro

20 25 30

Tyr Thr Ile Asp Pro Asn Thr Gly Glu Val Thr Trp Lys Tyr Gln Gln

35 40 45

Asp Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Gln

50 55 60

Glu Glu Val Glu Gly Lys Gln Val Thr Arg Tyr Ala Phe Ile Asp Glu

65 70 75 80

Ala Glu Tyr Thr Thr Glu Glu Ser Leu Glu Ala Ala Lys Ala Lys Ile

85 90 95

Phe Glu Lys Phe Pro Gly Leu Gln Glu Cys Lys Asp Ser Thr Tyr His

100 105 110

Tyr Glu Ile Asn Cys Leu Glu Arg Arg Pro Gly Thr Asp Val Pro Val

115 120 125

Thr Gly Gly Met Tyr Val Pro Arg Tyr Thr Gln Leu Asn Leu Asp Ala

130 135 140

Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile

145 150 155 160

Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Lys Gly Ser Lys

165 170 175

Gly Glu Arg Leu Asn Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met

180 185 190

Ser Val Trp Leu Trp Asn Asp Thr Lys Tyr Arg Tyr Glu Glu Gly Lys

195 200 205

Glu Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr

210 215 220

Ala Asn Asp Ala Tyr Ala Gly Gly Thr Lys Cys Ser Ala Asp Leu Lys

225 230 235 240

Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly Ser Ser Lys

245 250 255

Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro

260 265 270

Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys

275 280 285

Val Asp Val Glu Lys Tyr Pro Gly Ser Val Ser Ala Lys Gly Glu Ser

290 295 300

Val Thr Glu Asn Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala

305 310 315 320

Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln Asp Val

325 330 335

Thr Ile Lys Ser Ser Ala Ser Val Pro Val Thr Val Thr Val Ala Leu

340 345 350

Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg

355 360 365

Pro Pro Arg Val Thr Lys Thr Tyr Thr Leu Glu Ala Asn Gly Glu Val

370 375 380

Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asp Ser

385 390 395 400

Lys Asp Asp Val Ser Ala Asn Phe Thr Phe Thr Gly Val Val Lys Ala

405 410 415

Pro Phe Tyr Lys Asp Gly Glu Trp Lys Asn Asp Leu Asp Ser Pro Ala

420 425 430

Pro Leu Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr Pro Lys

435 440 445

Lys Asn Leu Glu Ala Ser Asn Phe Thr Gly Gly Val Ala Glu Phe Ala

450 455 460

Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg

465 470 475 480

Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Thr

485 490 495

Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp

500 505 510

Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr Asn Ser

515 520 525

Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu

530 535 540

Val Gly His Asn Ala Ala Glu Thr Pro Leu Asn Val Pro Gly Ala Thr

545 550 555 560

Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu

565 570 575

Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr

580 585 590

Leu Asp Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp

595 600 605

Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Glu Asn Phe

610 615 620

Asp Ile Lys Gln Trp Tyr Pro Asp Gly Glu Leu Pro Lys Phe Tyr Ser

625 630 635 640

Asp Arg Lys Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg

645 650 655

Lys Ala Arg Gly Asp Asp Val Gly Asn Ser Thr Phe Gly Gly Lys Asn

660 665 670

Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys

675 680 685

Ala Ser Trp Val Ala Gln Ala Asp Leu Ser Glu Phe Phe Lys Lys Trp

690 695 700

Asn Pro Gly Ala Ser Ala Tyr Gln Leu Pro Gly Ala Thr Glu Met Ser

705 710 715 720

Phe Gln Gly Gly Val Ser Ser Ser Ala Tyr Ser Thr Leu Ala Ser Leu

725 730 735

Lys Leu Pro Lys Pro Glu Lys Gly Pro Glu Thr Ile Asn Lys Val Thr

740 745 750

Glu His Lys Met Ser Ala Glu

755

<210> SEQ ID NO 40

<211> LENGTH: 759

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 40

Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg Ala Thr Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Ala Leu Pro Tyr

20 25 30

Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys Tyr Gln Val Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Leu Glu

50 55 60

Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys Ala Lys Ile Phe

85 90 95

Glu Lys Phe Pro Gly Leu Lys Glu Cys Lys Asp Pro Thr Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp

130 135 140

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

165 170 175

Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Lys Ile Glu Tyr Arg Tyr Glu Asn Asp Lys Asp

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

210 215 220

Asn Asp Ala Tyr Thr Gly Gly Thr Gln Cys Ser Asp Glu Leu Lys Lys

225 230 235 240

Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Glu Lys Ser Val Asn Lys

245 250 255

Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro

260 265 270

Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys

275 280 285

Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu Gly Glu Lys

290 295 300

Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala

305 310 315 320

Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu Val

325 330 335

Thr Ile Glu Ser Ser Ala Ser Val Pro Val Thr Val Thr Val Ala Leu

340 345 350

Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg

355 360 365

Pro Pro Lys Val Thr Lys Thr Tyr Glu Leu Lys Ala Asn Gly Glu Val

370 375 380

Lys Phe Thr Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser

385 390 395 400

Pro Gln Asn Glu Ser Ala Glu Phe Thr Phe Thr Gly Val Val Lys Ala

405 410 415

Pro Phe Tyr Lys Asp Gly Ala Trp Lys Asn Ala Leu Asn Ser Pro Ala

420 425 430

Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys

435 440 445

Lys Asn Leu Glu Ala Ser Asn Phe Thr Gly Gly Val Ala Glu Phe Ala

450 455 460

Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg

465 470 475 480

Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Thr

485 490 495

Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp

500 505 510

Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr Asn Ser

515 520 525

Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu

530 535 540

Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr

545 550 555 560

Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu

565 570 575

Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr

580 585 590

Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp

595 600 605

Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe

610 615 620

Asp Ile Lys Gln Trp Tyr Pro Glu Gly Asp Leu Pro Lys Phe Tyr Ser

625 630 635 640

Asp Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg

645 650 655

Lys Ala Arg Gly Asp Glu Val Gly Lys Thr Lys Phe Gly Glu Arg Asn

660 665 670

Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Lys Leu Met Leu Cys

675 680 685

Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp

690 695 700

Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met Asn

705 710 715 720

Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Glu Thr Leu Ala Ala Leu

725 730 735

Asn Leu Pro Lys Pro Gln Gln Gly Pro Glu Thr Ile Asn Gln Val Thr

740 745 750

Glu His Lys Met Ser Ala Glu

755

<210> SEQ ID NO 41

<211> LENGTH: 759

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 41

Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg Ala Thr Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Ala Leu Pro Tyr

20 25 30

Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys Tyr Gln Val Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Leu Glu

50 55 60

Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys Ala Lys Ile Phe

85 90 95

Glu Lys Phe Pro Gly Leu Lys Glu Cys Lys Asp Pro Thr Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp

130 135 140

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

165 170 175

Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Lys Ile Glu Tyr Arg Tyr Glu Asn Asp Lys Asp

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

210 215 220

Asn Asp Ala Tyr Thr Gly Gly Thr Gln Cys Ser Asp Glu Leu Lys Lys

225 230 235 240

Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Glu Lys Ser Val Asn Lys

245 250 255

Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro

260 265 270

Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys

275 280 285

Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu Gly Glu Lys

290 295 300

Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala

305 310 315 320

Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu Val

325 330 335

Thr Ile Glu Ser Thr Ala Ser Val Ala Val Thr Val Thr Val Ala Leu

340 345 350

Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg

355 360 365

Pro Pro Lys Val Thr Lys Thr Tyr Glu Leu Lys Ala Asn Gly Glu Val

370 375 380

Lys Phe Thr Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser

385 390 395 400

Pro Gln Asn Glu Ser Ala Glu Phe Thr Phe Thr Gly Val Val Lys Ala

405 410 415

Pro Phe Tyr Lys Asp Gly Ala Trp Lys Asn Ala Leu Asn Ser Pro Ala

420 425 430

Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys

435 440 445

Lys Asn Leu Glu Ala Ser Asn Tyr Lys Gly Gly Gln Glu Gln Phe Ala

450 455 460

Glu Glu Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg

465 470 475 480

Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Thr

485 490 495

Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp

500 505 510

Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr Asn Ser

515 520 525

Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu

530 535 540

Ala Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr

545 550 555 560

Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu

565 570 575

Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr

580 585 590

Leu Glu Glu Ser Asn Asn Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp

595 600 605

Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe

610 615 620

Asp Ile Thr Lys Trp Tyr Pro Glu Gly Asn Leu Pro Lys Phe Tyr Ser

625 630 635 640

Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg

645 650 655

Lys Ala Arg Gly Asp Glu Val Gly Lys Thr Lys Phe Gly Glu Arg Asn

660 665 670

Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys

675 680 685

Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Ala Phe Phe Lys Lys Trp

690 695 700

Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met Asn

705 710 715 720

Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Glu Thr Leu Ala Ala Leu

725 730 735

Asn Leu Pro Lys Pro Gln Gln Gly Pro Glu Thr Ile Asn Lys Val Thr

740 745 750

Glu Tyr Ser Met Pro Ala Glu

755

<210> SEQ ID NO 42

<211> LENGTH: 759

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 42

Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg Ala Thr Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Ala Leu Pro Tyr

20 25 30

Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys Tyr Gln Val Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Leu Glu

50 55 60

Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys Glu Lys Ile Phe

85 90 95

Ala Ala Phe Pro Gly Leu Lys Glu Cys Thr Asn Pro Ala Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp

130 135 140

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

165 170 175

Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Asp Thr Ser Tyr Arg Tyr Glu Glu Gly Lys Asn

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

210 215 220

Asn Asp Ala Tyr Ala Gly Gly Thr Lys Cys Ser Ala Asp Leu Lys Lys

225 230 235 240

Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly Ser Ser Lys Ala

245 250 255

Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu

260 265 270

Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val

275 280 285

Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Glu Glu Gly Gln Asn Val

290 295 300

Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly

305 310 315 320

Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu Val Thr

325 330 335

Ile Lys Ser Asn Ala Asn Val Pro Val Thr Val Thr Val Ala Leu Ala

340 345 350

Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro

355 360 365

Pro Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly Thr Val Lys

370 375 380

Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser Ser

385 390 395 400

Thr Asn Glu Ser Ala Ser Phe Thr Phe Thr Gly Val Val Lys Ala Pro

405 410 415

Phe Tyr Lys Asp Gly Ala Trp Lys Asn Asp Leu Asn Ser Pro Ala Pro

420 425 430

Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys Lys

435 440 445

Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn

450 455 460

Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe His Gly Arg Asp

465 470 475 480

Ser Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Pro Gly

485 490 495

His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp Ala

500 505 510

His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn Ser Thr

515 520 525

Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val

530 535 540

Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu

545 550 555 560

Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly

565 570 575

Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu

580 585 590

Glu Glu Ser Asn Asn Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg

595 600 605

Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp

610 615 620

Ile Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro Glu Phe Tyr Ser

625 630 635 640

Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg

645 650 655

Lys Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe Gly Gly Lys Asn

660 665 670

Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys

675 680 685

Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp

690 695 700

Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met Ser

705 710 715 720

Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu

725 730 735

Asp Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Gln Val Thr

740 745 750

Glu His Lys Met Ser Ala Glu

755

<210> SEQ ID NO 43

<211> LENGTH: 759

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 43

Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg Ala Thr Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Ala Leu Pro Tyr

20 25 30

Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys Tyr Gln Val Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Leu Glu

50 55 60

Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys Glu Lys Ile Phe

85 90 95

Ala Ala Phe Pro Gly Leu Lys Glu Cys Thr Asn Pro Ala Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp

130 135 140

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

165 170 175

Glu Arg Leu Ser Cys Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Asp Thr Ser Tyr Arg Tyr Glu Glu Gly Lys Asn

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

210 215 220

Asn Asp Ala Tyr Ala Gly Gly Thr Lys Cys Ser Ala Asp Leu Lys Lys

225 230 235 240

Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly Ser Ser Lys Ala

245 250 255

Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu

260 265 270

Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val

275 280 285

Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Glu Glu Gly Gln Asn Val

290 295 300

Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly

305 310 315 320

Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu Val Thr

325 330 335

Ile Lys Ser Asn Ala Asn Val Pro Val Thr Val Thr Val Ala Leu Ala

340 345 350

Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro

355 360 365

Pro Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly Thr Val Lys

370 375 380

Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser Ser

385 390 395 400

Thr Asn Glu Ser Ala Ser Phe Thr Phe Thr Gly Val Val Lys Ala Pro

405 410 415

Phe Tyr Lys Asp Gly Ala Trp Lys Asn Asp Leu Asn Ser Pro Ala Pro

420 425 430

Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys Lys

435 440 445

Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn

450 455 460

Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp

465 470 475 480

Ser Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Pro Gly

485 490 495

His Lys His Arg Phe Ala Asn Asp Val Gln Ile Ser Ile Gly Asp Ala

500 505 510

His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn Ser Thr

515 520 525

Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val

530 535 540

Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu

545 550 555 560

Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly

565 570 575

Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu

580 585 590

Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg

595 600 605

Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp

610 615 620

Ile Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro Glu Phe Tyr Ser

625 630 635 640

Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg

645 650 655

Lys Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe Gly Gly Lys Asn

660 665 670

Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys

675 680 685

Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp

690 695 700

Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met Ser

705 710 715 720

Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu

725 730 735

Lys Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Lys Val Thr

740 745 750

Glu His Lys Met Ser Val Glu

755

<210> SEQ ID NO 44

<211> LENGTH: 757

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 44

Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ser Thr Pro

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Lys Pro Pro Tyr

20 25 30

Thr Ile Asp Asp Thr Thr Lys Glu Val Ile Trp Lys Tyr Gln Gln Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Gln Glu

50 55 60

Glu Val Glu Gly Lys Gln Val Thr Gln Phe Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Pro Glu Ser Leu Ala Ala Ala Lys Gln Arg Ile Leu

85 90 95

Asp Ala Phe Pro Gly Leu Glu Val Cys Lys Asp Ser Asp Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Ser Gly Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Asp Leu Gly Ala Asp

130 135 140

Thr Ala Lys Ala Met Leu Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Gln Gly

165 170 175

Glu Arg Leu Asn Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Glu Thr Lys Tyr Arg Tyr Glu Glu Gly Lys Glu

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Thr

210 215 220

Asn Asn Ala Tyr Val Gly Thr Gln Cys Ser Ala Glu Leu Lys Lys Ser

225 230 235 240

Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Glu Ser Ser Lys Ala Gly

245 250 255

Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr

260 265 270

Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp

275 280 285

Val Glu Lys Tyr Pro Gly Ala Val Ser Glu Glu Gly Gln Asn Val Thr

290 295 300

Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn

305 310 315 320

Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu Val Thr Ile

325 330 335

Lys Ser Asn Ala Asn Val Pro Val Thr Val Thr Val Ala Leu Ala Asp

340 345 350

Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro

355 360 365

Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly Thr Val Lys Phe

370 375 380

Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser Ser Thr

385 390 395 400

Asn Glu Ser Ala Ser Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe

405 410 415

Tyr Lys Asp Gly Ala Trp Lys Asn Asp Leu Asn Ser Pro Ala Pro Leu

420 425 430

Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys Lys Asn

435 440 445

Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn Asp

450 455 460

Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp Ser

465 470 475 480

Glu Ser Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Thr Gly His

485 490 495

Lys His Arg Phe Ala Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His

500 505 510

Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn Ser Thr Thr

515 520 525

Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly

530 535 540

His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val

545 550 555 560

Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys

565 570 575

Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu

580 585 590

Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu

595 600 605

Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile

610 615 620

Lys Lys Trp Tyr Pro Glu Gly Glu Leu Pro Lys Phe Phe Ser Asp Arg

625 630 635 640

Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala

645 650 655

Arg Gly Asp Asp Val Gly Asn Lys Thr Phe Gly Gly Lys Asn Tyr Cys

660 665 670

Ala Glu Ser Asn Gly Asn Ala Ala Asp Ser Leu Met Leu Cys Ala Ser

675 680 685

Trp Val Ala Gln Thr Asp Leu Ser Ala Phe Phe Lys Lys Trp Asn Pro

690 695 700

Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Thr Glu Met Ser Phe Glu

705 710 715 720

Gly Gly Val Ser Gln Ser Ala Tyr Ser Thr Leu Ala Ser Leu Lys Leu

725 730 735

Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Lys Val Thr Glu His

740 745 750

Lys Met Ser Leu Glu

755

<210> SEQ ID NO 45

<211> LENGTH: 758

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 45

Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg Ala Thr Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Ala Leu Pro Tyr

20 25 30

Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys Tyr Gln Val Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Leu Glu

50 55 60

Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys Glu Lys Ile Phe

85 90 95

Ala Ala Phe Pro Gly Leu Lys Glu Cys Thr Asn Pro Ala Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp

130 135 140

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

165 170 175

Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Asp Thr Ser Tyr Arg Tyr Glu Glu Gly Lys Asn

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

210 215 220

Asn Asp Ala Tyr Ala Gly Gly Thr Lys Cys Ser Ala Asp Leu Lys Lys

225 230 235 240

Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly Ser Ser Lys Ala

245 250 255

Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu

260 265 270

Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val

275 280 285

Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Glu Glu Gly Gln Asn Val

290 295 300

Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly

305 310 315 320

Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu Val Thr

325 330 335

Ile Lys Ser Asn Ala Asn Val Pro Val Thr Val Thr Val Ala Leu Ala

340 345 350

Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro

355 360 365

Pro Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly Thr Val Lys

370 375 380

Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser Ser

385 390 395 400

Thr Asn Glu Ser Ala Ser Phe Thr Phe Thr Gly Val Val Lys Ala Pro

405 410 415

Phe Tyr Lys Asp Gly Ala Trp Lys Asn Asp Leu Asn Ser Pro Ala Pro

420 425 430

Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys Lys

435 440 445

Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn

450 455 460

Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp

465 470 475 480

Glu Thr Ser Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Thr Gly

485 490 495

His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp Ala

500 505 510

His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr Asn Ser Thr

515 520 525

Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val

530 535 540

Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu

545 550 555 560

Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly

565 570 575

Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu

580 585 590

Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg

595 600 605

Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp

610 615 620

Ile Lys Lys Trp Tyr Pro Glu Gly Glu Leu Pro Lys Phe Phe Ser Asp

625 630 635 640

Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys

645 650 655

Ala Arg Gly Asp Asp Val Gly Asp Lys Thr Phe Gly Gly Lys Asn Tyr

660 665 670

Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala

675 680 685

Ser Trp Val Ala Gln Thr Asp Leu Ser Ala Phe Phe Lys Lys Trp Asn

690 695 700

Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Thr Glu Met Ser Phe

705 710 715 720

Glu Gly Gly Val Ser Gln Ser Ala Tyr Ser Thr Leu Ala Ser Leu Lys

725 730 735

Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Lys Val Thr Glu

740 745 750

His Lys Met Ser Leu Glu

755

<210> SEQ ID NO 46

<211> LENGTH: 758

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 46

Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Arg Arg Ser Thr Pro

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Lys Pro Pro Tyr

20 25 30

Thr Ile Asp Asp Thr Thr Lys Glu Val Ile Trp Lys Tyr Gln Gln Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Gln Glu

50 55 60

Glu Val Glu Gly Lys Gln Val Thr Gln Phe Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Pro Glu Ser Leu Ala Ala Ala Lys Gln Arg Ile Leu

85 90 95

Asp Ala Phe Pro Gly Leu Glu Val Cys Lys Asp Ser Asp Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Asp Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Asp Leu Ser Ala Asp

130 135 140

Thr Ala Lys Ala Met Leu Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Gln Gly

165 170 175

Glu Arg Leu Asn Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Glu Thr Lys Tyr Arg Tyr Glu Glu Gly Lys Glu

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Thr

210 215 220

Asn Asn Ala Tyr Val Gly Thr Gln Cys Ser Ala Glu Leu Lys Lys Ser

225 230 235 240

Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Glu Ser Ser Lys Ala Gly

245 250 255

Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr

260 265 270

Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp

275 280 285

Val Glu Lys Tyr Pro Gly Val Val Asn Thr Asn Gly Glu Thr Val Thr

290 295 300

Gln Asn Ile Asn Leu Tyr Ser Ala Pro Thr Lys Trp Phe Ala Gly Asn

305 310 315 320

Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln Glu Val Ser Ile

325 330 335

Glu Ser Lys Ala Thr Val Pro Val Thr Val Thr Val Ala Leu Ala Asp

340 345 350

Asp Leu Thr Gly Arg Glu Lys His Glu Val Ser Leu Asn Arg Pro Pro

355 360 365

Arg Val Thr Lys Thr Tyr Asp Leu Lys Ala Asn Asp Lys Val Thr Phe

370 375 380

Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asp Ser Lys Glu

385 390 395 400

Val Gln Ser Ala Asp Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe

405 410 415

Tyr Lys Asp Gly Lys Trp Gln His Asp Leu Asn Ser Pro Ala Pro Leu

420 425 430

Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr Pro Lys Lys Asn

435 440 445

Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn Asp

450 455 460

Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp Ser

465 470 475 480

Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Pro Gly His

485 490 495

Lys His Arg Phe Ala Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His

500 505 510

Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn Ser Thr Thr

515 520 525

Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly

530 535 540

His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val

545 550 555 560

Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys

565 570 575

Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu

580 585 590

Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu

595 600 605

Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile

610 615 620

Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro Glu Phe Tyr Ser Glu

625 630 635 640

Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys

645 650 655

Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe Gly Gly Lys Asn Tyr

660 665 670

Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala

675 680 685

Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn

690 695 700

Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met Ser Phe

705 710 715 720

Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu Lys

725 730 735

Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Lys Val Thr Glu

740 745 750

His Lys Met Ser Val Glu

755

<210> SEQ ID NO 47

<211> LENGTH: 757

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 47

Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Gln Arg Glu Lys Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Phe Val Asp Gly Lys Pro Pro Tyr

20 25 30

Thr Ile Asp Glu Thr Thr Lys Glu Val Ile Trp Lys Tyr Gln Gln Asp

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Leu Glu

50 55 60

Asp Val Asp Gly Lys Gln Val Lys Arg Tyr Ala Phe Ile Asp Glu Ala

65 70 75 80

Glu His Glu Thr Asn Glu Ser Leu Glu Ala Ala Lys Ala Lys Ile Ile

85 90 95

Lys Ala Phe Pro Gly Leu Glu Glu Cys Lys Asp Pro Thr Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Asn Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Arg Tyr Thr Gln Leu Asn Leu Ser Ala Asp

