Great research starts with great data.

Learn More
More >
Patent Analysis of

Chiral nucleic acid adjuvant having antitumor effect and antitumor agent

Updated Time 12 June 2019

Patent Registration Data

Publication Number

US10149905

Application Number

US15/111798

Application Date

14 January 2015

Publication Date

11 December 2018

Current Assignee

WAVE LIFE SCIENCES JAPAN, INC.

Original Assignee (Applicant)

SHIN NIPPON BIOMEDICAL LABORATORIES, LTD.,WAVE LIFE SCIENCES JAPAN, INC

International Classification

C12N15/117,A61K39/39,A61K31/7088,A61K39/00

Cooperative Classification

A61K39/39,A61K31/7088,C12N15/117,A61K2039/55561,C12N2320/31

Inventor

GEMBA, TAKEFUMI,NAGATA, RYOICHI,TORIKAI, YUSUKE

Patent Images

This patent contains figures and images illustrating the invention and its embodiment.

US10149905 Chiral nucleic acid adjuvant 1 US10149905 Chiral nucleic acid adjuvant 2 US10149905 Chiral nucleic acid adjuvant 3
See all images <>

Abstract

Summary

Problem

The purpose of the present invention is to provide: a chiral nucleic acid adjuvant having anti-tumor activity; and an anti-tumor agent.

Solution

The present invention relates to an adjuvant for anti-tumor agent, wherein the adjuvant comprises oligonucleotides which comprise two to four CpG motif each represented by 5′-X1CpGX2-3′ and has a length of 14 to 32 nucleotides, wherein a nucleic acid at 3′ end side of at least two CpG motifs is connected by phosphorothioate linkage,

wherein each nucleic acid at 3′ end and 5′ end of the oligonucleotide is S type nucleic acid connected by phosphorothioate linkage, and wherein the oligonucleotide comprises at least one nucleic acid without phosphorothioate modification. The present invention relates to an anti-tumor agent containing its adjuvant.

Read more

Claims

1. An adjuvant comprising an oligonucleotide which comprises two to four CpG motifs each represented by 5′-X1CpGX2-3′ and has a length of 14 to 32 nucleotides,

wherein each CpG is a non-methylated CpG without a modified phosphate backbone; wherein the X1 is A; wherein the X2 is T; wherein the 3′ end side of at least two CpG motifs are independently connected to a nucleic acid moiety comprising a phosphorothioate linkage, wherein linkages at both the 3′ end and the 5′ end of the oligonucleotide are S type phosphorothioate linkages; wherein the oligonucleotide comprises at least one linkage that is not a phosphorothioate linkage outside of the CpG motif; and wherein the oligonucleotide comprises a 5′-ACpGTTSPTSP-3′ motif, wherein each SP represents an S type phosphorothioate linkage.

2. An agent which comprises the adjuvant of claim 1.

3. A method for treating a tumor, comprising administering to a subject suffering therefrom an adjuvant comprising an oligonucleotide which comprises two to four CpG motifs each represented by 5′-X1CpGX2-3′ and has a length of 14 to 32 nucleotides,

wherein each CpG is a non-methylated CpG without a modified phosphate backbone; wherein the X1 is A; wherein the X2 is T; wherein the 3′ end side of at least two CpG motifs are independently connected to a nucleic acid moiety comprising a phosphorothioate linkage, wherein linkages at both the 3′ end and the 5′ end of the oligonucleotide are S type phosphorothioate linkages; wherein the oligonucleotide comprises at least one linkage that is not a phosphorothioate linkage outside of the CpG motif; and wherein the oligonucleotide comprises a 5′-ACpGTTSPTSP-3′ motif, wherein each SP represents an S type phosphorothioate linkage.