130 135 140

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

165 170 175

Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Glu Ile Glu Tyr Ser Tyr Asp Ser Ser Lys Glu

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

210 215 220

Asn Asp Ala Tyr Thr Lys Gly Thr Leu Cys Ser Ala Glu Leu Lys Gln

225 230 235 240

Ser Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Gly Ser Lys Ala Gly

245 250 255

Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr

260 265 270

Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp

275 280 285

Val Glu Lys Tyr Pro Gly Ala Val Ser Val Gly Gly Glu Glu Val Thr

290 295 300

Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn

305 310 315 320

Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu Val Thr Ile

325 330 335

Lys Ser Asn Ala Asn Val Pro Val Thr Val Thr Val Ala Leu Ala Asp

340 345 350

Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro

355 360 365

Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly Thr Val Lys Phe

370 375 380

Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser Ser Thr

385 390 395 400

Asn Glu Ser Ala Ser Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe

405 410 415

Tyr Lys Asp Gly Ala Trp Lys Asn Asp Leu Asn Ser Pro Ala Pro Leu

420 425 430

Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr Pro Lys Lys Asn

435 440 445

Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Asp Gln Phe Ala Lys Asp

450 455 460

Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asn Asp

465 470 475 480

Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Thr Gly His

485 490 495

Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His

500 505 510

Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr Asn Ser Thr Thr

515 520 525

Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly

530 535 540

His Asn Ala Ala Glu Thr Pro Leu Asn Val Pro Gly Ala Thr Glu Val

545 550 555 560

Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys

565 570 575

Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Asp

580 585 590

Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu

595 600 605

Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile

610 615 620

Thr Lys Trp Tyr Pro Asp Gly Lys Leu Pro Ala Phe Tyr Ser Glu Arg

625 630 635 640

Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala

645 650 655

Arg Gly Asp Asp Val Gly Asn Ser Thr Phe Gly Gly Lys Asn Tyr Cys

660 665 670

Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser

675 680 685

Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn Pro

690 695 700

Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ala Glu Met Ser Phe Glu

705 710 715 720

Gly Gly Val Ser Ser Ser Ala Tyr Ser Thr Leu Ala Ser Leu Asn Leu

725 730 735

Pro Lys Pro Glu Lys Gly Pro Glu Thr Ile Asn Lys Val Thr Glu His

740 745 750

Lys Met Ser Ala Glu

755

<210> SEQ ID NO 48

<211> LENGTH: 758

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 48

Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ser Thr Pro

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Lys Pro Pro Tyr

20 25 30

Thr Ile Asp Asp Thr Thr Lys Glu Val Ile Trp Lys Tyr Gln Gln Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Gln Glu

50 55 60

Glu Val Glu Gly Lys Gln Val Thr Gln Phe Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Pro Glu Ser Leu Ala Ala Ala Lys Gln Arg Ile Leu

85 90 95

Asp Ala Phe Pro Gly Leu Glu Val Cys Lys Asp Ser Asp Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Asp Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Asp Leu Ser Ala Asp

130 135 140

Thr Ala Lys Ala Met Leu Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Gln Gly

165 170 175

Glu Arg Leu Asn Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Glu Thr Lys Tyr Arg Tyr Glu Glu Gly Lys Glu

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Thr

210 215 220

Asn Asn Ala Tyr Val Gly Thr Gln Cys Ser Ala Glu Leu Lys Lys Ser

225 230 235 240

Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Glu Ser Ser Lys Ala Gly

245 250 255

Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr

260 265 270

Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp

275 280 285

Val Glu Lys Tyr Pro Gly Val Val Asn Thr Asn Gly Glu Thr Val Thr

290 295 300

Gln Asn Ile Asn Leu Tyr Ser Ala Pro Thr Lys Trp Phe Ala Gly Asn

305 310 315 320

Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln Glu Val Ser Ile

325 330 335

Glu Ser Lys Ser Thr Val Pro Val Thr Val Thr Val Ala Leu Ala Asp

340 345 350

Asp Leu Thr Gly Arg Glu Lys His Glu Val Ser Leu Asn Arg Pro Pro

355 360 365

Arg Val Thr Lys Thr Tyr Asp Leu Lys Ala Asn Asp Lys Val Thr Phe

370 375 380

Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asp Ser Lys Glu

385 390 395 400

Val Gln Ser Ala Asp Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe

405 410 415

Tyr Lys Asp Gly Lys Trp Gln His Asp Leu Asn Ser Pro Ala Pro Leu

420 425 430

Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr Pro Lys Lys Asn

435 440 445

Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn Asp

450 455 460

Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp Ser

465 470 475 480

Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Pro Gly His

485 490 495

Lys His Arg Phe Ala Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His

500 505 510

Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn Ser Thr Thr

515 520 525

Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly

530 535 540

His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val

545 550 555 560

Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys

565 570 575

Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu

580 585 590

Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu

595 600 605

Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile

610 615 620

Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro Glu Phe Tyr Ser Glu

625 630 635 640

Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys

645 650 655

Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe Gly Gly Lys Asn Tyr

660 665 670

Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala

675 680 685

Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn

690 695 700

Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met Ser Phe

705 710 715 720

Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu Asp

725 730 735

Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Gln Val Thr Glu

740 745 750

His Lys Met Ser Ala Glu

755

<210> SEQ ID NO 49

<211> LENGTH: 761

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 49

Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ala Thr Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Val Val Glu Gly Glu Leu Pro Tyr

20 25 30

Thr Ile Asp Ser Lys Thr Gly Lys Val Thr Trp Lys Tyr Gln Ile Asp

35 40 45

Asn Lys Pro Asp Lys Lys Pro Lys Leu Glu Val Ala Ser Trp Gln Glu

50 55 60

Glu Val Asp Gly Lys Gln Val Thr Gln Phe Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Thr Glu Ser Leu Asp Ala Ala Lys Lys Lys Ile Leu

85 90 95

Glu Lys Phe Lys Gly Leu Glu Glu Cys Lys Asp Ser Thr Tyr His Tyr

100 105 110

Glu Ile Asn Cys Leu Glu Tyr Arg Pro Gly Thr Asn Val Pro Ala Thr

115 120 125

Gly Gly Met Tyr Val Pro Arg Tyr Thr Gln Leu Asn Leu Ser Ala Asp

130 135 140

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

165 170 175

Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Glu Ile Glu Tyr Ser Tyr Asp Ser Ser Lys Glu

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

210 215 220

Asn Asp Ala Tyr Thr Gly Gly Thr Gln Cys Ser Asp Glu Leu Lys Lys

225 230 235 240

Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Glu Lys Ser Val Asn Lys

245 250 255

Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro

260 265 270

Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys

275 280 285

Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Glu Glu Gly Gln Glu

290 295 300

Val Thr Glu Ser Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala

305 310 315 320

Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu Val

325 330 335

Thr Ile Lys Ser Asn Ala Asp Val Pro Val Thr Val Thr Val Ala Leu

340 345 350

Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg

355 360 365

Pro Pro Lys Val Thr Lys Thr Tyr Glu Leu Lys Ala Asn Gly Glu Val

370 375 380

Lys Phe Thr Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser

385 390 395 400

Lys Glu Asn Asn Lys Ser Ala Ser Phe Thr Phe Thr Gly Val Val Lys

405 410 415

Ala Pro Phe Tyr Lys Asn Gly Ala Trp Lys Asn Ala Leu Asn Ser Pro

420 425 430

Ala Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro

435 440 445

Lys Lys Asn Leu Glu Ala Ser Asn Phe Thr Gly Gly Val Ala Glu Phe

450 455 460

Ala Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly

465 470 475 480

Arg Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu

485 490 495

Thr Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly

500 505 510

Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr Asn

515 520 525

Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His

530 535 540

Glu Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala

545 550 555 560

Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr

565 570 575

Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu

580 585 590

Tyr Leu Glu Glu Ser Asn Asn Gln Ala Trp Ala Arg Gly Gly Ala Gly

595 600 605

Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn

610 615 620

Phe Asp Ile Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro Glu Phe

625 630 635 640

Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met

645 650 655

His Arg Lys Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe Gly Gly

660 665 670

Arg Asn Tyr Cys Ala Glu Ser Asn Gly Asn Thr Ala Asp Thr Leu Met

675 680 685

Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys

690 695 700

Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Thr Glu

705 710 715 720

Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala

725 730 735

Ser Leu Asp Leu Pro Lys Pro Lys Gln Gly Pro Glu Thr Ile Asn Lys

740 745 750

Val Thr Glu Tyr Ser Met Pro Ala Glu

755 760

<210> SEQ ID NO 50

<211> LENGTH: 757

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 50

Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ser Thr Pro

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Lys Pro Pro Tyr

20 25 30

Thr Ile Asp Asp Thr Thr Lys Glu Val Ile Trp Lys Tyr Gln Gln Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Gln Glu

50 55 60

Glu Val Glu Gly Lys Gln Val Thr Gln Phe Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Pro Glu Ser Leu Ala Ala Ala Lys Lys Arg Ile Leu

85 90 95

Asp Ala Phe Pro Gly Leu Glu Glu Cys Lys Asp Ser Asp Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp

130 135 140

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

165 170 175

Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Lys Ile Glu Tyr Arg Tyr Glu Asn Asp Lys Asp

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

210 215 220

Asn Asn Ala Tyr Asp Gly Gly Thr Gln Cys Ser Ala Glu Leu Lys Gln

225 230 235 240

Ser Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Gly Ser Lys Ala Gly

245 250 255

Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr

260 265 270

Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp

275 280 285

Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu Gly Glu Glu Val Thr

290 295 300

Glu Thr Ile Asn Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn

305 310 315 320

Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln Glu Val Ser Ile

325 330 335

Lys Ser Asn Ala Lys Val Pro Val Thr Val Thr Val Ala Leu Ala Asp

340 345 350

Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro

355 360 365

Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly Thr Val Lys Phe

370 375 380

Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Ser Asp Ser Lys Glu

385 390 395 400

Glu Lys Ser Ala Asn Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe

405 410 415

Tyr Lys Asp Gly Lys Trp Lys Asn Asp Leu Lys Ser Pro Ala Pro Leu

420 425 430

Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr Pro Lys Lys Asn

435 440 445

Leu Glu Ala Ser Asn Tyr Lys Gly Gly Leu Lys Gln Phe Ala Glu Asp

450 455 460

Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp Gly

465 470 475 480

Glu Ser Gly Lys His Arg Met Phe Thr Tyr Glu Ala Leu Thr Gly His

485 490 495

Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His

500 505 510

Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn Ser Thr Thr

515 520 525

Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly

530 535 540

His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val

545 550 555 560

Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys

565 570 575

Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu

580 585 590

Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu

595 600 605

Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile

610 615 620

Lys Gln Trp Tyr Pro Glu Gly Ser Leu Pro Ala Phe Tyr Ser Glu Arg

625 630 635 640

Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala

645 650 655

Arg Gly Asp Asp Val Gly Asn Asp Lys Phe Gly Asn Arg Asn Tyr Cys

660 665 670

Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser

675 680 685

Trp Val Ala Gln Thr Asp Leu Ser Ala Phe Phe Lys Lys Trp Asn Pro

690 695 700

Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Thr Glu Met Ser Phe Glu

705 710 715 720

Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu Asp Leu

725 730 735

Pro Lys Pro Lys Gln Gly Pro Glu Thr Ile Asn Lys Val Thr Glu Tyr

740 745 750

Ser Met Pro Ala Glu

755

<210> SEQ ID NO 51

<211> LENGTH: 759

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 51

Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg Ala Thr Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Ala Leu Pro Tyr

20 25 30

Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys Tyr Gln Val Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Leu Glu

50 55 60

Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys Glu Lys Ile Phe

85 90 95

Ala Ala Phe Pro Gly Leu Lys Glu Cys Thr Asn Pro Ala Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp

130 135 140

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

165 170 175

Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Asp Thr Ser Tyr Arg Tyr Glu Glu Gly Lys Asn

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

210 215 220

Asn Asp Ala Tyr Ala Gly Gly Thr Lys Cys Ser Ala Asp Leu Lys Lys

225 230 235 240

Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly Ser Ser Lys Ala

245 250 255

Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu

260 265 270

Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val

275 280 285

Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Glu Glu Gly Gln Asn Val

290 295 300

Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly

305 310 315 320

Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu Val Thr

325 330 335

Ile Lys Ser Asn Ala Asn Val Pro Val Thr Val Thr Val Ala Leu Ala

340 345 350

Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro

355 360 365

Pro Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly Thr Val Lys

370 375 380

Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser Ser

385 390 395 400

Thr Asn Glu Ser Ala Ser Phe Thr Phe Thr Gly Val Val Lys Ala Pro

405 410 415

Phe Tyr Lys Asp Gly Ala Trp Lys Asn Asp Leu Asn Ser Pro Ala Pro

420 425 430

Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys Lys

435 440 445

Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn

450 455 460

Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp

465 470 475 480

Ser Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Pro Gly

485 490 495

His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp Ala

500 505 510

His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn Ser Thr

515 520 525

Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val

530 535 540

Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu

545 550 555 560

Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly

565 570 575

Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu

580 585 590

Glu Glu Ser Asn Asn Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg

595 600 605

Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp

610 615 620

Ile Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro Glu Phe Tyr Ser

625 630 635 640

Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg

645 650 655

Lys Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe Gly Gly Lys Asn

660 665 670

Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys

675 680 685

Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp

690 695 700

Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met Ser

705 710 715 720

Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu

725 730 735

Asp Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Gln Val Thr

740 745 750

Glu His Lys Met Ser Ala Glu

755

<210> SEQ ID NO 52

<211> LENGTH: 757

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 52

Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ser Thr Pro

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Lys Pro Pro Tyr

20 25 30

Thr Ile Asp Asp Thr Thr Lys Glu Val Ile Trp Lys Tyr Gln Gln Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Gln Glu

50 55 60

Glu Val Glu Gly Lys Gln Val Thr Gln Phe Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Pro Glu Ser Leu Ala Ala Ala Lys Lys Arg Ile Leu

85 90 95

Asp Ala Phe Pro Gly Leu Glu Glu Cys Lys Asp Ser Asp Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp

130 135 140

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

165 170 175

Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Lys Ile Glu Tyr Arg Tyr Glu Asn Asp Lys Asp

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

210 215 220

Asn Asn Ala Tyr Asp Gly Gly Thr Gln Cys Ser Ala Glu Leu Lys Gln

225 230 235 240

Ser Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Gly Ser Lys Ala Gly

245 250 255

Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr

260 265 270

Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp

275 280 285

Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu Gly Glu Glu Val Thr

290 295 300

Glu Thr Ile Asn Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn

305 310 315 320

Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln Glu Val Ser Ile

325 330 335

Lys Ser Asn Ala Lys Val Pro Val Thr Val Thr Val Ala Leu Ala Asp

340 345 350

Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg Pro Pro

355 360 365

Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly Thr Val Lys Phe

370 375 380

Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Ser Asp Ser Lys Glu

385 390 395 400

Glu Lys Ser Ala Asn Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe

405 410 415

Tyr Lys Asp Gly Lys Trp Lys Asn Asp Leu Lys Ser Pro Ala Pro Leu

420 425 430

Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr Pro Lys Lys Asn

435 440 445

Leu Glu Ala Ser Asn Tyr Lys Gly Gly Leu Lys Gln Phe Ala Glu Asp

450 455 460

Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp Gly

465 470 475 480

Glu Ser Gly Lys His Arg Met Phe Thr Tyr Glu Ala Leu Thr Gly His

485 490 495

Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His

500 505 510

Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn Ser Thr Thr

515 520 525

Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly

530 535 540

His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val

545 550 555 560

Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys

565 570 575

Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu

580 585 590

Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu

595 600 605

Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile

610 615 620

Lys Gln Trp Tyr Pro Glu Gly Ser Leu Pro Ala Phe Tyr Ser Glu Arg

625 630 635 640

Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys Ala

645 650 655

Arg Gly Asp Asp Val Gly Asn Asp Lys Phe Gly Asn Arg Asn Tyr Cys

660 665 670

Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala Ser

675 680 685

Trp Val Ala Gln Thr Asp Leu Ser Ala Phe Phe Lys Lys Trp Asn Pro

690 695 700

Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Thr Glu Met Ser Phe Glu

705 710 715 720

Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu Asp Leu

725 730 735

Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Gln Val Thr Glu His

740 745 750

Lys Met Ser Ala Glu

755

<210> SEQ ID NO 53

<211> LENGTH: 762

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 53

Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg Glu Lys Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Ser Ala Gln Pro Pro

20 25 30

Tyr Thr Ile Asp Pro Asp Thr Gly Lys Val Thr Trp Lys Tyr Gln Glu

35 40 45

Glu Gly Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Gln

50 55 60

Glu Asp Val Asp Gly Lys Gln Val Thr Arg Tyr Ala Phe Ile Asp Glu

65 70 75 80

Ala Glu His Ser Thr Glu Glu Ser Leu Glu Ala Ala Lys Ala Lys Ile

85 90 95

Phe Glu Lys Phe Pro Gly Leu Gln Glu Cys Lys Asp Ser Thr Tyr His

100 105 110

Tyr Glu Ile Asn Cys Leu Glu Arg Arg Pro Gly Thr Asp Val Pro Val

115 120 125

Thr Gly Gly Met Tyr Val Pro Arg Tyr Thr Gln Leu Asn Leu Asp Ala

130 135 140

Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile

145 150 155 160

Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys

165 170 175

Gly Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met

180 185 190

Ser Val Trp Leu Trp Asn Lys Ile Glu Tyr Arg Tyr Glu Asn Asp Lys

195 200 205

Asp Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr

210 215 220

Ala Asn Asn Ala Tyr Ser Glu Gly Thr Gln Cys Ser Ala Asp Leu Lys

225 230 235 240

Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly Ser Ser Lys

245 250 255

Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro

260 265 270

Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys

275 280 285

Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu Gly Glu Lys

290 295 300

Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala

305 310 315 320

Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln Glu Val

325 330 335

Thr Ile Glu Ser Thr Ala Ser Val Pro Val Thr Val Thr Val Ala Leu

340 345 350

Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg

355 360 365

Pro Pro Lys Val Thr Lys Thr Tyr Asp Leu Lys Ala Asn Asp Lys Val

370 375 380

Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser

385 390 395 400

Pro Lys Asn Glu Ser Ala Glu Phe Thr Phe Thr Gly Val Val Lys Ala

405 410 415

Pro Phe Tyr Lys Asp Gly Glu Trp Lys Asn Ala Leu Asn Ser Pro Ala

420 425 430

Pro Leu Gly Glu Leu Glu Ser Asp Ser Phe Val Tyr Thr Ala Pro Lys

435 440 445

Asn Asn Leu Asn Ala Ser Asn Tyr Ser Asn Tyr Thr Asp Gly Val Ala

450 455 460

Glu Phe Ala Lys Glu Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe

465 470 475 480

Tyr Gly Arg Asp Gly Glu Ser Gly Asn His Arg Met Phe Thr Tyr Lys

485 490 495

Ala Leu Thr Gly His Lys His Arg Phe Ala Asn Asp Val Gln Ile Ser

500 505 510

Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser

515 520 525

Thr Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile

530 535 540

Trp His Glu Val Gly His Asn Ala Ala Glu Thr Pro Leu Asn Val Pro

545 550 555 560

Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp

565 570 575

Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala

580 585 590

Pro Glu Tyr Leu Asp Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly

595 600 605

Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu

610 615 620

Glu Asn Phe Asp Ile Lys Gln Trp Tyr Pro Asp Gly Glu Leu Pro Lys

625 630 635 640

Phe Tyr Ser Asp Arg Lys Gly Met Lys Gly Trp Asn Leu Phe Gln Leu

645 650 655

Met His Arg Lys Ala Arg Gly Asp Asp Val Ser Asn Asp Lys Phe Gly

660 665 670

Gly Arg Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu

675 680 685

Met Leu Cys Ala Ser Trp Val Ala Gln Ala Asp Leu Ser Glu Phe Phe

690 695 700

Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser

705 710 715 720

Glu Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu

725 730 735

Ala Ala Met His Leu Ser Lys Pro Glu Lys Gly Pro Glu Thr Ile Asn

740 745 750

Lys Val Thr Glu Tyr Ser Met Pro Ala Glu

755 760

<210> SEQ ID NO 54

<211> LENGTH: 758

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 54

Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ser Thr Pro

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Lys Pro Pro Tyr

20 25 30

Thr Ile Asp Asp Thr Thr Lys Glu Val Ile Trp Lys Tyr Gln Gln Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Gln Glu

50 55 60

Glu Val Glu Gly Lys Gln Val Thr Gln Phe Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Pro Glu Ser Leu Ala Ala Ala Lys Gln Arg Ile Leu

85 90 95

Asp Ala Phe Pro Gly Leu Glu Val Cys Lys Asp Ser Asp Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Asp Leu Gly Ala Asp

130 135 140

Thr Ala Lys Ala Met Leu Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Leu Gln Gly

165 170 175

Glu Arg Leu Asn Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Glu Thr Lys Tyr Arg Tyr Glu Glu Gly Lys Glu

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Thr

210 215 220

Asn Asn Ala Tyr Val Gly Thr Gln Cys Ser Ala Glu Leu Lys Lys Ser

225 230 235 240

Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Glu Ser Ser Lys Ala Gly

245 250 255

Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr

260 265 270

Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys Val Asp

275 280 285

Val Glu Lys Tyr Pro Gly Val Val Asn Thr Asn Gly Glu Thr Val Thr

290 295 300

Gln Asn Ile Asn Leu Tyr Ser Ala Pro Thr Lys Trp Phe Ala Gly Asn

305 310 315 320

Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln Glu Val Ser Ile

325 330 335

Glu Ser Lys Ala Thr Val Pro Val Thr Val Thr Val Ala Leu Ala Asp

340 345 350

Asp Leu Thr Gly Arg Glu Lys His Glu Val Ser Leu Asn Arg Pro Pro

355 360 365

Arg Val Thr Lys Thr Tyr Asp Leu Lys Ala Asn Asp Lys Val Thr Phe

370 375 380

Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asp Ser Lys Glu

385 390 395 400

Val Gln Ser Ala Asp Phe Thr Phe Thr Gly Val Val Lys Ala Pro Phe

405 410 415

Tyr Lys Asp Gly Lys Trp Gln His Asp Leu Asn Ser Pro Ala Pro Leu

420 425 430

Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr Pro Lys Lys Asn

435 440 445

Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln Phe Ala Asn Asp

450 455 460

Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg Asp Ser

465 470 475 480

Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Pro Gly His

485 490 495

Lys His Arg Phe Ala Asn Asp Val Gln Ile Ser Ile Gly Asp Ala His

500 505 510

Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn Ser Thr Thr

515 520 525

Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu Val Gly

530 535 540

His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr Glu Val

545 550 555 560

Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu Gly Lys

565 570 575

Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr Leu Glu

580 585 590

Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp Arg Leu

595 600 605

Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe Asp Ile

610 615 620

Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro Glu Phe Tyr Ser Glu

625 630 635 640

Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg Lys

645 650 655

Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe Gly Gly Lys Asn Tyr

660 665 670

Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys Ala

675 680 685

Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp Asn

690 695 700

Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Thr Glu Met Ser Phe

705 710 715 720

Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu Asn

725 730 735

Leu Pro Lys Pro Lys Gln Gly Pro Glu Thr Ile Asn Lys Val Thr Glu

740 745 750

Tyr Ser Met Pro Ala Glu

755

<210> SEQ ID NO 55

<211> LENGTH: 759

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 55

Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg Ala Thr Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Ala Leu Pro Tyr

20 25 30

Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys Tyr Gln Val Glu

35 40 45

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Leu Glu

50 55 60

Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys Ala Lys Ile Phe

85 90 95

Glu Lys Phe Pro Gly Leu Lys Glu Cys Lys Asp Pro Thr Tyr His Tyr

100 105 110

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp

130 135 140

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

165 170 175

Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Lys Ile Glu Tyr Arg Tyr Glu Asn Asp Lys Asp

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

210 215 220

Asn Asp Ala Tyr Thr Gly Gly Thr Gln Cys Ser Asp Glu Leu Lys Lys

225 230 235 240

Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Glu Lys Ser Val Asn Lys

245 250 255

Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro

260 265 270

Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys

275 280 285

Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu Gly Glu Lys

290 295 300

Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala

305 310 315 320

Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu Val

325 330 335

Thr Ile Glu Ser Ser Ala Ser Val Pro Val Thr Val Thr Val Ala Leu

340 345 350

Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg

355 360 365

Pro Pro Lys Val Thr Lys Thr Tyr Asp Leu Lys Ala Asn Asp Lys Val

370 375 380

Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser

385 390 395 400

Pro Lys Asn Glu Ser Ala Glu Phe Thr Phe Thr Gly Val Val Lys Ala

405 410 415

Pro Phe Tyr Lys Asp Gly Glu Trp Lys Asn Ala Leu Asn Ser Pro Ala

420 425 430

Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys

435 440 445

Lys Asn Leu Glu Ala Ser Asn Phe Thr Gly Gly Val Ala Glu Phe Ala

450 455 460

Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg

465 470 475 480

Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Thr

485 490 495

Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp

500 505 510

Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr Asn Ser

515 520 525

Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu

530 535 540

Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr

545 550 555 560

Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu

565 570 575

Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr

580 585 590

Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp

595 600 605

Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe

610 615 620

Asp Ile Lys Gln Trp Tyr Pro Glu Gly Asp Leu Pro Lys Phe Tyr Ser

625 630 635 640

Asp Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg

645 650 655

Lys Ala Arg Gly Asp Asp Val Gly Lys Thr Lys Phe Gly Glu Arg Asn

660 665 670

Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Lys Leu Met Leu Cys

675 680 685

Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp

690 695 700

Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met Asn

705 710 715 720

Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Glu Thr Leu Ala Ala Leu

725 730 735

Asn Leu Pro Lys Pro Gln Gln Gly Pro Glu Thr Ile Asn Gln Val Thr

740 745 750

Glu His Lys Met Ser Ala Glu

755

<210> SEQ ID NO 56

<211> LENGTH: 759

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 56

Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ala Thr Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Val Val Glu Gly Glu Leu Pro Tyr

20 25 30

Thr Ile Asp Ser Lys Thr Gly Lys Val Thr Trp Lys Tyr Gln Ile Asp

35 40 45

Asn Lys Pro Asp Lys Lys Pro Lys Leu Glu Val Ala Ser Trp Gln Glu

50 55 60

Glu Val Asp Gly Lys Gln Val Thr Gln Phe Ala Phe Ile Asp Glu Ala

65 70 75 80

Asp His Lys Thr Thr Glu Ser Leu Asp Ala Ala Lys Lys Lys Ile Leu

85 90 95

Glu Lys Phe Lys Gly Leu Glu Glu Cys Lys Asp Ser Thr Tyr His Tyr

100 105 110

Glu Ile Asn Cys Leu Glu Tyr Arg Pro Gly Thr Asn Val Pro Val Thr

115 120 125

Gly Gly Met Tyr Val Pro Arg Tyr Thr Gln Leu Asn Leu Ser Ala Asp

130 135 140

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

145 150 155 160

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

165 170 175

Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

180 185 190

Val Trp Leu Trp Asn Glu Ile Glu Tyr Ser Tyr Asp Ser Ser Lys Glu

195 200 205

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

210 215 220

Asn Asp Ala Tyr Thr Gly Gly Thr Gln Cys Ser Asp Glu Leu Lys Lys

225 230 235 240

Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Glu Lys Ser Val Asn Lys

245 250 255

Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro

260 265 270

Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys

275 280 285

Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu Gly Glu Lys

290 295 300

Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala

305 310 315 320

Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu Val

325 330 335

Thr Ile Glu Ser Ser Ala Ser Val Pro Val Thr Val Thr Val Ala Leu

340 345 350

Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg

355 360 365

Pro Pro Lys Val Thr Lys Thr Tyr Asp Leu Lys Ala Asn Asp Lys Val

370 375 380

Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser

385 390 395 400

Pro Lys Asn Glu Ser Ala Glu Phe Thr Phe Thr Gly Val Val Lys Ala

405 410 415

Pro Phe Tyr Lys Asp Gly Glu Trp Lys Asn Ala Leu Asn Ser Pro Ala

420 425 430

Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys

435 440 445

Lys Asn Leu Glu Ala Ser Asn Phe Thr Gly Gly Val Ala Glu Phe Ala

450 455 460

Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg

465 470 475 480

Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Thr

485 490 495

Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp

500 505 510

Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr Asn Ser

515 520 525

Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu

530 535 540

Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr

545 550 555 560

Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu

565 570 575

Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr

580 585 590

Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp

595 600 605

Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe

610 615 620

Asp Ile Lys Thr Trp Tyr Pro Asp Gly Asn Leu Pro Ala Phe Tyr Ser

625 630 635 640

Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg

645 650 655

Lys Ala Arg Gly Asp Glu Val Gly Lys Thr Lys Phe Gly Glu Arg Asn

660 665 670

Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys

675 680 685

Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp

690 695 700

Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met Asn

705 710 715 720

Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Glu Thr Leu Ala Ala Leu

725 730 735

Asn Leu Pro Lys Pro Gln Gln Gly Pro Glu Thr Ile Asn Gln Val Thr

740 745 750

Glu His Lys Met Ser Ala Glu

755

<210> SEQ ID NO 57

<211> LENGTH: 759

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 57

Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ala Thr Gly

1 5 10 15

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Ala Asp Gly Ala Gln Pro Pro

20 25 30

Tyr Thr Ile Asp Pro Asn Thr Gly Glu Val Thr Trp Lys Tyr Gln Gln

35 40 45

Asp Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Gln

50 55 60

Glu Glu Val Glu Gly Lys Gln Val Thr Arg Tyr Ala Phe Ile Asp Glu

65 70 75 80

Ala Glu Tyr Thr Thr Glu Glu Ser Leu Glu Ala Ala Lys Ala Lys Ile

85 90 95

Phe Glu Lys Phe Pro Gly Leu Gln Glu Cys Lys Asp Ser Thr Tyr His

100 105 110

Tyr Glu Ile Asn Cys Leu Glu Arg Arg Pro Gly Thr Asp Val Pro Val

115 120 125

Thr Gly Gly Met Tyr Val Pro Arg Tyr Thr Gln Leu Asn Leu Asp Ala

130 135 140

Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile

145 150 155 160

Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Lys Gly Ser Lys

165 170 175

Gly Glu Arg Leu Asn Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met

180 185 190

Ser Val Trp Leu Trp Asn Asp Thr Lys Tyr Arg Tyr Glu Glu Gly Lys

195 200 205

Glu Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr

210 215 220

Ala Asn Asp Ala Tyr Ala Gly Gly Thr Lys Cys Ser Ala Asp Leu Lys

225 230 235 240

Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly Ser Ser Lys

245 250 255

Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro

260 265 270

Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys

275 280 285

Val Asp Val Glu Lys Tyr Pro Gly Ser Val Ser Ala Lys Gly Glu Ser

290 295 300

Val Thr Glu Asn Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala

305 310 315 320

Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln Asp Val

325 330 335

Thr Ile Lys Ser Ser Ala Ser Val Pro Val Thr Val Thr Val Ala Leu

340 345 350

Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg

355 360 365

Pro Pro Arg Val Thr Lys Thr Tyr Thr Leu Glu Ala Asn Gly Glu Val

370 375 380

Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asp Ser

385 390 395 400

Lys Asp Asp Val Ser Ala Asn Phe Thr Phe Thr Gly Val Val Lys Ala

405 410 415

Pro Phe Tyr Lys Asp Gly Glu Trp Lys Asn Asp Leu Asp Ser Pro Ala

420 425 430

Pro Leu Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr Pro Lys

435 440 445

Lys Asn Leu Glu Ala Ser Asn Phe Thr Gly Gly Val Ala Glu Phe Ala

450 455 460

Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg

465 470 475 480

Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Thr

485 490 495

Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp

500 505 510

Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr Asn Ser

515 520 525

Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Glu

530 535 540

Val Gly His Asn Ala Ala Glu Thr Pro Leu Asn Val Pro Gly Ala Thr

545 550 555 560

Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu

565 570 575

Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr

580 585 590

Leu Asp Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp

595 600 605

Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Glu Asn Phe

610 615 620

Asp Ile Lys Gln Trp Tyr Pro Asp Gly Glu Leu Pro Lys Phe Tyr Ser

625 630 635 640

Asp Arg Lys Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg

645 650 655

Lys Ala Arg Gly Asp Asp Val Gly Asn Ser Thr Phe Gly Gly Lys Asn

660 665 670

Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys

675 680 685

Ala Ser Trp Val Ala Gln Ala Asp Leu Ser Glu Phe Phe Lys Lys Trp

690 695 700

Asn Pro Gly Ala Ser Ala Tyr Gln Leu Pro Gly Ala Thr Glu Met Ser

705 710 715 720

Phe Gln Gly Gly Val Ser Ser Ser Ala Tyr Ser Thr Leu Ala Ser Leu

725 730 735

Lys Leu Pro Lys Pro Glu Lys Gly Pro Glu Thr Ile Asn Lys Val Thr

740 745 750

Glu His Lys Met Ser Ala Glu

755

<210> SEQ ID NO 58

<211> LENGTH: 1497

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 58

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Ser Val Asp

1 5 10 15

Ser Gly Ser Gly Thr Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Thr

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Asp

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Asn Thr Val Ser Cys Val Val Gly Ser Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Asp Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Asn Ser Glu Asn Lys

130 135 140

Lys Thr Asn Ala Ile Ser Leu Val Thr Ser Ser Asp Ser Cys Pro Ala

145 150 155 160

Asp Ala Glu Gln Leu Cys Leu Thr Phe Ser Ser Val Val Asp Arg Ala

165 170 175

Arg Phe Glu Lys Leu Tyr Lys Gln Ile Asp Leu Ala Thr Asp Asn Phe

180 185 190

Ser Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Thr Val Val Pro Val Thr Thr Glu Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Gln Leu

245 250 255

Val Asp Ser Leu Gly Asn Gly Val Ala Gly Val Asp Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Asp Glu Asn Gly Lys Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Asp Glu Gly Asp Gln Asn Val Val Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Gln Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ser Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val Gln

500 505 510

Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Gly Gly

545 550 555 560

Gly Val Asn Ser Lys Gly Glu Cys Thr Leu Ser Gly Asp Ser Asp Asp

565 570 575

Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asn Asp Ile

580 585 590

Trp Gln Pro Asn Thr Lys Ser Ile Met Thr Val Gly Thr Asn Leu Glu

595 600 605

Asn Val Tyr Phe Lys Lys Ala Gly Gln Val Leu Gly Asn Ser Ala Pro

610 615 620

Phe Ala Phe His Glu Asp Phe Thr Gly Ile Thr Val Lys Gln Leu Thr

625 630 635 640

Ser Tyr Gly Asp Leu Asn Pro Glu Glu Ile Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Trp Ser Gly Asp Pro Tyr Ala Val Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Ser Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ala

740 745 750

Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro Ala Ala Asp Gly Ala Gln

755 760 765

Pro Pro Tyr Thr Ile Asp Pro Asn Thr Gly Glu Val Thr Trp Lys Tyr

770 775 780

Gln Gln Asp Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser

785 790 795 800

Trp Gln Glu Glu Val Glu Gly Lys Gln Val Thr Arg Tyr Ala Phe Ile

805 810 815

Asp Glu Ala Glu Tyr Thr Thr Glu Glu Ser Leu Glu Ala Ala Lys Ala

820 825 830

Lys Ile Phe Glu Lys Phe Pro Gly Leu Gln Glu Cys Lys Asp Ser Thr

835 840 845

Tyr His Tyr Glu Ile Asn Cys Leu Glu Arg Arg Pro Gly Thr Asp Val

850 855 860

Pro Val Thr Gly Gly Met Tyr Val Pro Arg Tyr Thr Gln Leu Asn Leu

865 870 875 880

Asp Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr

885 890 895

Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Lys Gly

900 905 910

Ser Lys Gly Glu Arg Leu Asn Ser Val Asp Leu Glu Arg Leu Tyr Gln

915 920 925

Asn Met Ser Val Trp Leu Trp Asn Asp Thr Lys Tyr Arg Tyr Glu Glu

930 935 940

Gly Lys Glu Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn

945 950 955 960

Cys Tyr Ala Asn Asp Ala Tyr Ala Gly Gly Thr Lys Cys Ser Ala Asp

965 970 975

Leu Lys Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly Ser

980 985 990

Ser Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu

995 1000 1005

Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn

1010 1015 1020

Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ser Val Ser Ala Lys Gly

1025 1030 1035 1040

Glu Ser Val Thr Glu Asn Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp

1045 1050 1055

Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln

1060 1065 1070

Asp Val Thr Ile Lys Ser Ser Ala Ser Val Pro Val Thr Val Thr Val

1075 1080 1085

Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu

1090 1095 1100

Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr Thr Leu Glu Ala Asn Gly

1105 1110 1115 1120

Glu Val Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly

1125 1130 1135

Asp Ser Lys Asp Asp Val Ser Ala Asn Phe Thr Phe Thr Gly Val Val

1140 1145 1150

Lys Ala Pro Phe Tyr Lys Asp Gly Glu Trp Lys Asn Asp Leu Asp Ser

1155 1160 1165

Pro Ala Pro Leu Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr

1170 1175 1180

Pro Lys Lys Asn Leu Glu Ala Ser Asn Phe Thr Gly Gly Val Ala Glu

1185 1190 1195 1200

Phe Ala Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr

1205 1210 1215

Gly Arg Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn

1220 1225 1230

Leu Thr Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile

1235 1240 1245

Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr

1250 1255 1260

Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp

1265 1270 1275 1280

His Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Asn Val Pro Gly

1285 1290 1295

Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg

1300 1305 1310

Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro

1315 1320 1325

Glu Tyr Leu Asp Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala

1330 1335 1340

Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Glu

1345 1350 1355 1360

Asn Phe Asp Ile Lys Gln Trp Tyr Pro Asp Gly Glu Leu Pro Lys Phe

1365 1370 1375

Tyr Ser Asp Arg Lys Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met

1380 1385 1390

His Arg Lys Ala Arg Gly Asp Asp Val Gly Asn Ser Thr Phe Gly Gly

1395 1400 1405

Lys Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met

1410 1415 1420

Leu Cys Ala Ser Trp Val Ala Gln Ala Asp Leu Ser Glu Phe Phe Lys

1425 1430 1435 1440

Lys Trp Asn Pro Gly Ala Ser Ala Tyr Gln Leu Pro Gly Ala Thr Glu

1445 1450 1455

Met Ser Phe Gln Gly Gly Val Ser Ser Ser Ala Tyr Ser Thr Leu Ala

1460 1465 1470

Ser Leu Lys Leu Pro Lys Pro Glu Lys Gly Pro Glu Thr Ile Asn Lys

1475 1480 1485

Val Thr Glu His Lys Met Ser Ala Glu

1490 1495

<210> SEQ ID NO 59

<211> LENGTH: 1498

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 59

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Ile Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala Thr

100 105 110

Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys

115 120 125

Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Ala Ser Asp Asp

130 135 140

Lys Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro

145 150 155 160

Ala Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser

165 170 175

Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu

180 185 190

Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp

195 200 205

Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro

210 215 220

Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu

225 230 235 240

Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg

245 250 255

Leu Val Asp Ser Met Gly Asn Gly Val Val Gly Val Asn Tyr Tyr Thr

260 265 270

Ser Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Lys Phe Asn Phe Ser

275 280 285

Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser

290 295 300

Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu

305 310 315 320

Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Gln Ala

325 330 335

Gly Lys Asn Asp Glu Arg Glu Val Pro Asp Val Val Arg Lys Val Phe

340 345 350

Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser

355 360 365

Asn Gly Glu Ala Leu Ser Glu Gly Asp Gln Thr Phe Glu Arg Thr Asn

370 375 380

Glu Phe Leu Glu Gln Phe Glu Ser Gly Gln Ala Lys Glu Ile Asp Thr

385 390 395 400

Ala Ile Cys Asp Ser Leu Gly Gly Cys Asn Ser Gln Arg Trp Phe Ser

405 410 415

Leu Thr Ala Arg Asn Val Asn Glu Gly Gln Ile Gln Gly Val Ile Asn

420 425 430

Lys Leu Trp Gly Val Asp Lys Asp Tyr Lys Ser Val Thr Lys Phe His

435 440 445

Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg

450 455 460

Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met

465 470 475 480

Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala

485 490 495

Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu Val

500 505 510

Glu Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe

515 520 525

Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn

530 535 540

Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Glu

545 550 555 560

Gly Gly Val Asp Lys Asn Gly Gln Cys Thr Arg Asn Ser Asp Ser Asn

565 570 575

Asp Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asp Asp

580 585 590

Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu

595 600 605

Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala

610 615 620

Glu Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu

625 630 635 640

Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu

645 650 655

Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile

660 665 670

Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val

675 680 685

Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met

690 695 700

Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val

705 710 715 720

Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val

725 730 735

Val Asn Asn Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg

740 745 750

Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Ala

755 760 765

Leu Pro Tyr Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys Tyr

770 775 780

Gln Val Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser

785 790 795 800

Trp Leu Glu Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe Ile

805 810 815

Asp Glu Ala Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys Ala

820 825 830

Lys Ile Phe Glu Lys Phe Pro Gly Leu Lys Glu Cys Lys Asp Pro Thr

835 840 845

Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val

850 855 860

Pro Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu

865 870 875 880

Asn Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr

885 890 895

Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly

900 905 910

Arg Lys Gly Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln

915 920 925

Asn Met Ser Val Trp Leu Trp Asn Lys Ile Glu Tyr Arg Tyr Glu Asn

930 935 940

Asp Lys Asp Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn

945 950 955 960

Cys Tyr Ala Asn Asp Ala Tyr Thr Gly Gly Thr Gln Cys Ser Asp Glu

965 970 975

Leu Lys Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Glu Lys Ser

980 985 990

Val Asn Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met

995 1000 1005

Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu

1010 1015 1020

Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu

1025 1030 1035 1040

Gly Glu Lys Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys

1045 1050 1055

Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln

1060 1065 1070

Lys Glu Val Thr Ile Glu Ser Ser Ala Ser Val Pro Val Thr Val Thr

1075 1080 1085

Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala

1090 1095 1100

Leu Asn Arg Pro Pro Lys Val Thr Lys Thr Tyr Glu Leu Lys Ala Asn

1105 1110 1115 1120

Gly Glu Val Lys Phe Thr Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys

1125 1130 1135

Gly Asn Ser Pro Gln Asn Glu Ser Ala Glu Phe Thr Phe Thr Gly Val

1140 1145 1150

Val Lys Ala Pro Phe Tyr Lys Asp Gly Ala Trp Lys Asn Ala Leu Asn

1155 1160 1165

Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr

1170 1175 1180

Thr Pro Lys Lys Asn Leu Glu Ala Ser Asn Phe Thr Gly Gly Val Ala

1185 1190 1195 1200

Glu Phe Ala Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe

1205 1210 1215

Tyr Gly Arg Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys

1220 1225 1230

Asn Leu Thr Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser

1235 1240 1245

Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser

1250 1255 1260

Thr Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile

1265 1270 1275 1280

Trp His Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro

1285 1290 1295

Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp

1300 1305 1310

Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala

1315 1320 1325

Pro Glu Tyr Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly

1330 1335 1340

Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu

1345 1350 1355 1360

Lys Asn Phe Asp Ile Lys Gln Trp Tyr Pro Glu Gly Asp Leu Pro Lys

1365 1370 1375

Phe Tyr Ser Asp Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu

1380 1385 1390

Met His Arg Lys Ala Arg Gly Asp Glu Val Gly Lys Thr Lys Phe Gly

1395 1400 1405

Glu Arg Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Lys Leu

1410 1415 1420

Met Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe

1425 1430 1435 1440

Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser

1445 1450 1455

Glu Met Asn Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Glu Thr Leu

1460 1465 1470

Ala Ala Leu Asn Leu Pro Lys Pro Gln Gln Gly Pro Glu Thr Ile Asn

1475 1480 1485

Gln Val Thr Glu His Lys Met Ser Ala Glu

1490 1495

<210> SEQ ID NO 60

<211> LENGTH: 1498

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 60

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Ile Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala Thr