4. A method for treating a tumor, comprising administering to a subject suffering therefrom an agent of claim 2.

Read more

Claim Tree

  • 1
    1. An adjuvant comprising
    • an oligonucleotide which comprises two to four CpG motifs each represented by 5′-X1CpGX2-3′ and has a length of 14 to 32 nucleotides, wherein each CpG is a non-methylated CpG without a modified phosphate backbone
    • wherein the X1 is A
    • wherein the X2 is T
    • wherein the 3′ end side of at least two CpG motifs are independently connected to a nucleic acid moiety comprising a phosphorothioate linkage, wherein linkages at both the 3′ end and the 5′ end of the oligonucleotide are S type phosphorothioate linkages
    • wherein the oligonucleotide comprises at least one linkage that is not a phosphorothioate linkage outside of the CpG motif
    • and wherein the oligonucleotide comprises a 5′-ACpGTTSPTSP-3′ motif, wherein each SP represents an S type phosphorothioate linkage.
  • 2
    2. An agent which comprises
    • the adjuvant of claim 1.
  • 3
    3. A method for treating a tumor, comprising
    • administering to a subject suffering therefrom an adjuvant comprising an oligonucleotide which comprises two to four CpG motifs each represented by 5′-X1CpGX2-3′ and has a length of 14 to 32 nucleotides, wherein each CpG is a non-methylated CpG without a modified phosphate backbone
    • wherein the X1 is A
    • wherein the X2 is T
    • wherein the 3′ end side of at least two CpG motifs are independently connected to a nucleic acid moiety comprising a phosphorothioate linkage, wherein linkages at both the 3′ end and the 5′ end of the oligonucleotide are S type phosphorothioate linkages
    • wherein the oligonucleotide comprises at least one linkage that is not a phosphorothioate linkage outside of the CpG motif
    • and wherein the oligonucleotide comprises a 5′-ACpGTTSPTSP-3′ motif, wherein each SP represents an S type phosphorothioate linkage.
  • 4
    4. A method for treating a tumor, comprising
    • administering to a subject suffering therefrom an agent of claim 2.
See all independent claims <>

Description

FIELD OF THE INVENTION

This invention is directed to a chiral nucleic acid adjuvant which has anti-tumor activity and an anti-tumor agent (a therapeutic agent or prophylactic agent for tumor). In more detail, this invention is directed to an adjuvant for anti-tumor agent comprising CpG oligonucleotides having PS and PO structures.

BACKGROUND OF THE INVENTION

JP 2002-513763 T (Patent Literature 1), JP 2002-154397 A (Patent Literature 2), JP 2002-521489 T (Patent Literature 3) disclose CpG oligonucleotide and the method of manufacturing them.

JP 2010-504750 T (Patent Literature 4) discloses that oligonucleotides, which have lipophilic substituted nucleotide analogues out of CpG motif, cause production of interferon-α (IFN-α).

Following Non Patent Literature 1 discloses that the S-form stereoisomer of CpG oligonucleotide trimer promotes MAPK signal.

Following Non Patent Literature 2 discloses PF-3512676 (Sequence No. 119), all parts of the sequence are phosphorothioated and S-form stereoisomer. Natural oligonucleic acid is readily reduced in vivo. Whereas, that are changed phosphodiester of oligo nucleic acid (P—O bond) to phosphoric acid thioester bond (P—S bond), P—S modifications are difficult to be reduced in vivo.

The following Non-Patent Literature 3 discloses that the CpG oligonucleotide (oligonucleotide having a CpG sequence) activates Th1 immune path through the Toll-like receptor (TLR9). CpG oligonucleotides can be classified into three types: class A-C. In CpG oligonucleotides classified as class A, the 3′ and 5′-phosphate-binding site of the end of 1-4 bases are phosphorothioate linkages (PS-binding), shows a strong IFN-α production inducing ability. However, its effects on B cell proliferation is weak. On the other hand, CpG oligonucleotides are classified as class B and C, all the phosphate binding sites are of S, shows a strong B-cell proliferation effect. However, its IFN-α production inducing ability is not so strong. Natural oligonucleic acid consist of phosphodiester bonds (PO bond) is readily reduced in vivo.

The following non-patent literature 4 discloses the anti-tumor activity of A-class and B-class CpG oligonucleotide.