100 105 110

Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys

115 120 125

Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Ala Ser Asp Asp

130 135 140

Lys Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro

145 150 155 160

Ala Asp Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser

165 170 175

Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu

180 185 190

Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp

195 200 205

Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro

210 215 220

Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu

225 230 235 240

Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg

245 250 255

Leu Val Asp Ser Met Gly Asn Gly Val Val Gly Val Asn Tyr Tyr Thr

260 265 270

Ser Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Lys Phe Asn Phe Ser

275 280 285

Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser

290 295 300

Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu

305 310 315 320

Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Gln Ala

325 330 335

Gly Lys Asn Asp Glu Arg Glu Val Pro Asp Val Val Arg Lys Val Phe

340 345 350

Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser

355 360 365

Asn Gly Glu Ala Leu Ser Glu Gly Asp Gln Thr Phe Glu Arg Thr Asn

370 375 380

Glu Phe Leu Glu Gln Phe Glu Ser Gly Gln Ala Lys Glu Ile Asp Thr

385 390 395 400

Ala Ile Cys Asp Ser Leu Gly Gly Cys Asn Ser Gln Arg Trp Phe Ser

405 410 415

Leu Thr Ala Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn

420 425 430

Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe His

435 440 445

Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg

450 455 460

Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met

465 470 475 480

Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala

485 490 495

Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu Val

500 505 510

Glu Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe

515 520 525

Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn

530 535 540

Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Glu

545 550 555 560

Gly Gly Val Asp Lys Asn Gly Gln Cys Thr Arg Asn Ser Asp Ser Asn

565 570 575

Asp Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asp Asp

580 585 590

Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu

595 600 605

Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala

610 615 620

Glu Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu

625 630 635 640

Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu

645 650 655

Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile

660 665 670

Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val

675 680 685

Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met

690 695 700

Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val

705 710 715 720

Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val

725 730 735

Val Asn Asn Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg

740 745 750

Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Ala

755 760 765

Leu Pro Tyr Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys Tyr

770 775 780

Gln Val Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser

785 790 795 800

Trp Leu Glu Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe Ile

805 810 815

Asp Glu Ala Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys Ala

820 825 830

Lys Ile Phe Glu Lys Phe Pro Gly Leu Lys Glu Cys Lys Asp Pro Thr

835 840 845

Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val

850 855 860

Pro Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu

865 870 875 880

Asn Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr

885 890 895

Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly

900 905 910

Arg Lys Gly Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln

915 920 925

Asn Met Ser Val Trp Leu Trp Asn Lys Ile Glu Tyr Arg Tyr Glu Asn

930 935 940

Asp Lys Asp Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn

945 950 955 960

Cys Tyr Ala Asn Asp Ala Tyr Thr Gly Gly Thr Gln Cys Ser Asp Glu

965 970 975

Leu Lys Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Glu Lys Ser

980 985 990

Val Asn Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met

995 1000 1005

Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu

1010 1015 1020

Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu

1025 1030 1035 1040

Gly Glu Lys Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys

1045 1050 1055

Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln

1060 1065 1070

Lys Glu Val Thr Ile Glu Ser Thr Ala Ser Val Ala Val Thr Val Thr

1075 1080 1085

Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala

1090 1095 1100

Leu Asn Arg Pro Pro Lys Val Thr Lys Thr Tyr Glu Leu Lys Ala Asn

1105 1110 1115 1120

Gly Glu Val Lys Phe Thr Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys

1125 1130 1135

Gly Asn Ser Pro Gln Asn Glu Ser Ala Glu Phe Thr Phe Thr Gly Val

1140 1145 1150

Val Lys Ala Pro Phe Tyr Lys Asp Gly Ala Trp Lys Asn Ala Leu Asn

1155 1160 1165

Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr

1170 1175 1180

Thr Pro Lys Lys Asn Leu Glu Ala Ser Asn Tyr Lys Gly Gly Gln Glu

1185 1190 1195 1200

Gln Phe Ala Glu Glu Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe

1205 1210 1215

Tyr Gly Arg Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys

1220 1225 1230

Asn Leu Thr Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser

1235 1240 1245

Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser

1250 1255 1260

Thr Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile

1265 1270 1275 1280

Trp His Ala Ala Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro

1285 1290 1295

Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp

1300 1305 1310

Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala

1315 1320 1325

Pro Glu Tyr Leu Glu Glu Ser Asn Asn Gln Ala Trp Ala Arg Gly Gly

1330 1335 1340

Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu

1345 1350 1355 1360

Lys Asn Phe Asp Ile Thr Lys Trp Tyr Pro Glu Gly Asn Leu Pro Lys

1365 1370 1375

Phe Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu

1380 1385 1390

Met His Arg Lys Ala Arg Gly Asp Glu Val Gly Lys Thr Lys Phe Gly

1395 1400 1405

Glu Arg Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu

1410 1415 1420

Met Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Ala Phe Phe

1425 1430 1435 1440

Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser

1445 1450 1455

Glu Met Asn Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Glu Thr Leu

1460 1465 1470

Ala Ala Leu Asn Leu Pro Lys Pro Gln Gln Gly Pro Glu Thr Ile Asn

1475 1480 1485

Lys Val Thr Glu Tyr Ser Met Pro Ala Glu

1490 1495

<210> SEQ ID NO 61

<211> LENGTH: 1497

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 61

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Ile Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Lys Pro

85 90 95

Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp Asp Lys

130 135 140

Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala

145 150 155 160

Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys

165 170 175

Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe

180 185 190

Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu

245 250 255

Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Asn Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu Val Glu

500 505 510

Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Asn Gly

545 550 555 560

Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro Asp Asp

565 570 575

Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asp Asp Lys

580 585 590

Trp Lys Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu Asp

595 600 605

Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala Ala

610 615 620

Phe Asp Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu Ser

625 630 635 640

Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg Ala

740 745 750

Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Ala Leu

755 760 765

Pro Tyr Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys Tyr Gln

770 775 780

Val Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp

785 790 795 800

Leu Glu Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe Ile Asp

805 810 815

Glu Ala Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys Glu Lys

820 825 830

Ile Phe Ala Ala Phe Pro Gly Leu Lys Glu Cys Thr Asn Pro Ala Tyr

835 840 845

His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro

850 855 860

Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn

865 870 875 880

Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn

885 890 895

Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg

900 905 910

Lys Gly Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn

915 920 925

Met Ser Val Trp Leu Trp Asn Asp Thr Ser Tyr Arg Tyr Glu Glu Gly

930 935 940

Lys Asn Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys

945 950 955 960

Tyr Ala Asn Asp Ala Tyr Ala Gly Gly Thr Lys Cys Ser Ala Asp Leu

965 970 975

Lys Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly Ser Ser

980 985 990

Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys

995 1000 1005

Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile

1010 1015 1020

Lys Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Glu Glu Gly Gln

1025 1030 1035 1040

Asn Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe

1045 1050 1055

Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu

1060 1065 1070

Val Thr Ile Lys Ser Asn Ala Asn Val Pro Val Thr Val Thr Val Ala

1075 1080 1085

Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn

1090 1095 1100

Arg Pro Pro Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly Thr

1105 1110 1115 1120

Val Lys Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn

1125 1130 1135

Ser Ser Thr Asn Glu Ser Ala Ser Phe Thr Phe Thr Gly Val Val Lys

1140 1145 1150

Ala Pro Phe Tyr Lys Asp Gly Ala Trp Lys Asn Asp Leu Asn Ser Pro

1155 1160 1165

Ala Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro

1170 1175 1180

Lys Lys Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln Phe

1185 1190 1195 1200

Ala Asn Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe His Gly

1205 1210 1215

Arg Asp Ser Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu

1220 1225 1230

Pro Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly

1235 1240 1245

Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn

1250 1255 1260

Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His

1265 1270 1275 1280

Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala

1285 1290 1295

Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr

1300 1305 1310

Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu

1315 1320 1325

Tyr Leu Glu Glu Ser Asn Asn Gln Ala Trp Ala Arg Gly Gly Ala Gly

1330 1335 1340

Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn

1345 1350 1355 1360

Phe Asp Ile Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro Glu Phe

1365 1370 1375

Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met

1380 1385 1390

His Arg Lys Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe Gly Gly

1395 1400 1405

Lys Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met

1410 1415 1420

Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys

1425 1430 1435 1440

Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu

1445 1450 1455

Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala

1460 1465 1470

Ser Leu Asp Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Gln

1475 1480 1485

Val Thr Glu His Lys Met Ser Ala Glu

1490 1495

<210> SEQ ID NO 62

<211> LENGTH: 1499

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 62

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Leu Arg Val Thr

65 70 75 80

Gly Asp Ile Thr Cys Asn Asp Glu Ser Ser Asp Gly Phe Thr Phe Thr

85 90 95

Pro Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala

100 105 110

Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu

115 120 125

Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp

130 135 140

Asn Lys Lys Ser Asn Ala Leu Ser Leu Val Thr Ser Met Asn Ser Cys

145 150 155 160

Pro Ala Asn Thr Glu Gln Val Cys Leu Glu Phe Ser Ser Val Ile Glu

165 170 175

Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu

180 185 190

Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr

195 200 205

Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr

210 215 220

Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala

225 230 235 240

Glu Gln Phe Tyr Gln Tyr Gln Pro Ser Glu Ile Ile Leu Ser Glu Gly

245 250 255

Arg Leu Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr

260 265 270

Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe

275 280 285

Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly

290 295 300

Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp

305 310 315 320

Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr

325 330 335

Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val

340 345 350

Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu

355 360 365

Ser Asn Gly Ala Thr Leu Asp Glu Gly Glu Gln Val Val Asn Leu Pro

370 375 380

Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp

385 390 395 400

Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe

405 410 415

Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile

420 425 430

Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe

435 440 445

His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala

450 455 460

Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu

465 470 475 480

Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg

485 490 495

Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu

500 505 510

Val Glu Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro

515 520 525

Phe Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly

530 535 540

Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp

545 550 555 560

Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro

565 570 575

Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asp

580 585 590

Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn

595 600 605

Leu Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser

610 615 620

Ala Ala Phe Asp Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His

625 630 635 640

Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile

645 650 655

Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala

660 665 670

Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp

675 680 685

Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile

690 695 700

Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe

705 710 715 720

Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser

725 730 735

Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln

740 745 750

Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly

755 760 765

Ala Leu Pro Tyr Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys

770 775 780

Tyr Gln Val Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala

785 790 795 800

Ser Trp Leu Glu Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe

805 810 815

Ile Asp Glu Ala Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys

820 825 830

Glu Lys Ile Phe Ala Ala Phe Pro Gly Leu Lys Glu Cys Thr Asn Pro

835 840 845

Ala Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly

850 855 860

Val Pro Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser

865 870 875 880

Leu Asn Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly

885 890 895

Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn

900 905 910

Gly Arg Lys Gly Glu Arg Leu Ser Cys Val Asp Leu Glu Arg Leu Tyr

915 920 925

Gln Asn Met Ser Val Trp Leu Trp Asn Asp Thr Ser Tyr Arg Tyr Glu

930 935 940

Glu Gly Lys Asn Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu

945 950 955 960

Asn Cys Tyr Ala Asn Asp Ala Tyr Ala Gly Gly Thr Lys Cys Ser Ala

965 970 975

Asp Leu Lys Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly

980 985 990

Ser Ser Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met

995 1000 1005

Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu

1010 1015 1020

Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Glu Glu

1025 1030 1035 1040

Gly Gln Asn Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys

1045 1050 1055

Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln

1060 1065 1070

Lys Glu Val Thr Ile Lys Ser Asn Ala Asn Val Pro Val Thr Val Thr

1075 1080 1085

Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala

1090 1095 1100

Leu Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser

1105 1110 1115 1120

Gly Thr Val Lys Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys

1125 1130 1135

Gly Asn Ser Ser Thr Asn Glu Ser Ala Ser Phe Thr Phe Thr Gly Val

1140 1145 1150

Val Lys Ala Pro Phe Tyr Lys Asp Gly Ala Trp Lys Asn Asp Leu Asn

1155 1160 1165

Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr

1170 1175 1180

Thr Pro Lys Lys Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu

1185 1190 1195 1200

Gln Phe Ala Asn Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe

1205 1210 1215

Tyr Gly Arg Asp Ser Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys

1220 1225 1230

Asn Leu Pro Gly His Lys His Arg Phe Ala Asn Asp Val Gln Ile Ser

1235 1240 1245

Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser

1250 1255 1260

Pro Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile

1265 1270 1275 1280

Trp His Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro

1285 1290 1295

Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp

1300 1305 1310

Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala

1315 1320 1325

Pro Glu Tyr Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly

1330 1335 1340

Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu

1345 1350 1355 1360

Lys Asn Phe Asp Ile Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro

1365 1370 1375

Glu Phe Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln

1380 1385 1390

Leu Met His Arg Lys Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe

1395 1400 1405

Gly Gly Lys Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr

1410 1415 1420

Leu Met Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe

1425 1430 1435 1440

Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala

1445 1450 1455

Ser Glu Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr

1460 1465 1470

Leu Ala Ser Leu Lys Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile

1475 1480 1485

Asn Lys Val Thr Glu His Lys Met Ser Val Glu

1490 1495

<210> SEQ ID NO 63

<211> LENGTH: 1497

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 63

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Leu Arg Val Thr

65 70 75 80

Gly Asp Ile Thr Cys Asn Asp Glu Ser Ser Asp Gly Phe Thr Phe Thr

85 90 95

Pro Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala

100 105 110

Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu

115 120 125

Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp

130 135 140

Asn Lys Lys Ser Asn Ala Leu Ser Leu Val Thr Ser Met Asn Ser Cys

145 150 155 160

Pro Ala Asn Thr Glu Gln Val Cys Leu Glu Phe Ser Ser Val Ile Glu

165 170 175

Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu

180 185 190

Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr

195 200 205

Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr

210 215 220

Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala

225 230 235 240

Glu Gln Phe Tyr Gln Tyr Gln Pro Ser Glu Ile Ile Leu Ser Glu Gly

245 250 255

Arg Leu Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr

260 265 270

Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe

275 280 285

Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly

290 295 300

Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp

305 310 315 320

Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr

325 330 335

Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val

340 345 350

Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu

355 360 365

Ser Asn Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro

370 375 380

Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp

385 390 395 400

Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe

405 410 415

Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile

420 425 430

Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe

435 440 445

His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala

450 455 460

Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu

465 470 475 480

Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg

485 490 495

Ala Trp Asp Lys Asn Asp Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile

500 505 510

Val Arg Pro Glu Asn Val Thr Arg Glu Thr Ala Thr Phe Asn Leu Pro

515 520 525

Phe Ile Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly

530 535 540

Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp

545 550 555 560

Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro

565 570 575

Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asn

580 585 590

Asp Arg Trp Leu Pro Asp Ala Lys Ser Ser Met Thr Val Gly Thr Asn

595 600 605

Leu Asp Thr Val Tyr Phe Lys Lys His Gly Gln Val Leu Gly Asn Ser

610 615 620

Ala Pro Phe Ala Phe His Lys Asp Phe Thr Gly Ile Thr Val Lys Pro

625 630 635 640

Met Thr Ser Tyr Gly Asn Leu Asn Pro Asp Glu Val Pro Leu Leu Ile

645 650 655

Leu Asn Gly Phe Glu Tyr Val Thr Gln Trp Gly Ser Asp Pro Tyr Ser

660 665 670

Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp

675 680 685

Val Thr Asp Leu Ile Ala Tyr Met Asn Lys Gly Gly Ser Val Leu Ile

690 695 700

Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe

705 710 715 720

Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser

725 730 735

Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg

740 745 750

Arg Ser Thr Pro Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly

755 760 765

Lys Pro Pro Tyr Thr Ile Asp Asp Thr Thr Lys Glu Val Ile Trp Lys

770 775 780

Tyr Gln Gln Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala

785 790 795 800

Ser Trp Gln Glu Glu Val Glu Gly Lys Gln Val Thr Gln Phe Ala Phe

805 810 815

Ile Asp Glu Ala Asp His Lys Thr Pro Glu Ser Leu Ala Ala Ala Lys

820 825 830

Gln Arg Ile Leu Asp Ala Phe Pro Gly Leu Glu Val Cys Lys Asp Ser

835 840 845

Asp Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Ser Gly

850 855 860

Val Pro Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Asp

865 870 875 880

Leu Gly Ala Asp Thr Ala Lys Ala Met Leu Gln Ala Ala Asp Leu Gly

885 890 895

Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn

900 905 910

Gly Arg Gln Gly Glu Arg Leu Asn Ser Val Asp Leu Glu Arg Leu Tyr

915 920 925

Gln Asn Met Ser Val Trp Leu Trp Asn Glu Thr Lys Tyr Arg Tyr Glu

930 935 940

Glu Gly Lys Glu Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu

945 950 955 960

Asn Cys Tyr Thr Asn Asn Ala Tyr Val Gly Thr Gln Cys Ser Ala Glu

965 970 975

Leu Lys Lys Ser Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Glu Ser

980 985 990

Ser Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu

995 1000 1005

Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn

1010 1015 1020

Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Glu Glu Gly

1025 1030 1035 1040

Gln Asn Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp

1045 1050 1055

Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys

1060 1065 1070

Glu Val Thr Ile Lys Ser Asn Ala Asn Val Pro Val Thr Val Thr Val

1075 1080 1085

Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu

1090 1095 1100

Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly

1105 1110 1115 1120

Thr Val Lys Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly

1125 1130 1135

Asn Ser Ser Thr Asn Glu Ser Ala Ser Phe Thr Phe Thr Gly Val Val

1140 1145 1150

Lys Ala Pro Phe Tyr Lys Asp Gly Ala Trp Lys Asn Asp Leu Asn Ser

1155 1160 1165

Pro Ala Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr

1170 1175 1180

Pro Lys Lys Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln

1185 1190 1195 1200

Phe Ala Asn Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr

1205 1210 1215

Gly Arg Asp Ser Glu Ser Gly Lys His Arg Met Phe Thr Tyr Lys Asn

1220 1225 1230

Leu Thr Gly His Lys His Arg Phe Ala Asn Asp Val Gln Ile Ser Ile

1235 1240 1245

Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro

1250 1255 1260

Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp

1265 1270 1275 1280

His Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly

1285 1290 1295

Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg

1300 1305 1310

Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro

1315 1320 1325

Glu Tyr Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala

1330 1335 1340

Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys

1345 1350 1355 1360

Asn Phe Asp Ile Lys Lys Trp Tyr Pro Glu Gly Glu Leu Pro Lys Phe

1365 1370 1375

Phe Ser Asp Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met

1380 1385 1390

His Arg Lys Ala Arg Gly Asp Asp Val Gly Asn Lys Thr Phe Gly Gly

1395 1400 1405

Lys Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Ser Leu Met

1410 1415 1420

Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Ala Phe Phe Lys

1425 1430 1435 1440

Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Thr Glu

1445 1450 1455

Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Ser Thr Leu Ala

1460 1465 1470

Ser Leu Lys Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Lys

1475 1480 1485

Val Thr Glu His Lys Met Ser Leu Glu

1490 1495

<210> SEQ ID NO 64

<211> LENGTH: 1498

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 64

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Leu Arg Val Thr

65 70 75 80

Gly Asp Ile Thr Cys Asn Asp Glu Ser Ser Asp Gly Phe Thr Phe Thr

85 90 95

Pro Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala

100 105 110

Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu

115 120 125

Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp

130 135 140

Asn Lys Lys Ser Asn Ala Leu Ser Leu Val Thr Ser Met Asn Ser Cys

145 150 155 160

Pro Ala Asn Thr Glu Gln Val Cys Leu Glu Phe Ser Ser Val Ile Glu

165 170 175

Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu

180 185 190

Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr

195 200 205

Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr

210 215 220

Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala

225 230 235 240

Glu Gln Phe Tyr Gln Tyr Gln Pro Ser Glu Ile Ile Leu Ser Glu Gly

245 250 255

Arg Leu Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr

260 265 270

Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe

275 280 285

Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly

290 295 300

Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp

305 310 315 320

Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr

325 330 335

Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val

340 345 350

Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu

355 360 365

Ser Asn Gly Ala Thr Leu Asp Glu Gly Glu Gln Val Val Asn Leu Pro

370 375 380

Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp

385 390 395 400

Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe

405 410 415

Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile

420 425 430

Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe

435 440 445

His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala

450 455 460

Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu

465 470 475 480

Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg

485 490 495

Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu

500 505 510

Val Glu Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro

515 520 525

Phe Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly

530 535 540

Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp

545 550 555 560

Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro

565 570 575

Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asp

580 585 590

Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn

595 600 605

Leu Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser

610 615 620

Ala Ala Phe Asp Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His

625 630 635 640

Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile

645 650 655

Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala

660 665 670

Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp

675 680 685

Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile

690 695 700

Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe

705 710 715 720

Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser

725 730 735

Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln

740 745 750

Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly

755 760 765

Ala Leu Pro Tyr Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys

770 775 780

Tyr Gln Val Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala

785 790 795 800

Ser Trp Leu Glu Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe

805 810 815

Ile Asp Glu Ala Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys

820 825 830

Glu Lys Ile Phe Ala Ala Phe Pro Gly Leu Lys Glu Cys Thr Asn Pro

835 840 845

Ala Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly

850 855 860

Val Pro Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser

865 870 875 880

Leu Asn Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly

885 890 895

Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn

900 905 910

Gly Arg Lys Gly Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr

915 920 925

Gln Asn Met Ser Val Trp Leu Trp Asn Asp Thr Ser Tyr Arg Tyr Glu

930 935 940

Glu Gly Lys Asn Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu

945 950 955 960

Asn Cys Tyr Ala Asn Asp Ala Tyr Ala Gly Gly Thr Lys Cys Ser Ala

965 970 975

Asp Leu Lys Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly

980 985 990

Ser Ser Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met

995 1000 1005

Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu

1010 1015 1020

Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Glu Glu

1025 1030 1035 1040

Gly Gln Asn Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys

1045 1050 1055

Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln

1060 1065 1070

Lys Glu Val Thr Ile Lys Ser Asn Ala Asn Val Pro Val Thr Val Thr

1075 1080 1085

Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala

1090 1095 1100

Leu Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser

1105 1110 1115 1120

Gly Thr Val Lys Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys

1125 1130 1135

Gly Asn Ser Ser Thr Asn Glu Ser Ala Ser Phe Thr Phe Thr Gly Val

1140 1145 1150

Val Lys Ala Pro Phe Tyr Lys Asp Gly Ala Trp Lys Asn Asp Leu Asn

1155 1160 1165

Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr

1170 1175 1180

Thr Pro Lys Lys Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu

1185 1190 1195 1200

Gln Phe Ala Asn Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe

1205 1210 1215

Tyr Gly Arg Asp Glu Thr Ser Gly Lys His Arg Met Phe Thr Tyr Lys

1220 1225 1230

Asn Leu Thr Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser

1235 1240 1245

Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser

1250 1255 1260

Thr Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile

1265 1270 1275 1280

Trp His Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro

1285 1290 1295

Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp

1300 1305 1310

Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala

1315 1320 1325

Pro Glu Tyr Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly

1330 1335 1340

Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu

1345 1350 1355 1360

Lys Asn Phe Asp Ile Lys Lys Trp Tyr Pro Glu Gly Glu Leu Pro Lys

1365 1370 1375

Phe Phe Ser Asp Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu

1380 1385 1390

Met His Arg Lys Ala Arg Gly Asp Asp Val Gly Asp Lys Thr Phe Gly

1395 1400 1405

Gly Lys Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu

1410 1415 1420

Met Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Ala Phe Phe

1425 1430 1435 1440

Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Thr

1445 1450 1455

Glu Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Ser Thr Leu

1460 1465 1470

Ala Ser Leu Lys Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn

1475 1480 1485

Lys Val Thr Glu His Lys Met Ser Leu Glu

1490 1495

<210> SEQ ID NO 65

<211> LENGTH: 1498

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 65

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Leu Arg Val Thr

65 70 75 80

Gly Asp Ile Thr Cys Asn Asp Glu Ser Ser Asp Gly Phe Thr Phe Thr

85 90 95

Pro Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala

100 105 110

Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu

115 120 125

Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp

130 135 140

Asn Lys Lys Ser Asn Ala Leu Ser Leu Val Thr Ser Met Asn Ser Cys

145 150 155 160

Pro Ala Asn Thr Glu Gln Val Cys Leu Glu Phe Ser Ser Val Ile Glu

165 170 175

Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu

180 185 190

Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr

195 200 205

Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Ala Thr Thr

210 215 220

Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala

225 230 235 240

Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly

245 250 255

Arg Leu Val Asp Ser Gln Gly Asp Gly Val Val Gly Val Asn Tyr Tyr

260 265 270

Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe

275 280 285

Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly

290 295 300

Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp

305 310 315 320

Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Lys

325 330 335

Ala Gly Gln Asn His Thr Arg Val Val Pro Asp Glu Val Arg Lys Val

340 345 350

Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu

355 360 365

Ser Asn Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro

370 375 380

Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp

385 390 395 400

Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe

405 410 415

Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Lys Ile Gln Gly Val Ile

420 425 430

Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe

435 440 445

His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala

450 455 460

Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu

465 470 475 480

Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg

485 490 495

Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile

500 505 510

Val Arg Pro Glu Asn Val Thr Arg Glu Thr Ala Thr Phe Asn Leu Pro

515 520 525

Phe Ile Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly

530 535 540

Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp

545 550 555 560

Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro

565 570 575

Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asp

580 585 590

Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn

595 600 605

Leu Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser

610 615 620

Ala Ala Phe Asp Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His

625 630 635 640

Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile

645 650 655

Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala

660 665 670

Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp

675 680 685

Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile

690 695 700

Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe

705 710 715 720

Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser

725 730 735

Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Arg

740 745 750

Arg Ser Thr Pro Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly

755 760 765

Lys Pro Pro Tyr Thr Ile Asp Asp Thr Thr Lys Glu Val Ile Trp Lys

770 775 780

Tyr Gln Gln Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala

785 790 795 800

Ser Trp Gln Glu Glu Val Glu Gly Lys Gln Val Thr Gln Phe Ala Phe

805 810 815

Ile Asp Glu Ala Asp His Lys Thr Pro Glu Ser Leu Ala Ala Ala Lys

820 825 830

Gln Arg Ile Leu Asp Ala Phe Pro Gly Leu Glu Val Cys Lys Asp Ser

835 840 845

Asp Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Asp

850 855 860

Val Pro Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Asp

865 870 875 880

Leu Ser Ala Asp Thr Ala Lys Ala Met Leu Gln Ala Ala Asp Leu Gly

885 890 895

Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn

900 905 910

Gly Arg Gln Gly Glu Arg Leu Asn Ser Val Asp Leu Glu Arg Leu Tyr

915 920 925

Gln Asn Met Ser Val Trp Leu Trp Asn Glu Thr Lys Tyr Arg Tyr Glu

930 935 940

Glu Gly Lys Glu Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu

945 950 955 960

Asn Cys Tyr Thr Asn Asn Ala Tyr Val Gly Thr Gln Cys Ser Ala Glu

965 970 975

Leu Lys Lys Ser Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Glu Ser

980 985 990

Ser Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu

995 1000 1005

Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn

1010 1015 1020

Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Val Val Asn Thr Asn Gly

1025 1030 1035 1040

Glu Thr Val Thr Gln Asn Ile Asn Leu Tyr Ser Ala Pro Thr Lys Trp

1045 1050 1055

Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln

1060 1065 1070

Glu Val Ser Ile Glu Ser Lys Ala Thr Val Pro Val Thr Val Thr Val

1075 1080 1085

Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ser Leu

1090 1095 1100

Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr Asp Leu Lys Ala Asn Asp

1105 1110 1115 1120

Lys Val Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly

1125 1130 1135

Asp Ser Lys Glu Val Gln Ser Ala Asp Phe Thr Phe Thr Gly Val Val

1140 1145 1150

Lys Ala Pro Phe Tyr Lys Asp Gly Lys Trp Gln His Asp Leu Asn Ser

1155 1160 1165

Pro Ala Pro Leu Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr

1170 1175 1180

Pro Lys Lys Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln

1185 1190 1195 1200

Phe Ala Asn Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr

1205 1210 1215

Gly Arg Asp Ser Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn

1220 1225 1230

Leu Pro Gly His Lys His Arg Phe Ala Asn Asp Val Gln Ile Ser Ile

1235 1240 1245

Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro

1250 1255 1260

Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp

1265 1270 1275 1280

His Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly

1285 1290 1295

Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg

1300 1305 1310

Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro

1315 1320 1325

Glu Tyr Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala

1330 1335 1340

Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys

1345 1350 1355 1360

Asn Phe Asp Ile Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro Glu

1365 1370 1375

Phe Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu

1380 1385 1390

Met His Arg Lys Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe Gly

1395 1400 1405

Gly Lys Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu

1410 1415 1420

Met Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe

1425 1430 1435 1440

Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser

1445 1450 1455

Glu Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu

1460 1465 1470

Ala Ser Leu Lys Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn

1475 1480 1485

Lys Val Thr Glu His Lys Met Ser Val Glu

1490 1495

<210> SEQ ID NO 66

<211> LENGTH: 1497

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 66

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Ser Val Asp

1 5 10 15

Ser Gly Ser Gly Thr Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Thr

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Asp

35 40 45

Pro Thr Pro Asp Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu

50 55 60

Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg

65 70 75 80

Val Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe

85 90 95

Thr Pro Gly Asn Thr Val Ser Cys Val Val Gly Ser Thr Thr Ile Ala

100 105 110

Thr Phe Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Asp

115 120 125

Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Asn Ser Glu

130 135 140

Asn Lys Lys Thr Asn Ala Ile Ser Leu Val Thr Ser Ser Asp Ser Cys

145 150 155 160

Pro Ala Asp Ala Glu Gln Leu Cys Leu Thr Phe Ser Ser Val Val Asp

165 170 175

Arg Ala Arg Phe Glu Lys Leu Tyr Lys Gln Ile Asp Leu Ala Thr Asp

180 185 190

Asn Phe Ser Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr

195 200 205

Asp Lys Ala Pro Ser Thr His Thr Ser Thr Val Val Pro Val Thr Thr

210 215 220

Glu Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala

225 230 235 240

Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly

245 250 255

Gln Leu Val Asp Ser Leu Gly Asn Gly Val Ala Gly Val Asp Tyr Tyr

260 265 270

Thr Asn Ser Gly Arg Gly Val Thr Asp Glu Asn Gly Lys Phe Ser Phe

275 280 285

Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly

290 295 300

Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp

305 310 315 320

Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr

325 330 335

Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val

340 345 350

Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu

355 360 365

Ser Asn Gly Ala Thr Leu Asp Glu Gly Asp Gln Asn Val Val Leu Pro

370 375 380

Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp

385 390 395 400

Thr Ala Ile Cys Ala Lys Thr Asn Gly Cys Asn Glu Ala Arg Trp Phe

405 410 415

Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile

420 425 430

Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Gln Ser Val Ser Lys Phe

435 440 445

His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala

450 455 460

Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu

465 470 475 480

Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg

485 490 495

Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile

500 505 510

Val Gln Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro

515 520 525

Phe Ile Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly

530 535 540

Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp

545 550 555 560

Gly Gly Gly Val Asn Ser Lys Gly Glu Cys Thr Leu Ser Gly Asp Ser

565 570 575

Asp Asp Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asn

580 585 590

Asp Ile Trp Gln Pro Asn Thr Lys Ser Ile Met Thr Val Gly Thr Asn

595 600 605

Leu Glu Asn Val Tyr Phe Lys Lys Ala Gly Gln Val Leu Gly Asn Ser

610 615 620

Ala Pro Phe Ala Phe His Glu Asp Phe Thr Gly Ile Thr Val Lys Gln

625 630 635 640

Leu Thr Ser Tyr Gly Asp Leu Asn Pro Glu Glu Ile Pro Leu Leu Ile

645 650 655

Leu Asn Gly Phe Glu Tyr Val Thr Gln Trp Ser Gly Asp Pro Tyr Ala

660 665 670

Val Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp

675 680 685

Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile

690 695 700

Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Ser Phe

705 710 715 720

Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser

725 730 735

Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Gln

740 745 750

Arg Glu Lys Gly Ile Trp Val Tyr Glu Arg Tyr Pro Phe Val Asp Gly

755 760 765

Lys Pro Pro Tyr Thr Ile Asp Glu Thr Thr Lys Glu Val Ile Trp Lys

770 775 780

Tyr Gln Gln Asp Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala

785 790 795 800

Ser Trp Leu Glu Asp Val Asp Gly Lys Gln Val Lys Arg Tyr Ala Phe

805 810 815

Ile Asp Glu Ala Glu His Glu Thr Asn Glu Ser Leu Glu Ala Ala Lys

820 825 830

Ala Lys Ile Ile Lys Ala Phe Pro Gly Leu Glu Glu Cys Lys Asp Pro

835 840 845

Thr Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Asn

850 855 860

Val Pro Val Thr Gly Gly Met Tyr Val Pro Arg Tyr Thr Gln Leu Asn

865 870 875 880

Leu Ser Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly

885 890 895

Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn

900 905 910

Gly Arg Lys Gly Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr

915 920 925

Gln Asn Met Ser Val Trp Leu Trp Asn Glu Ile Glu Tyr Ser Tyr Asp

930 935 940

Ser Ser Lys Glu Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu

945 950 955 960

Asn Cys Tyr Ala Asn Asp Ala Tyr Thr Lys Gly Thr Leu Cys Ser Ala

965 970 975

Glu Leu Lys Gln Ser Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Gly

980 985 990

Ser Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu

995 1000 1005

Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn

1010 1015 1020

Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Val Gly Gly

1025 1030 1035 1040

Glu Glu Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp

1045 1050 1055

Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys

1060 1065 1070

Glu Val Thr Ile Lys Ser Asn Ala Asn Val Pro Val Thr Val Thr Val

1075 1080 1085

Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu

1090 1095 1100

Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly

1105 1110 1115 1120

Thr Val Lys Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly

1125 1130 1135

Asn Ser Ser Thr Asn Glu Ser Ala Ser Phe Thr Phe Thr Gly Val Val

1140 1145 1150

Lys Ala Pro Phe Tyr Lys Asp Gly Ala Trp Lys Asn Asp Leu Asn Ser

1155 1160 1165

Pro Ala Pro Leu Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr

1170 1175 1180

Pro Lys Lys Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Asp Gln

1185 1190 1195 1200

Phe Ala Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr

1205 1210 1215

Gly Arg Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn

1220 1225 1230

Leu Thr Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile

1235 1240 1245

Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr

1250 1255 1260

Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp

1265 1270 1275 1280

His Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Asn Val Pro Gly

1285 1290 1295

Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg

1300 1305 1310

Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro

1315 1320 1325

Glu Tyr Leu Asp Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala

1330 1335 1340

Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys

1345 1350 1355 1360

Asn Phe Asp Ile Thr Lys Trp Tyr Pro Asp Gly Lys Leu Pro Ala Phe

1365 1370 1375

Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met

1380 1385 1390

His Arg Lys Ala Arg Gly Asp Asp Val Gly Asn Ser Thr Phe Gly Gly

1395 1400 1405

Lys Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met

1410 1415 1420

Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys

1425 1430 1435 1440

Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ala Glu

1445 1450 1455

Met Ser Phe Glu Gly Gly Val Ser Ser Ser Ala Tyr Ser Thr Leu Ala

1460 1465 1470

Ser Leu Asn Leu Pro Lys Pro Glu Lys Gly Pro Glu Thr Ile Asn Lys

1475 1480 1485

Val Thr Glu His Lys Met Ser Ala Glu

1490 1495

<210> SEQ ID NO 67

<211> LENGTH: 1496

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 67

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Ile Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Lys Pro

85 90 95

Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp Asp Lys

130 135 140

Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala

145 150 155 160

Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys

165 170 175

Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe

180 185 190

Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu

245 250 255

Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser Trp

275 280 285

Gly Glu Ala Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Asn Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val Arg

500 505 510

Pro Glu Asn Val Thr Arg Glu Thr Ala Ser Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Asn Gly

545 550 555 560

Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro Asp Asp

565 570 575

Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asn Asp Arg

580 585 590

Trp Leu Pro Asp Ala Lys Ser Ser Met Thr Val Gly Thr Asn Leu Glu

595 600 605

Thr Val Tyr Phe Lys Lys His Gly Gln Val Leu Gly Asn Ser Ala Pro

610 615 620

Phe Ala Phe His Lys Asp Phe Thr Gly Ile Thr Val Lys Pro Met Thr

625 630 635 640

Ser Tyr Gly Asn Leu Asn Pro Asp Glu Val Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Trp Gly Ser Asp Pro Tyr Ser Ile Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Met Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ser

740 745 750

Thr Pro Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Lys Pro

755 760 765

Pro Tyr Thr Ile Asp Asp Thr Thr Lys Glu Val Ile Trp Lys Tyr Gln

770 775 780

Gln Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp

785 790 795 800

Gln Glu Glu Val Glu Gly Lys Gln Val Thr Gln Phe Ala Phe Ile Asp

805 810 815

Glu Ala Asp His Lys Thr Pro Glu Ser Leu Ala Ala Ala Lys Gln Arg

820 825 830

Ile Leu Asp Ala Phe Pro Gly Leu Glu Val Cys Lys Asp Ser Asp Tyr

835 840 845

His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Asp Val Pro

850 855 860

Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Asp Leu Ser

865 870 875 880

Ala Asp Thr Ala Lys Ala Met Leu Gln Ala Ala Asp Leu Gly Thr Asn

885 890 895

Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg

900 905 910

Gln Gly Glu Arg Leu Asn Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn

915 920 925

Met Ser Val Trp Leu Trp Asn Glu Thr Lys Tyr Arg Tyr Glu Glu Gly

930 935 940

Lys Glu Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys

945 950 955 960

Tyr Thr Asn Asn Ala Tyr Val Gly Thr Gln Cys Ser Ala Glu Leu Lys

965 970 975

Lys Ser Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Glu Ser Ser Lys

980 985 990

Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro

995 1000 1005

Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys

1010 1015 1020

Val Asp Val Glu Lys Tyr Pro Gly Val Val Asn Thr Asn Gly Glu Thr

1025 1030 1035 1040

Val Thr Gln Asn Ile Asn Leu Tyr Ser Ala Pro Thr Lys Trp Phe Ala

1045 1050 1055

Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln Glu Val

1060 1065 1070

Ser Ile Glu Ser Lys Ser Thr Val Pro Val Thr Val Thr Val Ala Leu

1075 1080 1085

Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ser Leu Asn Arg

1090 1095 1100

Pro Pro Arg Val Thr Lys Thr Tyr Asp Leu Lys Ala Asn Asp Lys Val

1105 1110 1115 1120

Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asp Ser

1125 1130 1135

Lys Glu Val Gln Ser Ala Asp Phe Thr Phe Thr Gly Val Val Lys Ala

1140 1145 1150

Pro Phe Tyr Lys Asp Gly Lys Trp Gln His Asp Leu Asn Ser Pro Ala

1155 1160 1165

Pro Leu Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr Pro Lys

1170 1175 1180

Lys Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln Phe Ala

1185 1190 1195 1200

Asn Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg

1205 1210 1215

Asp Ser Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Pro

1220 1225 1230

Gly His Lys His Arg Phe Ala Asn Asp Val Gln Ile Ser Ile Gly Asp

1235 1240 1245

Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn Ser

1250 1255 1260

Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Ala

1265 1270 1275 1280

Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr

1285 1290 1295

Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu

1300 1305 1310

Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr

1315 1320 1325

Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp

1330 1335 1340

Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe

1345 1350 1355 1360

Asp Ile Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro Glu Phe Tyr

1365 1370 1375

Ser Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His

1380 1385 1390

Arg Lys Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe Gly Gly Lys

1395 1400 1405

Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu

1410 1415 1420

Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys

1425 1430 1435 1440

Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met

1445 1450 1455

Ser Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser

1460 1465 1470

Leu Asp Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Gln Val

1475 1480 1485

Thr Glu His Lys Met Ser Ala Glu

1490 1495

<210> SEQ ID NO 68

<211> LENGTH: 1500

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 68

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Ile Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala Thr

100 105 110

Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys

115 120 125

Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Ala Ser Asp Asp

130 135 140

Lys Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro

145 150 155 160

Ala Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser

165 170 175

Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu

180 185 190

Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp

195 200 205

Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro

210 215 220

Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu

225 230 235 240

Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg

245 250 255

Leu Val Asp Ser Met Gly Asn Gly Val Val Gly Val Asn Tyr Tyr Thr

260 265 270

Ser Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Lys Phe Asn Phe Ser

275 280 285

Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser

290 295 300

Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu

305 310 315 320

Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Gln Ala

325 330 335

Gly Lys Asn Asp Glu Arg Glu Val Pro Asp Val Val Arg Lys Val Phe

340 345 350

Ala Ala Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser

355 360 365

Asn Gly Glu Ala Leu Ser Glu Gly Asp Gln Thr Phe Glu Arg Thr Asn

370 375 380

Glu Phe Leu Glu Gln Phe Glu Ser Gly Gln Ala Lys Glu Ile Asp Thr

385 390 395 400

Ala Ile Cys Asp Ser Leu Gly Gly Cys Asn Ser Gln Arg Trp Phe Ser

405 410 415

Leu Thr Ala Arg Asn Val Asn Glu Gly Gln Ile Gln Gly Val Ile Asn

420 425 430

Lys Leu Trp Gly Val Asp Lys Asp Tyr Lys Ser Val Thr Lys Phe His

435 440 445

Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg

450 455 460

Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met

465 470 475 480

Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala

485 490 495

Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu Val

500 505 510

Glu Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe

515 520 525

Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn

530 535 540

Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Glu

545 550 555 560

Gly Gly Val Asp Lys Asn Gly Gln Cys Thr Arg Asn Ser Asp Ser Asn

565 570 575

Asp Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asn Asp

580 585 590

Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu

595 600 605

Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala

610 615 620

Glu Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu

625 630 635 640

Ser Ser Tyr Gly Asp Leu Asp Pro Gln Lys Met Pro Leu Leu Ile Leu

645 650 655

Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Gly Asp Pro Tyr Ala Val

660 665 670

Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Ser Gln Gln Asp Val

675 680 685

Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met

690 695 700

Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val

705 710 715 720

Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val

725 730 735

Val Asn Asn Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg

740 745 750

Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro Val Val Glu Gly Glu

755 760 765

Leu Pro Tyr Thr Ile Asp Ser Lys Thr Gly Lys Val Thr Trp Lys Tyr

770 775 780

Gln Ile Asp Asn Lys Pro Asp Lys Lys Pro Lys Leu Glu Val Ala Ser

785 790 795 800

Trp Gln Glu Glu Val Asp Gly Lys Gln Val Thr Gln Phe Ala Phe Ile

805 810 815

Asp Glu Ala Asp His Lys Thr Thr Glu Ser Leu Asp Ala Ala Lys Lys

820 825 830

Lys Ile Leu Glu Lys Phe Lys Gly Leu Glu Glu Cys Lys Asp Ser Thr

835 840 845

Tyr His Tyr Glu Ile Asn Cys Leu Glu Tyr Arg Pro Gly Thr Asn Val

850 855 860

Pro Ala Thr Gly Gly Met Tyr Val Pro Arg Tyr Thr Gln Leu Asn Leu

865 870 875 880

Ser Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr

885 890 895

Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly

900 905 910

Arg Lys Gly Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln

915 920 925

Asn Met Ser Val Trp Leu Trp Asn Glu Ile Glu Tyr Ser Tyr Asp Ser

930 935 940

Ser Lys Glu Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn

945 950 955 960

Cys Tyr Ala Asn Asp Ala Tyr Thr Gly Gly Thr Gln Cys Ser Asp Glu

965 970 975

Leu Lys Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Glu Lys Ser

980 985 990

Val Asn Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met

995 1000 1005

Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu

1010 1015 1020

Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Glu Glu

1025 1030 1035 1040

Gly Gln Glu Val Thr Glu Ser Ile Ser Leu Tyr Ser Asn Pro Thr Lys

1045 1050 1055

Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln

1060 1065 1070

Lys Glu Val Thr Ile Lys Ser Asn Ala Asp Val Pro Val Thr Val Thr

1075 1080 1085

Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala

1090 1095 1100

Leu Asn Arg Pro Pro Lys Val Thr Lys Thr Tyr Glu Leu Lys Ala Asn

1105 1110 1115 1120

Gly Glu Val Lys Phe Thr Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys

1125 1130 1135

Gly Asn Ser Lys Glu Asn Asn Lys Ser Ala Ser Phe Thr Phe Thr Gly

1140 1145 1150

Val Val Lys Ala Pro Phe Tyr Lys Asn Gly Ala Trp Lys Asn Ala Leu

1155 1160 1165

Asn Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr

1170 1175 1180

Thr Thr Pro Lys Lys Asn Leu Glu Ala Ser Asn Phe Thr Gly Gly Val

1185 1190 1195 1200

Ala Glu Phe Ala Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp

1205 1210 1215

Phe Tyr Gly Arg Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr

1220 1225 1230

Lys Asn Leu Thr Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile

1235 1240 1245

Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe

1250 1255 1260

Ser Thr Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu

1265 1270 1275 1280

Ile Trp His Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val

1285 1290 1295

Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln

1300 1305 1310

Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val

1315 1320 1325

Ala Pro Glu Tyr Leu Glu Glu Ser Asn Asn Gln Ala Trp Ala Arg Gly

1330 1335 1340

Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala

1345 1350 1355 1360

Glu Lys Asn Phe Asp Ile Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu

1365 1370 1375

Pro Glu Phe Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe

1380 1385 1390

Gln Leu Met His Arg Lys Ala Arg Gly Asp Glu Val Ser Asn Asp Lys

1395 1400 1405

Phe Gly Gly Arg Asn Tyr Cys Ala Glu Ser Asn Gly Asn Thr Ala Asp

1410 1415 1420

Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu

1425 1430 1435 1440

Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly

1445 1450 1455

Ala Thr Glu Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn

1460 1465 1470

Thr Leu Ala Ser Leu Asp Leu Pro Lys Pro Lys Gln Gly Pro Glu Thr

1475 1480 1485

Ile Asn Lys Val Thr Glu Tyr Ser Met Pro Ala Glu

1490 1495 1500

<210> SEQ ID NO 69

<211> LENGTH: 1495

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 69

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Ile Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Lys Pro