Both Class CpG oligonucleotide showed anti-tumor activity when they were administered in combination with cancer antigens. However, there was no effect when administered oligonucleotides alone. In order to express the activity, they should be administered as liposome formulations to prevent degradation in vivo.

The following patent literature 5 discloses a pharmaceutical composition for the tumor treatment including an adjuvant. The following patent literature 6 discloses a anti-tumor agent which comprises an adjuvant consist of a CpG oligonucleotide and comprises an oligonucleotide as an effective ingredient.

CITATION LIST

Patent Literature

  • [Patent Literature 1] JP 2002-513763 A
  • [Patent Literature 2] JP 2002-154397 A
  • [Patent Literature 3] JP 2002-521489 A
  • [Patent Literature 4] JP 2010-504750 A
  • [Patent Literature 5] JP 3044009
  • [Patent Literature 6] JP 4977035

Non Patent Literature

  • [Non Patent Literature 1] Authur M. Krieg et al. OLIGONUCLROTIDES 13: pp. 491-499 (2003)
  • [Non Patent Literature 2] Clin Cancer Res. 2008 Jul. 15; 14(14):4532-42.
  • [Non Patent Literature 3] Krieg, Am., J Clin Invest (2007)117:1184-1194.
  • [Non Patent Literature 4] Pedro Berraondo et al. Cancer Res 67: pp. 8847-8855(2007).

SUMMARY OF INVENTION

Technical Problem

For example, all of the sequence of the CpG oligonucleotide disclosed in Non Patent Literature 2 are phosphorothioated (PS bond). Therefore CpG oligonucleotides disclosed in Non Patent Literature 2 have problems that they induce inflammation and toxic reaction. When the phosphorothioate backbone modification is removed from the CpG oligonucleotides disclosed in Non Patent Literature 2, the stability of the nucleotide decreases. In addition, there is a problem that Natural CpG oligonucleotides also readily reduced in vivo.

In the anti-tumor agent disclosed in the Patent Literatures 5 and 6, the adjuvant having strong anti-tumor activity is used to enhance the curative effect for tumor. Further, it may be possible to improve tumor in patients unable to improve tumor by active ingredients such as a chemotherapeutic agent or the cancer antigen vaccine.

One object of the present invention is to provide an adjuvant comprising a stable CpG oligonucleotide having anti-tumor activity.

Other object of the present invention is to provide an anti-tumor agent comprising a stable CpG oligonucleotide. In particular, one object of the present invention is to provide an adjuvant for anti-tumor agent comprising a stable CpG oligonucleotide having anti-tumor activity.

Means for Achieving the Object

This invention is basically based on the following new finding. It is possible to enhance in-vivo stability of the oligo nucleic acid by controlling the molecular conformation of the oligo nucleic acid. Because of it, it becomes possible to provide a stable oligonucleotide in vivo, without introducing the PS bond to all of the sequences. Because not all of the sequences have PS binding modification, the oligonucleotide of the present invention has excellent biocompatibility. In addition, as shown in the working examples below, the oligonucleotide of the present invention also has anti-tumor activity.

The first aspect of the invention relates to an adjuvant for anti-tumor agent, wherein the adjuvant comprises oligonucleotides which comprise two to four CpG motif each represented by 5′-X1CpGX2-3′ and has a length of 14 to 32 nucleotides, wherein the CpG is non-methylated CpG without modified phosphate backbones, wherein the X1 is A or T, wherein the X2 is A or T, wherein a nucleic acid at 3′ end side of at least two CpG motifs is connected by phosphorothioate linkage, wherein each nucleic acid at 3′ end and 5′ end of the oligonucleotide is S type nucleic acid connected by phosphorothioate linkage, and wherein the oligonucleotide comprises at least one nucleic acid without phosphorothioate modification. It is preferred that nucleic acids without modified phosphate backbones is present on the part besides CpG motifs.

The adjuvant for anti-tumor agent is an adjuvant used in an anti-tumor agent.