85 90 95

Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp Asp Lys

130 135 140

Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala

145 150 155 160

Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys

165 170 175

Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe

180 185 190

Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu

245 250 255

Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Asn Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val Arg

500 505 510

Pro Glu Asn Val Thr Arg Glu Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Asn Gly

545 550 555 560

Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro Asp Asp

565 570 575

Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asn Asp Arg

580 585 590

Trp Leu Pro Asp Ala Lys Ser Asn Met Thr Val Gly Thr Asn Leu Asp

595 600 605

Thr Val Tyr Phe Lys Lys His Gly Gln Val Thr Gly Asn Ser Ala Ala

610 615 620

Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu Ser

625 630 635 640

Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Met Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ser

740 745 750

Thr Pro Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Lys Pro

755 760 765

Pro Tyr Thr Ile Asp Asp Thr Thr Lys Glu Val Ile Trp Lys Tyr Gln

770 775 780

Gln Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp

785 790 795 800

Gln Glu Glu Val Glu Gly Lys Gln Val Thr Gln Phe Ala Phe Ile Asp

805 810 815

Glu Ala Asp His Lys Thr Pro Glu Ser Leu Ala Ala Ala Lys Lys Arg

820 825 830

Ile Leu Asp Ala Phe Pro Gly Leu Glu Glu Cys Lys Asp Ser Asp Tyr

835 840 845

His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro

850 855 860

Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn

865 870 875 880

Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn

885 890 895

Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg

900 905 910

Lys Gly Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn

915 920 925

Met Ser Val Trp Leu Trp Asn Lys Ile Glu Tyr Arg Tyr Glu Asn Asp

930 935 940

Lys Asp Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys

945 950 955 960

Tyr Ala Asn Asn Ala Tyr Asp Gly Gly Thr Gln Cys Ser Ala Glu Leu

965 970 975

Lys Gln Ser Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Gly Ser Lys

980 985 990

Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro

995 1000 1005

Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys

1010 1015 1020

Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu Gly Glu Glu

1025 1030 1035 1040

Val Thr Glu Thr Ile Asn Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala

1045 1050 1055

Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln Glu Val

1060 1065 1070

Ser Ile Lys Ser Asn Ala Lys Val Pro Val Thr Val Thr Val Ala Leu

1075 1080 1085

Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg

1090 1095 1100

Pro Pro Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly Thr Val

1105 1110 1115 1120

Lys Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Ser Asp Ser

1125 1130 1135

Lys Glu Glu Lys Ser Ala Asn Phe Thr Phe Thr Gly Val Val Lys Ala

1140 1145 1150

Pro Phe Tyr Lys Asp Gly Lys Trp Lys Asn Asp Leu Lys Ser Pro Ala

1155 1160 1165

Pro Leu Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr Pro Lys

1170 1175 1180

Lys Asn Leu Glu Ala Ser Asn Tyr Lys Gly Gly Leu Lys Gln Phe Ala

1185 1190 1195 1200

Glu Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg

1205 1210 1215

Asp Gly Glu Ser Gly Lys His Arg Met Phe Thr Tyr Glu Ala Leu Thr

1220 1225 1230

Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp

1235 1240 1245

Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn Ser

1250 1255 1260

Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Ala

1265 1270 1275 1280

Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr

1285 1290 1295

Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu

1300 1305 1310

Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr

1315 1320 1325

Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp

1330 1335 1340

Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe

1345 1350 1355 1360

Asp Ile Lys Gln Trp Tyr Pro Glu Gly Ser Leu Pro Ala Phe Tyr Ser

1365 1370 1375

Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg

1380 1385 1390

Lys Ala Arg Gly Asp Asp Val Gly Asn Asp Lys Phe Gly Asn Arg Asn

1395 1400 1405

Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys

1410 1415 1420

Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Ala Phe Phe Lys Lys Trp

1425 1430 1435 1440

Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Thr Glu Met Ser

1445 1450 1455

Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu

1460 1465 1470

Asp Leu Pro Lys Pro Lys Gln Gly Pro Glu Thr Ile Asn Lys Val Thr

1475 1480 1485

Glu Tyr Ser Met Pro Ala Glu

1490 1495

<210> SEQ ID NO 70

<211> LENGTH: 1497

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 70

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Ile Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Lys Pro

85 90 95

Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp Asp Lys

130 135 140

Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala

145 150 155 160

Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys

165 170 175

Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe

180 185 190

Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu

245 250 255

Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Asn Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu Val Glu

500 505 510

Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Asn Gly

545 550 555 560

Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro Asp Asp

565 570 575

Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asp Asp Lys

580 585 590

Trp Lys Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu Asp

595 600 605

Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala Ala

610 615 620

Phe Asp Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu Ser

625 630 635 640

Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg Ala

740 745 750

Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Ala Leu

755 760 765

Pro Tyr Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys Tyr Gln

770 775 780

Val Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp

785 790 795 800

Leu Glu Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe Ile Asp

805 810 815

Glu Ala Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys Glu Lys

820 825 830

Ile Phe Ala Ala Phe Pro Gly Leu Lys Glu Cys Thr Asn Pro Ala Tyr

835 840 845

His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro

850 855 860

Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn

865 870 875 880

Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn

885 890 895

Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg

900 905 910

Lys Gly Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn

915 920 925

Met Ser Val Trp Leu Trp Asn Asp Thr Ser Tyr Arg Tyr Glu Glu Gly

930 935 940

Lys Asn Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys

945 950 955 960

Tyr Ala Asn Asp Ala Tyr Ala Gly Gly Thr Lys Cys Ser Ala Asp Leu

965 970 975

Lys Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly Ser Ser

980 985 990

Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys

995 1000 1005

Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile

1010 1015 1020

Lys Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Glu Glu Gly Gln

1025 1030 1035 1040

Asn Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe

1045 1050 1055

Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu

1060 1065 1070

Val Thr Ile Lys Ser Asn Ala Asn Val Pro Val Thr Val Thr Val Ala

1075 1080 1085

Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn

1090 1095 1100

Arg Pro Pro Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly Thr

1105 1110 1115 1120

Val Lys Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn

1125 1130 1135

Ser Ser Thr Asn Glu Ser Ala Ser Phe Thr Phe Thr Gly Val Val Lys

1140 1145 1150

Ala Pro Phe Tyr Lys Asp Gly Ala Trp Lys Asn Asp Leu Asn Ser Pro

1155 1160 1165

Ala Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro

1170 1175 1180

Lys Lys Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln Phe

1185 1190 1195 1200

Ala Asn Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly

1205 1210 1215

Arg Asp Ser Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu

1220 1225 1230

Pro Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly

1235 1240 1245

Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn

1250 1255 1260

Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His

1265 1270 1275 1280

Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala

1285 1290 1295

Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr

1300 1305 1310

Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu

1315 1320 1325

Tyr Leu Glu Glu Ser Asn Asn Gln Ala Trp Ala Arg Gly Gly Ala Gly

1330 1335 1340

Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn

1345 1350 1355 1360

Phe Asp Ile Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro Glu Phe

1365 1370 1375

Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met

1380 1385 1390

His Arg Lys Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe Gly Gly

1395 1400 1405

Lys Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met

1410 1415 1420

Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys

1425 1430 1435 1440

Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu

1445 1450 1455

Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala

1460 1465 1470

Ser Leu Asp Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Gln

1475 1480 1485

Val Thr Glu His Lys Met Ser Ala Glu

1490 1495

<210> SEQ ID NO 71

<211> LENGTH: 1495

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 71

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Ile Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Lys Pro

85 90 95

Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp Asp Lys

130 135 140

Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala

145 150 155 160

Asn Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys

165 170 175

Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe

180 185 190

Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu

245 250 255

Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Glu Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Asn Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val Arg

500 505 510

Pro Glu Asn Val Thr Arg Glu Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Asn Gly

545 550 555 560

Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro Asp Asp

565 570 575

Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asn Asp Arg

580 585 590

Trp Leu Pro Asp Ala Lys Ser Asn Met Thr Val Gly Thr Asn Leu Asp

595 600 605

Thr Val Tyr Phe Lys Lys His Gly Gln Val Thr Gly Asn Ser Ala Ala

610 615 620

Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu Ser

625 630 635 640

Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Met Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ser

740 745 750

Thr Pro Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Lys Pro

755 760 765

Pro Tyr Thr Ile Asp Asp Thr Thr Lys Glu Val Ile Trp Lys Tyr Gln

770 775 780

Gln Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp

785 790 795 800

Gln Glu Glu Val Glu Gly Lys Gln Val Thr Gln Phe Ala Phe Ile Asp

805 810 815

Glu Ala Asp His Lys Thr Pro Glu Ser Leu Ala Ala Ala Lys Lys Arg

820 825 830

Ile Leu Asp Ala Phe Pro Gly Leu Glu Glu Cys Lys Asp Ser Asp Tyr

835 840 845

His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro

850 855 860

Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn

865 870 875 880

Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn

885 890 895

Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg

900 905 910

Lys Gly Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn

915 920 925

Met Ser Val Trp Leu Trp Asn Lys Ile Glu Tyr Arg Tyr Glu Asn Asp

930 935 940

Lys Asp Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys

945 950 955 960

Tyr Ala Asn Asn Ala Tyr Asp Gly Gly Thr Gln Cys Ser Ala Glu Leu

965 970 975

Lys Gln Ser Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Gly Ser Lys

980 985 990

Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro

995 1000 1005

Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys

1010 1015 1020

Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu Gly Glu Glu

1025 1030 1035 1040

Val Thr Glu Thr Ile Asn Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala

1045 1050 1055

Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln Glu Val

1060 1065 1070

Ser Ile Lys Ser Asn Ala Lys Val Pro Val Thr Val Thr Val Ala Leu

1075 1080 1085

Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg

1090 1095 1100

Pro Pro Arg Val Thr Lys Thr Tyr Ser Leu Asp Ala Ser Gly Thr Val

1105 1110 1115 1120

Lys Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Ser Asp Ser

1125 1130 1135

Lys Glu Glu Lys Ser Ala Asn Phe Thr Phe Thr Gly Val Val Lys Ala

1140 1145 1150

Pro Phe Tyr Lys Asp Gly Lys Trp Lys Asn Asp Leu Lys Ser Pro Ala

1155 1160 1165

Pro Leu Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr Pro Lys

1170 1175 1180

Lys Asn Leu Glu Ala Ser Asn Tyr Lys Gly Gly Leu Lys Gln Phe Ala

1185 1190 1195 1200

Glu Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg

1205 1210 1215

Asp Gly Glu Ser Gly Lys His Arg Met Phe Thr Tyr Glu Ala Leu Thr

1220 1225 1230

Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp

1235 1240 1245

Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro Asn Ser

1250 1255 1260

Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Ala

1265 1270 1275 1280

Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr

1285 1290 1295

Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu

1300 1305 1310

Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr

1315 1320 1325

Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp

1330 1335 1340

Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe

1345 1350 1355 1360

Asp Ile Lys Gln Trp Tyr Pro Glu Gly Ser Leu Pro Ala Phe Tyr Ser

1365 1370 1375

Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg

1380 1385 1390

Lys Ala Arg Gly Asp Asp Val Gly Asn Asp Lys Phe Gly Asn Arg Asn

1395 1400 1405

Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met Leu Cys

1410 1415 1420

Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Ala Phe Phe Lys Lys Trp

1425 1430 1435 1440

Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Thr Glu Met Ser

1445 1450 1455

Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu Ala Ser Leu

1460 1465 1470

Asp Leu Pro Lys Pro Glu Gln Gly Pro Glu Thr Ile Asn Gln Val Thr

1475 1480 1485

Glu His Lys Met Ser Ala Glu

1490 1495

<210> SEQ ID NO 72

<211> LENGTH: 1501

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 72

Cys Asp Gly Gly Gly Ser Gly Pro Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Asp

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Ile Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala Thr

100 105 110

Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys

115 120 125

Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Ala Ser Asp Asp

130 135 140

Lys Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro

145 150 155 160

Ala Asp Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser

165 170 175

Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu

180 185 190

Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp

195 200 205

Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro

210 215 220

Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu

225 230 235 240

Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg

245 250 255

Leu Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr

260 265 270

Asn Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser

275 280 285

Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser

290 295 300

Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu

305 310 315 320

Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr

325 330 335

Gly Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe

340 345 350

Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser

355 360 365

Asn Gly Ala Thr Leu Asp Glu Gly Asp Gln Asn Val Val Leu Pro Asn

370 375 380

Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp Thr

385 390 395 400

Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser

405 410 415

Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn

420 425 430

Lys Leu Trp Gly Val Asp Lys Asp Tyr Lys Ser Val Thr Lys Phe His

435 440 445

Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg

450 455 460

Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met

465 470 475 480

Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala

485 490 495

Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val

500 505 510

Gln Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe

515 520 525

Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn

530 535 540

Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Asn

545 550 555 560

Gly Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Ser Gly Asp Ser Asp

565 570 575

Asp Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asp Asp

580 585 590

Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu

595 600 605

Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala

610 615 620

Glu Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu

625 630 635 640

Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu

645 650 655

Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile

660 665 670

Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val

675 680 685

Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met

690 695 700

Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val

705 710 715 720

Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val

725 730 735

Val Asn Thr Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg

740 745 750

Glu Lys Gly Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Ser Ala

755 760 765

Gln Pro Pro Tyr Thr Ile Asp Pro Asp Thr Gly Lys Val Thr Trp Lys

770 775 780

Tyr Gln Glu Glu Gly Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala

785 790 795 800

Ser Trp Gln Glu Asp Val Asp Gly Lys Gln Val Thr Arg Tyr Ala Phe

805 810 815

Ile Asp Glu Ala Glu His Ser Thr Glu Glu Ser Leu Glu Ala Ala Lys

820 825 830

Ala Lys Ile Phe Glu Lys Phe Pro Gly Leu Gln Glu Cys Lys Asp Ser

835 840 845

Thr Tyr His Tyr Glu Ile Asn Cys Leu Glu Arg Arg Pro Gly Thr Asp

850 855 860

Val Pro Val Thr Gly Gly Met Tyr Val Pro Arg Tyr Thr Gln Leu Asn

865 870 875 880

Leu Asp Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly

885 890 895

Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn

900 905 910

Gly Arg Lys Gly Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr

915 920 925

Gln Asn Met Ser Val Trp Leu Trp Asn Lys Ile Glu Tyr Arg Tyr Glu

930 935 940

Asn Asp Lys Asp Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu

945 950 955 960

Asn Cys Tyr Ala Asn Asn Ala Tyr Ser Glu Gly Thr Gln Cys Ser Ala

965 970 975

Asp Leu Lys Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly

980 985 990

Ser Ser Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met

995 1000 1005

Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu

1010 1015 1020

Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu

1025 1030 1035 1040

Gly Glu Lys Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys

1045 1050 1055

Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln

1060 1065 1070

Gln Glu Val Thr Ile Glu Ser Thr Ala Ser Val Pro Val Thr Val Thr

1075 1080 1085

Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala

1090 1095 1100

Leu Asn Arg Pro Pro Lys Val Thr Lys Thr Tyr Asp Leu Lys Ala Asn

1105 1110 1115 1120

Asp Lys Val Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys

1125 1130 1135

Gly Asn Ser Pro Lys Asn Glu Ser Ala Glu Phe Thr Phe Thr Gly Val

1140 1145 1150

Val Lys Ala Pro Phe Tyr Lys Asp Gly Glu Trp Lys Asn Ala Leu Asn

1155 1160 1165

Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Asp Ser Phe Val Tyr Thr

1170 1175 1180

Ala Pro Lys Asn Asn Leu Asn Ala Ser Asn Tyr Ser Asn Tyr Thr Asp

1185 1190 1195 1200

Gly Val Ala Glu Phe Ala Lys Glu Leu Asp Thr Phe Ala Ser Ser Met

1205 1210 1215

Asn Asp Phe Tyr Gly Arg Asp Gly Glu Ser Gly Asn His Arg Met Phe

1220 1225 1230

Thr Tyr Lys Ala Leu Thr Gly His Lys His Arg Phe Ala Asn Asp Val

1235 1240 1245

Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser

1250 1255 1260

Ser Phe Ser Thr Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp

1265 1270 1275 1280

Trp Leu Ile Trp His Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu

1285 1290 1295

Asn Val Pro Gly Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr

1300 1305 1310

Met Gln Asp Arg Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile

1315 1320 1325

Thr Val Ala Pro Glu Tyr Leu Asp Glu Ser Asn Gly Gln Ala Trp Ala

1330 1335 1340

Arg Gly Gly Ala Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu

1345 1350 1355 1360

Trp Ala Glu Glu Asn Phe Asp Ile Lys Gln Trp Tyr Pro Asp Gly Glu

1365 1370 1375

Leu Pro Lys Phe Tyr Ser Asp Arg Lys Gly Met Lys Gly Trp Asn Leu

1380 1385 1390

Phe Gln Leu Met His Arg Lys Ala Arg Gly Asp Asp Val Ser Asn Asp

1395 1400 1405

Lys Phe Gly Gly Arg Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala

1410 1415 1420

Asp Thr Leu Met Leu Cys Ala Ser Trp Val Ala Gln Ala Asp Leu Ser

1425 1430 1435 1440

Glu Phe Phe Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro

1445 1450 1455

Gly Ala Ser Glu Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr

1460 1465 1470

Asn Thr Leu Ala Ala Met His Leu Ser Lys Pro Glu Lys Gly Pro Glu

1475 1480 1485

Thr Ile Asn Lys Val Thr Glu Tyr Ser Met Pro Ala Glu

1490 1495 1500

<210> SEQ ID NO 73

<211> LENGTH: 1498

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 73

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Leu Arg Val Thr

65 70 75 80

Gly Asp Ile Thr Cys Asn Asp Glu Ser Ser Asp Gly Phe Thr Phe Thr

85 90 95

Pro Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn Thr Thr Ile Ala

100 105 110

Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu

115 120 125

Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Gly Ser Asp

130 135 140

Asn Lys Lys Ser Asn Ala Leu Ser Leu Val Thr Ser Met Asn Ser Cys

145 150 155 160

Pro Ala Asn Thr Glu Gln Val Cys Leu Glu Phe Ser Ser Val Ile Glu

165 170 175

Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu

180 185 190

Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr

195 200 205

Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Ala Thr Thr

210 215 220

Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala

225 230 235 240

Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly

245 250 255

Arg Leu Val Asp Ser Gln Gly Asp Gly Val Val Gly Val Asn Tyr Tyr

260 265 270

Thr Asn Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe

275 280 285

Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly

290 295 300

Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp

305 310 315 320

Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Lys

325 330 335

Ala Gly Gln Asn His Thr Arg Val Val Pro Asp Glu Val Arg Lys Val

340 345 350

Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu

355 360 365

Ser Asn Gly Ala Thr Leu Gly Glu Gly Glu Gln Val Val Asn Leu Pro

370 375 380

Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp

385 390 395 400

Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe

405 410 415

Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile

420 425 430

Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Lys Ser Val Ser Lys Phe

435 440 445

His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala

450 455 460

Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu

465 470 475 480

Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg

485 490 495

Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile

500 505 510

Val Arg Pro Glu Asn Val Thr Arg Glu Thr Ala Thr Phe Asn Leu Pro

515 520 525

Phe Ile Ser Leu Gly Gln Val Gly Asp Gly Lys Leu Met Val Ile Gly

530 535 540

Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp

545 550 555 560

Asn Gly Gly Val Asn Lys Asp Gly Gln Cys Thr Leu Asn Ser Asp Pro

565 570 575

Asp Asp Met Lys Asn Phe Met Glu Asn Val Leu Arg Tyr Leu Ser Asn

580 585 590

Asp Arg Trp Leu Pro Asp Ala Lys Ser Ser Met Thr Val Gly Thr Asn

595 600 605

Leu Asp Thr Val Tyr Phe Lys Lys His Gly Gln Val Leu Gly Asn Ser

610 615 620

Ala Pro Phe Ala Phe His Lys Asp Phe Thr Gly Ile Thr Val Lys Pro

625 630 635 640

Met Thr Ser Tyr Gly Asn Leu Asn Pro Asp Glu Val Pro Leu Leu Ile

645 650 655

Leu Asn Gly Phe Glu Tyr Val Thr Gln Trp Gly Ser Asp Pro Tyr Ser

660 665 670

Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp

675 680 685

Val Thr Asp Leu Ile Ala Tyr Met Asn Lys Gly Gly Ser Val Leu Ile

690 695 700

Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe

705 710 715 720

Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser

725 730 735

Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg

740 745 750

Arg Ser Thr Pro Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly

755 760 765

Lys Pro Pro Tyr Thr Ile Asp Asp Thr Thr Lys Glu Val Ile Trp Lys

770 775 780

Tyr Gln Gln Glu Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala

785 790 795 800

Ser Trp Gln Glu Glu Val Glu Gly Lys Gln Val Thr Gln Phe Ala Phe

805 810 815

Ile Asp Glu Ala Asp His Lys Thr Pro Glu Ser Leu Ala Ala Ala Lys

820 825 830

Gln Arg Ile Leu Asp Ala Phe Pro Gly Leu Glu Val Cys Lys Asp Ser

835 840 845

Asp Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly

850 855 860

Val Pro Val Thr Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Asp

865 870 875 880

Leu Gly Ala Asp Thr Ala Lys Ala Met Leu Gln Ala Ala Asp Leu Gly

885 890 895

Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn

900 905 910

Gly Leu Gln Gly Glu Arg Leu Asn Ser Val Asp Leu Glu Arg Leu Tyr

915 920 925

Gln Asn Met Ser Val Trp Leu Trp Asn Glu Thr Lys Tyr Arg Tyr Glu

930 935 940

Glu Gly Lys Glu Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu

945 950 955 960

Asn Cys Tyr Thr Asn Asn Ala Tyr Val Gly Thr Gln Cys Ser Ala Glu

965 970 975

Leu Lys Lys Ser Leu Ile Asp Asn Lys Met Ile Tyr Gly Glu Glu Ser

980 985 990

Ser Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu

995 1000 1005

Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn

1010 1015 1020

Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Val Val Asn Thr Asn Gly

1025 1030 1035 1040

Glu Thr Val Thr Gln Asn Ile Asn Leu Tyr Ser Ala Pro Thr Lys Trp

1045 1050 1055

Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln

1060 1065 1070

Glu Val Ser Ile Glu Ser Lys Ala Thr Val Pro Val Thr Val Thr Val

1075 1080 1085

Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ser Leu

1090 1095 1100

Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr Asp Leu Lys Ala Asn Asp

1105 1110 1115 1120

Lys Val Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly

1125 1130 1135

Asp Ser Lys Glu Val Gln Ser Ala Asp Phe Thr Phe Thr Gly Val Val

1140 1145 1150

Lys Ala Pro Phe Tyr Lys Asp Gly Lys Trp Gln His Asp Leu Asn Ser

1155 1160 1165

Pro Ala Pro Leu Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr

1170 1175 1180

Pro Lys Lys Asn Leu Asn Ala Ser Asn Tyr Thr Gly Gly Leu Glu Gln

1185 1190 1195 1200

Phe Ala Asn Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr

1205 1210 1215

Gly Arg Asp Ser Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn

1220 1225 1230

Leu Pro Gly His Lys His Arg Phe Ala Asn Asp Val Gln Ile Ser Ile

1235 1240 1245

Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Pro

1250 1255 1260

Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp

1265 1270 1275 1280

His Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly

1285 1290 1295

Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg

1300 1305 1310

Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro

1315 1320 1325

Glu Tyr Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala

1330 1335 1340

Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys

1345 1350 1355 1360

Asn Phe Asp Ile Lys Lys Trp Tyr Pro Asp Gly Thr Pro Leu Pro Glu

1365 1370 1375

Phe Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu

1380 1385 1390

Met His Arg Lys Ala Arg Gly Asp Glu Val Ser Asn Asp Lys Phe Gly

1395 1400 1405

Gly Lys Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu

1410 1415 1420

Met Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe

1425 1430 1435 1440

Lys Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Thr

1445 1450 1455

Glu Met Ser Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Asn Thr Leu

1460 1465 1470

Ala Ser Leu Asn Leu Pro Lys Pro Lys Gln Gly Pro Glu Thr Ile Asn

1475 1480 1485

Lys Val Thr Glu Tyr Ser Met Pro Ala Glu

1490 1495

<210> SEQ ID NO 74

<211> LENGTH: 1495

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 74

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Thr Pro Asp Pro Glu Pro Glu Pro Glu Pro Glu Pro Val Pro Thr

50 55 60

Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr Gly Ala

65 70 75 80

Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro Gly Glu

85 90 95

Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe Asp Thr

100 105 110

Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val Ser Phe

115 120 125

Ser Leu Glu Asp Ala Gln Glu Leu Ala Ala Ser Asp Asp Lys Lys Ser

130 135 140

Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala Asn Thr

145 150 155 160

Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys Arg Phe

165 170 175

Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe Lys Lys

180 185 190

Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys Ala Pro

195 200 205

Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly Thr Lys

210 215 220

Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln Phe Tyr

225 230 235 240

Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu Val Asp

245 250 255

Ser Met Gly Asn Gly Val Val Gly Val Asn Tyr Tyr Thr Ser Ser Gly

260 265 270

Arg Gly Val Thr Gly Glu Asn Gly Lys Phe Asn Phe Ser Trp Gly Glu

275 280 285

Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val Arg Gly

290 295 300

Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val Arg Gly

305 310 315 320

Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Gln Ala Gly Lys Asn

325 330 335

Asp Glu Arg Glu Val Pro Asp Val Val Arg Lys Val Phe Ala Glu Tyr

340 345 350

Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn Gly Glu

355 360 365

Ala Leu Ser Glu Gly Asp Gln Thr Phe Glu Arg Thr Asn Glu Phe Leu

370 375 380

Glu Gln Phe Glu Ser Gly Gln Ala Lys Glu Ile Asp Thr Ala Ile Cys

385 390 395 400

Asp Ser Leu Gly Gly Cys Asn Ser Gln Arg Trp Phe Ser Leu Thr Ala

405 410 415

Arg Asn Val Asn Glu Gly Gln Ile Gln Gly Val Ile Asn Lys Leu Trp

420 425 430

Gly Val Asp Lys Asp Tyr Lys Ser Val Thr Lys Phe His Val Phe His

435 440 445

Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly Gln Ala

450 455 460

Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala Arg Asn

465 470 475 480

Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp Asp Lys

485 490 495

Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Leu Val Glu Pro Glu

500 505 510

Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe Ile Ser Leu

515 520 525

Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn Pro His Tyr

530 535 540

Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Glu Gly Gly Val

545 550 555 560

Asp Lys Asn Gly Gln Cys Thr Arg Asn Ser Asp Ser Asn Asp Met Lys

565 570 575

His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asp Asp Lys Trp Thr

580 585 590

Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu Asp Thr Val

595 600 605

Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala Glu Phe Gly

610 615 620

Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu Ser Ser Tyr

625 630 635 640

Gly Asp Leu Asp Pro Gln Glu Met Pro Leu Leu Ile Leu Asn Gly Phe

645 650 655

Glu Tyr Val Thr Gln Val Gly Asn Asp Pro Tyr Ala Ile Pro Leu Arg

660 665 670

Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr Asp Leu

675 680 685

Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met Glu Asn Val

690 695 700

Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg Leu Leu

705 710 715 720

Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val Asn Asn

725 730 735

Asp Pro Gln Gly Tyr Pro Asn Arg Val Arg Gln Gln Arg Ala Thr Gly

740 745 750

Ile Trp Val Tyr Glu Arg Tyr Pro Ala Val Asp Gly Ala Leu Pro Tyr

755 760 765

Thr Ile Asp Ser Lys Thr Gly Glu Val Lys Trp Lys Tyr Gln Val Glu

770 775 780

Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser Trp Leu Glu

785 790 795 800

Asp Val Asp Gly Lys Gln Glu Thr Arg Tyr Ala Phe Ile Asp Glu Ala

805 810 815

Asp His Lys Thr Glu Asp Ser Leu Lys Ala Ala Lys Ala Lys Ile Phe

820 825 830

Glu Lys Phe Pro Gly Leu Lys Glu Cys Lys Asp Pro Thr Tyr His Tyr

835 840 845

Glu Val Asn Cys Leu Glu Tyr Arg Pro Gly Thr Gly Val Pro Val Thr

850 855 860

Gly Gly Met Tyr Val Pro Gln Tyr Thr Gln Leu Ser Leu Asn Ala Asp

865 870 875 880

Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn Ile Gln

885 890 895

Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg Lys Gly

900 905 910

Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn Met Ser

915 920 925

Val Trp Leu Trp Asn Lys Ile Glu Tyr Arg Tyr Glu Asn Asp Lys Asp

930 935 940

Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys Tyr Ala

945 950 955 960

Asn Asp Ala Tyr Thr Gly Gly Thr Gln Cys Ser Asp Glu Leu Lys Lys

965 970 975

Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Glu Lys Ser Val Asn Lys

980 985 990

Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu Lys Pro

995 1000 1005

Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn Ile Lys

1010 1015 1020

Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu Gly Glu Lys

1025 1030 1035 1040

Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp Phe Ala

1045 1050 1055

Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys Glu Val

1060 1065 1070

Thr Ile Glu Ser Ser Ala Ser Val Pro Val Thr Val Thr Val Ala Leu

1075 1080 1085

Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu Asn Arg

1090 1095 1100

Pro Pro Lys Val Thr Lys Thr Tyr Asp Leu Lys Ala Asn Asp Lys Val

1105 1110 1115 1120

Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly Asn Ser

1125 1130 1135

Pro Lys Asn Glu Ser Ala Glu Phe Thr Phe Thr Gly Val Val Lys Ala

1140 1145 1150

Pro Phe Tyr Lys Asp Gly Glu Trp Lys Asn Ala Leu Asn Ser Pro Ala

1155 1160 1165

Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr Pro Lys

1170 1175 1180

Lys Asn Leu Glu Ala Ser Asn Phe Thr Gly Gly Val Ala Glu Phe Ala

1185 1190 1195 1200

Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr Gly Arg

1205 1210 1215

Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn Leu Thr

1220 1225 1230

Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile Gly Asp

1235 1240 1245

Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr Asn Ser

1250 1255 1260

Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp His Ala

1265 1270 1275 1280

Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly Ala Thr

1285 1290 1295

Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg Tyr Leu

1300 1305 1310

Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro Glu Tyr

1315 1320 1325

Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala Gly Asp

1330 1335 1340

Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys Asn Phe

1345 1350 1355 1360

Asp Ile Lys Gln Trp Tyr Pro Glu Gly Asp Leu Pro Lys Phe Tyr Ser

1365 1370 1375

Asp Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met His Arg

1380 1385 1390

Lys Ala Arg Gly Asp Asp Val Gly Lys Thr Lys Phe Gly Glu Arg Asn

1395 1400 1405

Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Lys Leu Met Leu Cys

1410 1415 1420

Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys Lys Trp

1425 1430 1435 1440

Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu Met Asn

1445 1450 1455

Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Glu Thr Leu Ala Ala Leu

1460 1465 1470

Asn Leu Pro Lys Pro Gln Gln Gly Pro Glu Thr Ile Asn Gln Val Thr

1475 1480 1485

Glu His Lys Met Ser Ala Glu

1490 1495

<210> SEQ ID NO 75

<211> LENGTH: 1497

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 75

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Pro Val Asp

1 5 10 15

Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Asn

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Ile Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Glu Asp Val Thr Cys Val Ala Gly Asn Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Glu Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Ala Ser Asp Asn Lys

130 135 140

Lys Ser Asn Ala Val Ser Leu Val Thr Ser Ser Asn Ser Cys Pro Ala

145 150 155 160

Asp Thr Glu Gln Val Cys Leu Thr Phe Ser Ser Val Ile Glu Ser Lys

165 170 175

Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp Leu Ala Pro Glu Glu Phe

180 185 190

Lys Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Pro Val Val Pro Val Thr Thr Pro Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Arg Leu

245 250 255

Val Asp Ser Gln Gly Tyr Gly Val Ala Gly Val Asn Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Gly Glu Asn Gly Glu Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Asp Glu Gly Glu Gln Val Val Asn Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Ser Tyr Lys Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ala Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val Arg

500 505 510

Pro Glu Asn Val Thr Arg Glu Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Lys Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Glu Gly

545 550 555 560

Gly Val Asp Lys Asn Gly Gln Cys Thr Arg Asn Ser Asp Ser Asn Asp

565 570 575

Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asn Asp Lys

580 585 590

Trp Thr Pro Asp Ala Lys Ala Ser Met Thr Val Gly Thr Asn Leu Asp

595 600 605

Thr Val Tyr Phe Lys Arg His Gly Gln Val Thr Gly Asn Ser Ala Glu

610 615 620

Phe Gly Phe His Pro Asp Phe Ala Gly Ile Ser Val Glu His Leu Ser

625 630 635 640

Ser Tyr Gly Asp Leu Asp Pro Gln Lys Met Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Val Gly Gly Asp Pro Tyr Ala Val Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Met Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Gly Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ala