In preferred examples of the adjuvant of the present invention, X1 is A, X2 is T. Then, the nucleic acid with phosphorothioate bond is a first S-form T having phosphorothioate bond. That is, in the adjuvant of the present invention, a nucleic acid at 3′ end side of at least two CpG motifs is connected by phosphorothioate linkage. In the preferred example, TSP (TSP represents T with phosphorothioate bond) is present adjacent to the 5′-ACpGT-3.

More preferred example of the adjuvants of the present invention is an adjuvant that has a further second S-form T adjacent to the first S-form T (5′-ACpGTTSPTSP-3). Furthermore, an adjuvant that has a third S-form T adjacent to the second S-form T (5′-ACpGTTSPTSPTSP-3) is also preferred.

In the adjuvant of the present invention, it is preferred that the nucleic acid base of 5′ terminal is the S-form nucleic acid base with phosphorothioate bond. Furthermore, in the adjuvant of the present invention, it is preferred that the nucleic acid base of 3′ terminal is the S-form nucleic acid base with phosphorothioate bond.

The preferred examples of the adjuvant of the present invention are adjuvants comprising an oligonucleotide having the nucleotide sequence represented by SEQ ID NO: 4, 6, 26, 33, 42, 43, 49-51, 56-58, 60-63, 74, 78-80, 82, 83, 85-96, 98, 99, 101-106, 108, 109 or 111-118.

The oligonucleotide of this invention is preferred to include any of the following sequences or be an oligonucleotide consisting of any of the following sequences.


TABLE 1-1
Seq.
No.
Sequence (5′→3′)
4
T*C*AACGTT*T*C*AACGTT*T*T*G*G
6
T*C*AACGTT*T*C*AACGTT*G*G*G*G
26
T*C*GACGTT*T*T*GACGTT*T*T*GACGTT*T*T*G*A*C*G*
G*G
33
T*C*GACGTT*T*T*GACGTT*T*T*GACGG*G*G*G*G
42
G*G*GACGATATCGTCG*G*G*G*G*G
43
G*G*GACGACGTCGTCG*G*G*G*G*G
49
T*C*ATCGAT*T*T*ATCGAT*T*T*A*A*C*G*G*G
50
T*C*GACGTTTTGACGTT*T*T*G*A*C*G*G*G
51
T*C*GACGTTTTGACGTTTTGACGGG
56
T*C*GACGT*T*GACGT*T*G*A*C*G*G*G
57
T*C*ATCGATATCGA*T*G*A*C*G*G*G
58
T*C*GACGTTGACGT*T*G*A*C*G*G*G
60
T*C*GACGTT*T*T*GACGT*T*T*T*G*G*G*G*G
61
T*C*GACGTT*T*T*GAGGT*T*T*T*G*A*G*G*G*G
62
T*C*GACGTT*T*T*GACGT*T*T*T*G*T*G*G*G*G
63
T*C*G*ACGTTGACGTTGACGGG
78
T*C*G*ACGTTT*T*G*ACGTT*T*T*G*A*C*G*G*G
79
T*C*G*ACGTT*T*T*T*A*ACGAC*T*T*G*A*C*G*G*G
80
T*C*G*ACGTTT*T*AACGAC*T*T*G*A*C*G*G*G
82
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGA*T*G*G*G
83
T*C*ATCGAT*T*T*ATCGAT*T*T*AT*C*G*G*G
85
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*T*T*A*T*C*G*
G*G