740 745 750

Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro Val Val Glu Gly Glu Leu

755 760 765

Pro Tyr Thr Ile Asp Ser Lys Thr Gly Lys Val Thr Trp Lys Tyr Gln

770 775 780

Ile Asp Asn Lys Pro Asp Lys Lys Pro Lys Leu Glu Val Ala Ser Trp

785 790 795 800

Gln Glu Glu Val Asp Gly Lys Gln Val Thr Gln Phe Ala Phe Ile Asp

805 810 815

Glu Ala Asp His Lys Thr Thr Glu Ser Leu Asp Ala Ala Lys Lys Lys

820 825 830

Ile Leu Glu Lys Phe Lys Gly Leu Glu Glu Cys Lys Asp Ser Thr Tyr

835 840 845

His Tyr Glu Ile Asn Cys Leu Glu Tyr Arg Pro Gly Thr Asn Val Pro

850 855 860

Val Thr Gly Gly Met Tyr Val Pro Arg Tyr Thr Gln Leu Asn Leu Ser

865 870 875 880

Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr Asn

885 890 895

Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Asn Gly Arg

900 905 910

Lys Gly Glu Arg Leu Ser Ser Val Asp Leu Glu Arg Leu Tyr Gln Asn

915 920 925

Met Ser Val Trp Leu Trp Asn Glu Ile Glu Tyr Ser Tyr Asp Ser Ser

930 935 940

Lys Glu Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn Cys

945 950 955 960

Tyr Ala Asn Asp Ala Tyr Thr Gly Gly Thr Gln Cys Ser Asp Glu Leu

965 970 975

Lys Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Glu Lys Ser Val

980 985 990

Asn Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu

995 1000 1005

Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn

1010 1015 1020

Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ala Val Ser Ala Glu Gly

1025 1030 1035 1040

Glu Lys Val Thr Glu Thr Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp

1045 1050 1055

Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Lys

1060 1065 1070

Glu Val Thr Ile Glu Ser Ser Ala Ser Val Pro Val Thr Val Thr Val

1075 1080 1085

Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu

1090 1095 1100

Asn Arg Pro Pro Lys Val Thr Lys Thr Tyr Asp Leu Lys Ala Asn Asp

1105 1110 1115 1120

Lys Val Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly

1125 1130 1135

Asn Ser Pro Lys Asn Glu Ser Ala Glu Phe Thr Phe Thr Gly Val Val

1140 1145 1150

Lys Ala Pro Phe Tyr Lys Asp Gly Glu Trp Lys Asn Ala Leu Asn Ser

1155 1160 1165

Pro Ala Pro Leu Gly Glu Leu Glu Ser Asp Ala Phe Val Tyr Thr Thr

1170 1175 1180

Pro Lys Lys Asn Leu Glu Ala Ser Asn Phe Thr Gly Gly Val Ala Glu

1185 1190 1195 1200

Phe Ala Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr

1205 1210 1215

Gly Arg Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn

1220 1225 1230

Leu Thr Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile

1235 1240 1245

Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr

1250 1255 1260

Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp

1265 1270 1275 1280

His Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Thr Val Pro Gly

1285 1290 1295

Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg

1300 1305 1310

Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro

1315 1320 1325

Glu Tyr Leu Glu Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala

1330 1335 1340

Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Lys

1345 1350 1355 1360

Asn Phe Asp Ile Lys Thr Trp Tyr Pro Asp Gly Asn Leu Pro Ala Phe

1365 1370 1375

Tyr Ser Glu Arg Glu Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met

1380 1385 1390

His Arg Lys Ala Arg Gly Asp Glu Val Gly Lys Thr Lys Phe Gly Glu

1395 1400 1405

Arg Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met

1410 1415 1420

Leu Cys Ala Ser Trp Val Ala Gln Thr Asp Leu Ser Glu Phe Phe Lys

1425 1430 1435 1440

Lys Trp Asn Pro Gly Ala Asn Ala Tyr Gln Leu Pro Gly Ala Ser Glu

1445 1450 1455

Met Asn Phe Glu Gly Gly Val Ser Gln Ser Ala Tyr Glu Thr Leu Ala

1460 1465 1470

Ala Leu Asn Leu Pro Lys Pro Gln Gln Gly Pro Glu Thr Ile Asn Gln

1475 1480 1485

Val Thr Glu His Lys Met Ser Ala Glu

1490 1495

<210> SEQ ID NO 76

<211> LENGTH: 1497

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 76

Cys Asp Gly Gly Gly Ser Gly Ser Ser Ser Asp Thr Pro Ser Val Asp

1 5 10 15

Ser Gly Ser Gly Thr Leu Pro Glu Val Lys Pro Asp Pro Thr Pro Thr

20 25 30

Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Asp

35 40 45

Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro Glu Pro Glu Pro Val

50 55 60

Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly Ser Gln Arg Val Thr

65 70 75 80

Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly Phe Thr Phe Thr Pro

85 90 95

Gly Asn Thr Val Ser Cys Val Val Gly Ser Thr Thr Ile Ala Thr Phe

100 105 110

Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu Arg Ala Val Asp Lys Val

115 120 125

Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu Ala Asn Ser Glu Asn Lys

130 135 140

Lys Thr Asn Ala Ile Ser Leu Val Thr Ser Ser Asp Ser Cys Pro Ala

145 150 155 160

Asp Ala Glu Gln Leu Cys Leu Thr Phe Ser Ser Val Val Asp Arg Ala

165 170 175

Arg Phe Glu Lys Leu Tyr Lys Gln Ile Asp Leu Ala Thr Asp Asn Phe

180 185 190

Ser Lys Leu Val Asn Glu Glu Val Glu Asn Asn Ala Ala Thr Asp Lys

195 200 205

Ala Pro Ser Thr His Thr Ser Thr Val Val Pro Val Thr Thr Glu Gly

210 215 220

Thr Lys Pro Asp Leu Asn Ala Ser Phe Val Ser Ala Asn Ala Glu Gln

225 230 235 240

Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile Leu Ser Glu Gly Gln Leu

245 250 255

Val Asp Ser Leu Gly Asn Gly Val Ala Gly Val Asp Tyr Tyr Thr Asn

260 265 270

Ser Gly Arg Gly Val Thr Asp Glu Asn Gly Lys Phe Ser Phe Ser Trp

275 280 285

Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr Phe Glu Leu Gly Ser Val

290 295 300

Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr Glu Leu Gly Asp Glu Val

305 310 315 320

Arg Gly Ala Asn Ile Asp Gln Leu Ile His Arg Tyr Ser Thr Thr Gly

325 330 335

Gln Asn Asn Thr Arg Val Val Pro Asp Asp Val Arg Lys Val Phe Ala

340 345 350

Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile Asn Leu Ser Leu Ser Asn

355 360 365

Gly Ala Thr Leu Asp Glu Gly Asp Gln Asn Val Val Leu Pro Asn Glu

370 375 380

Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala Lys Glu Ile Asp Thr Ala

385 390 395 400

Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu Ala Arg Trp Phe Ser Leu

405 410 415

Thr Thr Arg Asn Val Asn Asp Gly Gln Ile Gln Gly Val Ile Asn Lys

420 425 430

Leu Trp Gly Val Asp Thr Asn Tyr Gln Ser Val Ser Lys Phe His Val

435 440 445

Phe His Asp Ser Thr Asn Phe Tyr Gly Ser Thr Gly Asn Ala Arg Gly

450 455 460

Gln Ala Val Val Asn Ile Ser Asn Ser Ala Phe Pro Ile Leu Met Ala

465 470 475 480

Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe Gly Glu Lys Arg Ala Trp

485 490 495

Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu Ala Pro Ser Ile Val Gln

500 505 510

Pro Glu Asn Val Thr Arg Asp Thr Ala Thr Phe Asn Leu Pro Phe Ile

515 520 525

Ser Leu Gly Gln Val Gly Glu Gly Lys Leu Met Val Ile Gly Asn Pro

530 535 540

His Tyr Asn Ser Ile Leu Arg Cys Pro Asn Gly Tyr Ser Trp Gly Gly

545 550 555 560

Gly Val Asn Ser Lys Gly Glu Cys Thr Leu Ser Gly Asp Ser Asp Asp

565 570 575

Met Lys His Phe Met Gln Asn Val Leu Arg Tyr Leu Ser Asn Asp Ile

580 585 590

Trp Gln Pro Asn Thr Lys Ser Ile Met Thr Val Gly Thr Asn Leu Glu

595 600 605

Asn Val Tyr Phe Lys Lys Ala Gly Gln Val Leu Gly Asn Ser Ala Pro

610 615 620

Phe Ala Phe His Glu Asp Phe Thr Gly Ile Thr Val Lys Gln Leu Thr

625 630 635 640

Ser Tyr Gly Asp Leu Asn Pro Glu Glu Ile Pro Leu Leu Ile Leu Asn

645 650 655

Gly Phe Glu Tyr Val Thr Gln Trp Ser Gly Asp Pro Tyr Ala Val Pro

660 665 670

Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu Thr Gln Gln Asp Val Thr

675 680 685

Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly Ser Val Leu Ile Met Glu

690 695 700

Asn Val Met Ser Asn Leu Lys Glu Glu Ser Ala Ser Ser Phe Val Arg

705 710 715 720

Leu Leu Asp Ala Ala Gly Leu Ser Met Ala Leu Asn Lys Ser Val Val

725 730 735

Asn Asn Asp Pro Gln Gly Tyr Pro Asp Arg Val Arg Gln Arg Arg Ala

740 745 750

Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro Ala Ala Asp Gly Ala Gln

755 760 765

Pro Pro Tyr Thr Ile Asp Pro Asn Thr Gly Glu Val Thr Trp Lys Tyr

770 775 780

Gln Gln Asp Asn Lys Pro Asp Asp Lys Pro Lys Leu Glu Val Ala Ser

785 790 795 800

Trp Gln Glu Glu Val Glu Gly Lys Gln Val Thr Arg Tyr Ala Phe Ile

805 810 815

Asp Glu Ala Glu Tyr Thr Thr Glu Glu Ser Leu Glu Ala Ala Lys Ala

820 825 830

Lys Ile Phe Glu Lys Phe Pro Gly Leu Gln Glu Cys Lys Asp Ser Thr

835 840 845

Tyr His Tyr Glu Ile Asn Cys Leu Glu Arg Arg Pro Gly Thr Asp Val

850 855 860

Pro Val Thr Gly Gly Met Tyr Val Pro Arg Tyr Thr Gln Leu Asn Leu

865 870 875 880

Asp Ala Asp Thr Ala Lys Ala Met Val Gln Ala Ala Asp Leu Gly Thr

885 890 895

Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr Phe Arg Thr Lys Gly

900 905 910

Ser Lys Gly Glu Arg Leu Asn Ser Val Asp Leu Glu Arg Leu Tyr Gln

915 920 925

Asn Met Ser Val Trp Leu Trp Asn Asp Thr Lys Tyr Arg Tyr Glu Glu

930 935 940

Gly Lys Glu Asp Glu Leu Gly Phe Lys Thr Phe Thr Glu Phe Leu Asn

945 950 955 960

Cys Tyr Ala Asn Asp Ala Tyr Ala Gly Gly Thr Lys Cys Ser Ala Asp

965 970 975

Leu Lys Lys Ser Leu Val Asp Asn Asn Met Ile Tyr Gly Asp Gly Ser

980 985 990

Ser Lys Ala Gly Met Met Asn Pro Ser Tyr Pro Leu Asn Tyr Met Glu

995 1000 1005

Lys Pro Leu Thr Arg Leu Met Leu Gly Arg Ser Trp Trp Asp Leu Asn

1010 1015 1020

Ile Lys Val Asp Val Glu Lys Tyr Pro Gly Ser Val Ser Ala Lys Gly

1025 1030 1035 1040

Glu Ser Val Thr Glu Asn Ile Ser Leu Tyr Ser Asn Pro Thr Lys Trp

1045 1050 1055

Phe Ala Gly Asn Met Gln Ser Thr Gly Leu Trp Ala Pro Ala Gln Gln

1060 1065 1070

Asp Val Thr Ile Lys Ser Ser Ala Ser Val Pro Val Thr Val Thr Val

1075 1080 1085

Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu Lys His Glu Val Ala Leu

1090 1095 1100

Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr Thr Leu Glu Ala Asn Gly

1105 1110 1115 1120

Glu Val Thr Phe Lys Val Pro Tyr Gly Gly Leu Ile Tyr Ile Lys Gly

1125 1130 1135

Asp Ser Lys Asp Asp Val Ser Ala Asn Phe Thr Phe Thr Gly Val Val

1140 1145 1150

Lys Ala Pro Phe Tyr Lys Asp Gly Glu Trp Lys Asn Asp Leu Asp Ser

1155 1160 1165

Pro Ala Pro Leu Gly Glu Leu Glu Ser Ala Ser Phe Val Tyr Thr Thr

1170 1175 1180

Pro Lys Lys Asn Leu Glu Ala Ser Asn Phe Thr Gly Gly Val Ala Glu

1185 1190 1195 1200

Phe Ala Lys Asp Leu Asp Thr Phe Ala Ser Ser Met Asn Asp Phe Tyr

1205 1210 1215

Gly Arg Asn Asp Glu Asp Gly Lys His Arg Met Phe Thr Tyr Lys Asn

1220 1225 1230

Leu Thr Gly His Lys His Arg Phe Thr Asn Asp Val Gln Ile Ser Ile

1235 1240 1245

Gly Asp Ala His Ser Gly Tyr Pro Val Met Asn Ser Ser Phe Ser Thr

1250 1255 1260

Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu Asn Asp Trp Leu Ile Trp

1265 1270 1275 1280

His Ala Val Gly His Asn Ala Ala Glu Thr Pro Leu Asn Val Pro Gly

1285 1290 1295

Ala Thr Glu Val Ala Asn Asn Val Leu Ala Leu Tyr Met Gln Asp Arg

1300 1305 1310

Tyr Leu Gly Lys Met Asn Arg Val Ala Asp Asp Ile Thr Val Ala Pro

1315 1320 1325

Glu Tyr Leu Asp Glu Ser Asn Gly Gln Ala Trp Ala Arg Gly Gly Ala

1330 1335 1340

Gly Asp Arg Leu Leu Met Tyr Ala Gln Leu Lys Glu Trp Ala Glu Glu

1345 1350 1355 1360

Asn Phe Asp Ile Lys Gln Trp Tyr Pro Asp Gly Glu Leu Pro Lys Phe

1365 1370 1375

Tyr Ser Asp Arg Lys Gly Met Lys Gly Trp Asn Leu Phe Gln Leu Met

1380 1385 1390

His Arg Lys Ala Arg Gly Asp Asp Val Gly Asn Ser Thr Phe Gly Gly

1395 1400 1405

Lys Asn Tyr Cys Ala Glu Ser Asn Gly Asn Ala Ala Asp Thr Leu Met

1410 1415 1420

Leu Cys Ala Ser Trp Val Ala Gln Ala Asp Leu Ser Glu Phe Phe Lys

1425 1430 1435 1440

Lys Trp Asn Pro Gly Ala Ser Ala Tyr Gln Leu Pro Gly Ala Thr Glu

1445 1450 1455

Met Ser Phe Gln Gly Gly Val Ser Ser Ser Ala Tyr Ser Thr Leu Ala

1460 1465 1470

Ser Leu Lys Leu Pro Lys Pro Glu Lys Gly Pro Glu Thr Ile Asn Lys

1475 1480 1485

Val Thr Glu His Lys Met Ser Ala Glu

1490 1495

<210> SEQ ID NO 77

<211> LENGTH: 1270

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 77

Asp Thr Pro Ser Val Asp Ser Gly Ser Gly Thr Leu Pro Glu Val Lys

1 5 10 15

Pro Asp Pro Thr Pro Thr Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp

20 25 30

Pro Glu Pro Thr Pro Asp Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu

35 40 45

Pro Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly

50 55 60

Gly Ser Gln Arg Val Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp

65 70 75 80

Gly Phe Thr Phe Thr Pro Gly Asn Thr Val Ser Cys Val Val Gly Ser

85 90 95

Thr Thr Ile Ala Thr Phe Asn Thr Gln Ser Glu Ala Ala Arg Ser Leu

100 105 110

Arg Ala Val Asp Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu

115 120 125

Ala Asn Ser Glu Asn Lys Lys Thr Asn Ala Ile Ser Leu Val Thr Ser

130 135 140

Ser Asp Ser Cys Pro Ala Asp Ala Glu Gln Leu Cys Leu Thr Phe Ser

145 150 155 160

Ser Val Val Asp Arg Ala Arg Phe Glu Lys Leu Tyr Lys Gln Ile Asp

165 170 175

Leu Ala Thr Asp Asn Phe Ser Lys Leu Val Asn Glu Glu Val Glu Asn

180 185 190

Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Thr Val Val

195 200 205

Pro Val Thr Thr Glu Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val

210 215 220

Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile

225 230 235 240

Leu Ser Glu Gly Gln Leu Val Asp Ser Leu Gly Asn Gly Val Ala Gly

245 250 255

Val Asp Tyr Tyr Thr Asn Ser Gly Arg Gly Val Thr Asp Glu Asn Gly

260 265 270

Lys Phe Ser Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr

275 280 285

Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr

290 295 300

Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His

305 310 315 320

Arg Tyr Ser Thr Thr Gly Gln Asn Asn Thr Arg Val Val Pro Asp Asp

325 330 335

Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile

340 345 350

Asn Leu Ser Leu Ser Asn Gly Ala Thr Leu Asp Glu Gly Asp Gln Asn

355 360 365

Val Val Leu Pro Asn Glu Phe Ile Glu Gln Phe Lys Thr Gly Gln Ala

370 375 380

Lys Glu Ile Asp Thr Ala Ile Cys Ala Lys Thr Asp Gly Cys Asn Glu

385 390 395 400

Ala Arg Trp Phe Ser Leu Thr Thr Arg Asn Val Asn Asp Gly Gln Ile

405 410 415

Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Thr Asn Tyr Gln Ser

420 425 430

Val Ser Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser

435 440 445

Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ser Ala

450 455 460

Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe

465 470 475 480

Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu

485 490 495

Ala Pro Ser Ile Val Gln Pro Glu Asn Val Thr Arg Asp Thr Ala Thr

500 505 510

Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu

515 520 525

Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn

530 535 540

Gly Tyr Ser Trp Gly Gly Gly Val Asn Ser Lys Gly Glu Cys Thr Leu

545 550 555 560

Ser Gly Asp Ser Asp Asp Met Lys His Phe Met Gln Asn Val Leu Arg

565 570 575

Tyr Leu Ser Asn Asp Ile Trp Gln Pro Asn Thr Lys Ser Ile Met Thr

580 585 590

Val Gly Thr Asn Leu Glu Asn Val Tyr Phe Lys Lys Ala Gly Gln Val

595 600 605

Leu Gly Asn Ser Ala Pro Phe Ala Phe His Glu Asp Phe Thr Gly Ile

610 615 620

Thr Val Lys Gln Leu Thr Ser Tyr Gly Asp Leu Asn Pro Glu Glu Ile

625 630 635 640

Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Trp Ser Gly

645 650 655

Asp Pro Tyr Ala Val Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu

660 665 670

Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly

675 680 685

Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser

690 695 700

Ala Ser Ser Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala

705 710 715 720

Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asp Arg

725 730 735

Val Arg Gln Arg Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro

740 745 750

Ala Ala Asp Gly Ala Gln Pro Pro Tyr Thr Ile Asp Pro Asn Thr Gly

755 760 765

Glu Val Thr Trp Lys Tyr Gln Gln Asp Asn Lys Pro Asp Asp Lys Pro

770 775 780

Lys Leu Glu Val Ala Ser Trp Gln Glu Glu Val Glu Gly Lys Gln Val

785 790 795 800

Thr Arg Tyr Ala Phe Ile Asp Glu Ala Glu Tyr Thr Thr Glu Glu Ser

805 810 815

Leu Glu Ala Ala Lys Ala Lys Ile Phe Glu Lys Phe Pro Gly Leu Gln

820 825 830

Glu Cys Lys Asp Ser Thr Tyr His Tyr Glu Ile Asn Cys Leu Glu Arg

835 840 845

Arg Pro Gly Thr Asp Val Pro Val Thr Gly Gly Met Tyr Val Pro Arg

850 855 860

Tyr Thr Gln Leu Asn Leu Asp Ala Asp Thr Ala Lys Ala Met Val Gln

865 870 875 880

Ala Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu

885 890 895

Tyr Phe Arg Thr Lys Gly Ser Lys Gly Glu Arg Leu Asn Ser Val Asp

900 905 910

Leu Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Asp Thr

915 920 925

Lys Tyr Arg Tyr Glu Glu Gly Lys Glu Asp Glu Leu Gly Phe Lys Thr

930 935 940

Phe Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Ala Gly Gly

945 950 955 960

Thr Lys Cys Ser Ala Asp Leu Lys Lys Ser Leu Val Asp Asn Asn Met

965 970 975

Ile Tyr Gly Asp Gly Ser Ser Lys Ala Gly Met Met Asn Pro Ser Tyr

980 985 990

Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg

995 1000 1005

Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly

1010 1015 1020

Ser Val Ser Ala Lys Gly Glu Ser Val Thr Glu Asn Ile Ser Leu Tyr

1025 1030 1035 1040

Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu

1045 1050 1055

Trp Ala Pro Ala Gln Gln Asp Val Thr Ile Lys Ser Ser Ala Ser Val

1060 1065 1070

Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu

1075 1080 1085

Lys His Glu Val Ala Leu Asn Arg Pro Pro Arg Val Thr Lys Thr Tyr

1090 1095 1100

Thr Leu Glu Ala Asn Gly Glu Val Thr Phe Lys Val Pro Tyr Gly Gly

1105 1110 1115 1120

Leu Ile Tyr Ile Lys Gly Asp Ser Lys Asp Asp Val Ser Ala Asn Phe

1125 1130 1135

Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Glu Trp

1140 1145 1150

Lys Asn Asp Leu Asp Ser Pro Ala Pro Leu Gly Glu Leu Glu Ser Ala

1155 1160 1165

Ser Phe Val Tyr Thr Thr Pro Lys Lys Asn Leu Glu Ala Ser Asn Phe

1170 1175 1180

Thr Gly Gly Val Ala Glu Phe Ala Lys Asp Leu Asp Thr Phe Ala Ser

1185 1190 1195 1200

Ser Met Asn Asp Phe Tyr Gly Arg Asn Asp Glu Asp Gly Lys His Arg

1205 1210 1215

Met Phe Thr Tyr Lys Asn Leu Thr Gly His Lys His Arg Phe Thr Asn

1220 1225 1230

Asp Val Gln Ile Ser Ile Gly Asp Ala His Ser Gly Tyr Pro Val Met

1235 1240 1245

Asn Ser Ser Phe Ser Thr Asn Ser Thr Thr Leu Pro Thr Thr Pro Leu

1250 1255 1260

Asn Asp Trp Leu Ile Trp

1265 1270

<210> SEQ ID NO 78

<211> LENGTH: 1270

<212> TYPE: PRT

<213> ORGANISM: Escherichia coli

<400> SEQUENCE: 78

Thr Pro Pro Val Asp Ser Gly Thr Gly Ser Leu Pro Glu Val Lys Pro

1 5 10 15

Asp Pro Thr Pro Asn Pro Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro

20 25 30

Glu Pro Thr Pro Glu Pro Thr Pro Asp Pro Glu Pro Thr Pro Glu Pro

35 40 45

Glu Pro Glu Pro Val Pro Thr Lys Thr Gly Tyr Leu Thr Leu Gly Gly

50 55 60

Ser Gln Arg Ile Thr Gly Ala Thr Cys Asn Gly Glu Ser Ser Asp Gly

65 70 75 80

Phe Thr Phe Thr Pro Gly Asp Lys Val Thr Cys Val Ala Gly Asn Asn

85 90 95

Thr Thr Ile Ala Thr Phe Asp Thr Gln Ser Glu Ala Ala Arg Ser Leu

100 105 110

Arg Ala Val Glu Lys Val Ser Phe Ser Leu Glu Asp Ala Gln Glu Leu

115 120 125

Ala Ala Ser Asp Asp Lys Lys Ser Asn Ala Val Ser Leu Val Thr Ser

130 135 140

Ser Asn Ser Cys Pro Ala Asn Thr Glu Gln Val Cys Leu Thr Phe Ser

145 150 155 160

Ser Val Ile Glu Ser Lys Arg Phe Asp Ser Leu Tyr Lys Gln Ile Asp

165 170 175

Leu Ala Pro Glu Glu Phe Lys Lys Leu Val Asn Glu Glu Val Glu Asn

180 185 190

Asn Ala Ala Thr Asp Lys Ala Pro Ser Thr His Thr Ser Pro Val Val

195 200 205

Pro Val Thr Thr Pro Gly Thr Lys Pro Asp Leu Asn Ala Ser Phe Val

210 215 220

Ser Ala Asn Ala Glu Gln Phe Tyr Gln Tyr Gln Pro Thr Glu Ile Ile

225 230 235 240

Leu Ser Glu Gly Arg Leu Val Asp Ser Met Gly Asn Gly Val Val Gly

245 250 255

Val Asn Tyr Tyr Thr Ser Ser Gly Arg Gly Val Thr Gly Glu Asn Gly

260 265 270

Lys Phe Asn Phe Ser Trp Gly Glu Thr Ile Ser Phe Gly Ile Asp Thr

275 280 285

Phe Glu Leu Gly Ser Val Arg Gly Asn Lys Ser Thr Ile Ala Leu Thr

290 295 300

Glu Leu Gly Asp Glu Val Arg Gly Ala Asn Ile Asp Gln Leu Ile His

305 310 315 320

Arg Tyr Ser Gln Ala Gly Lys Asn Asp Glu Arg Glu Val Pro Asp Val

325 330 335

Val Arg Lys Val Phe Ala Glu Tyr Pro Asn Val Ile Asn Glu Ile Ile

340 345 350

Asn Leu Ser Leu Ser Asn Gly Glu Ala Leu Ser Glu Gly Asp Gln Thr

355 360 365

Phe Glu Arg Thr Asn Glu Phe Leu Glu Gln Phe Glu Ser Gly Gln Ala

370 375 380

Lys Glu Ile Asp Thr Ala Ile Cys Asp Ser Leu Gly Gly Cys Asn Ser

385 390 395 400

Gln Arg Trp Phe Ser Leu Thr Ala Arg Asn Val Asn Glu Gly Gln Ile

405 410 415

Gln Gly Val Ile Asn Lys Leu Trp Gly Val Asp Lys Asp Tyr Lys Ser

420 425 430

Val Thr Lys Phe His Val Phe His Asp Ser Thr Asn Phe Tyr Gly Ser

435 440 445

Thr Gly Asn Ala Arg Gly Gln Ala Val Val Asn Ile Ser Asn Ala Ala

450 455 460

Phe Pro Ile Leu Met Ala Arg Asn Asp Lys Asn Tyr Trp Leu Ala Phe

465 470 475 480

Gly Glu Lys Arg Ala Trp Asp Lys Asn Glu Leu Ala Tyr Ile Thr Glu

485 490 495

Ala Pro Ser Leu Val Glu Pro Glu Asn Val Thr Arg Asp Thr Ala Thr

500 505 510

Phe Asn Leu Pro Phe Ile Ser Leu Gly Gln Val Gly Glu Gly Lys Leu

515 520 525

Met Val Ile Gly Asn Pro His Tyr Asn Ser Ile Leu Arg Cys Pro Asn

530 535 540

Gly Tyr Ser Trp Glu Gly Gly Val Asp Lys Asn Gly Gln Cys Thr Arg

545 550 555 560

Asn Ser Asp Ser Asn Asp Met Lys His Phe Met Gln Asn Val Leu Arg

565 570 575

Tyr Leu Ser Asp Asp Lys Trp Thr Pro Asp Ala Lys Ala Ser Met Thr

580 585 590

Val Gly Thr Asn Leu Asp Thr Val Tyr Phe Lys Arg His Gly Gln Val

595 600 605

Thr Gly Asn Ser Ala Glu Phe Gly Phe His Pro Asp Phe Ala Gly Ile

610 615 620

Ser Val Glu His Leu Ser Ser Tyr Gly Asp Leu Asp Pro Gln Glu Met

625 630 635 640

Pro Leu Leu Ile Leu Asn Gly Phe Glu Tyr Val Thr Gln Val Gly Asn

645 650 655

Asp Pro Tyr Ala Ile Pro Leu Arg Ala Asp Thr Ser Lys Pro Lys Leu

660 665 670

Thr Gln Gln Asp Val Thr Asp Leu Ile Ala Tyr Leu Asn Lys Gly Gly

675 680 685

Ser Val Leu Ile Met Glu Asn Val Met Ser Asn Leu Lys Glu Glu Ser

690 695 700

Ala Ser Gly Phe Val Arg Leu Leu Asp Ala Ala Gly Leu Ser Met Ala

705 710 715 720

Leu Asn Lys Ser Val Val Asn Asn Asp Pro Gln Gly Tyr Pro Asn Arg

725 730 735

Val Arg Gln Gln Arg Ala Thr Gly Ile Trp Val Tyr Glu Arg Tyr Pro

740 745 750

Ala Val Asp Gly Ala Leu Pro Tyr Thr Ile Asp Ser Lys Thr Gly Glu

755 760 765

Val Lys Trp Lys Tyr Gln Val Glu Asn Lys Pro Asp Asp Lys Pro Lys

770 775 780

Leu Glu Val Ala Ser Trp Leu Glu Asp Val Asp Gly Lys Gln Glu Thr

785 790 795 800

Arg Tyr Ala Phe Ile Asp Glu Ala Asp His Lys Thr Glu Asp Ser Leu

805 810 815

Lys Ala Ala Lys Ala Lys Ile Phe Glu Lys Phe Pro Gly Leu Lys Glu

820 825 830

Cys Lys Asp Pro Thr Tyr His Tyr Glu Val Asn Cys Leu Glu Tyr Arg

835 840 845

Pro Gly Thr Gly Val Pro Val Thr Gly Gly Met Tyr Val Pro Gln Tyr

850 855 860

Thr Gln Leu Ser Leu Asn Ala Asp Thr Ala Lys Ala Met Val Gln Ala

865 870 875 880

Ala Asp Leu Gly Thr Asn Ile Gln Arg Leu Tyr Gln His Glu Leu Tyr

885 890 895

Phe Arg Thr Asn Gly Arg Lys Gly Glu Arg Leu Ser Ser Val Asp Leu

900 905 910

Glu Arg Leu Tyr Gln Asn Met Ser Val Trp Leu Trp Asn Lys Ile Glu

915 920 925

Tyr Arg Tyr Glu Asn Asp Lys Asp Asp Glu Leu Gly Phe Lys Thr Phe

930 935 940

Thr Glu Phe Leu Asn Cys Tyr Ala Asn Asp Ala Tyr Thr Gly Gly Thr

945 950 955 960

Gln Cys Ser Asp Glu Leu Lys Lys Ser Leu Val Asp Asn Asn Met Ile

965 970 975

Tyr Gly Glu Lys Ser Val Asn Lys Ala Gly Met Met Asn Pro Ser Tyr

980 985 990

Pro Leu Asn Tyr Met Glu Lys Pro Leu Thr Arg Leu Met Leu Gly Arg

995 1000 1005

Ser Trp Trp Asp Leu Asn Ile Lys Val Asp Val Glu Lys Tyr Pro Gly

1010 1015 1020

Ala Val Ser Ala Glu Gly Glu Lys Val Thr Glu Thr Ile Ser Leu Tyr

1025 1030 1035 1040

Ser Asn Pro Thr Lys Trp Phe Ala Gly Asn Met Gln Ser Thr Gly Leu

1045 1050 1055

Trp Ala Pro Ala Gln Lys Glu Val Thr Ile Glu Ser Ser Ala Ser Val

1060 1065 1070

Pro Val Thr Val Thr Val Ala Leu Ala Asp Asp Leu Thr Gly Arg Glu

1075 1080 1085

Lys His Glu Val Ala Leu Asn Arg Pro Pro Lys Val Thr Lys Thr Tyr

1090 1095 1100

Glu Leu Lys Ala Asn Gly Glu Val Lys Phe Thr Val Pro Tyr Gly Gly

1105 1110 1115 1120

Leu Ile Tyr Ile Lys Gly Asn Ser Pro Gln Asn Glu Ser Ala Glu Phe

1125 1130 1135

Thr Phe Thr Gly Val Val Lys Ala Pro Phe Tyr Lys Asp Gly Ala Trp

1140 1145 1150