TABLE 1-2
86
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*A*T*C*G*G*G
87
T*T*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*G*G
88
T*C*ATCGATATCGAT*T*T*G*A*C*G*G*G
89
TCATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G
90
T*C*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*A*T
91
T*C*GACGTTGACGTTGACGTTGGG
92
T*C*G*ACGTTGACGTTGACGGG
93
T*C*A*TCGAT*T*T*A*TCGAT*T*T*G*A*C*G*G*G
94
T*C*A*TCGAT*A*TCGAT*G*ACGT*T*T*G*G*G
95
T*C*GACGTTTGACGTTT*G*A*C*G*G*G
96
T*C*ATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G
98
G*G*GACGAC*G*TCGTCG*G*G*G*G*G
99
G*G*GACGACGTCGTCG*G*G*G*G
101
T*C*GACGACGTCGTCT*T*T*G*G*G
102
T*A*GACGACGTCGTCT*T*T*G*G*G
103
T*T*GACGACGTCGTCA*A*A*G*G*G
104
T*C*GACGTAGACGTCT*T*T*G*G*G
105
T*C*GACGTAGACGTTT*A*G*G*G*G
106
T*C*ATCGATATCGATT*T*T*G*G*G
108
T*C*GACGTAGACGATCGATGGG
109
T*C*GACGAC*T*T*GACGAC*T*T*G*A*C*G*G*G
111
T*T*ATCGATATCGATA*T*C*G*A*T*G*G*G
112
T*T*ATCGATATCGATT*T*A*A*A*G*G*G
113
T*C*ATCGATTTATCGATTTGACGTT
114
T*C*ATCGA*T*ATCGA*T*G*A*C*G*G*G*G
115
T*C*ATCGATATCGATGGG
116
T*C*GTCGTTGTCGT*T*G*A*C*G*G*G
117
T*C*G*TCGTT*T*T*G*TCGTT*T*T*G*A*C*G*G*G
118
T*C*GTCGTTGTCGTTG*A*C*G*A*C*G*G*G

In above formula * indicates the stereoisomer caused by phosphate backbone modification by sulfur atoms. In each sequence above, at least one of the * is S-form stereoisomer.

The preferred examples of adjuvant of the present invention are the oligonucleotides that have immunity-inducing activity and comprise oligonucleotides that represented by SEQ ID NO: 56, 57, 82, 103 or 109, or that one or two bases are substituted from, inserted to, deleted from or added to oligonucleotides having the nucleotide sequence represented by SEQ ID NO: 56, 57, 82, 103 or 109.

The second aspect of the invention relates to an anti-tumor agent which comprises the adjuvant described above. This anti-tumor agent may comprise any oligonucleotides described above as an active ingredient. This anti-tumor agent may comprise the adjuvant of the present invention with known active ingredient. In this case, This adjuvant sometimes shows the synergistic effect with the active ingredient because the oligonucleotide of the present invention has anti-tumor activity. Further, it may be possible to enhance the immunity-induction in patients unable to enhance the immunity-induction by the active ingredient. t

Effect of the Invention

According to the present invention, it is possible to provide an adjuvant comprising a stable CpG oligonucleotide having anti-tumor activity.

According to the present invention, it is possible to provide an adjuvant for anti-tumor agent comprising a stable CpG oligonucleotide having anti-tumor activity.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a diagram showing the activity of NK cells.

FIG. 2 is a graph showing tumor volume.

FIG. 3 is a graph showing the growth rate of tumors in tumor-bearing mice that have been administered various compounds.

FIG. 4 is a graph showing the survival rate of tumor-bearing mice that have been administered various compounds.

BEST MODE FOR CARRYING OUT THE INVENTION

The following describes embodiments of the present invention. The present invention is not limited to the embodiments described below and includes those that a skilled person in the art will easily modify based on the following embodiments.

“Oligonucleotide” or “oligo” means sugar (e.g. ribose or deoxyribose) binding multiple nucleotides (i.e. Phosphate groups and substituted organic bases (either of substituted pyrimidines (e.g. cytosine (C), thymine (T) or uracil (U)) or substituted purine (e.g. adenine (A) or guanine (G))). As used in this specification, the term “oligonucleotide” means both of oligoribonucleotide (ORN) and oligodeoxyribonucleotide (ODN). The term “oligonucleotide” includes also oligonucleoside (i.e., the oligonucleotide without phosphate) and any other organic base polymer. Oligonucleotides can be obtained from existing nucleic acid sources (e.g. genome or cDNA), but synthetic one (e.g. produced by oligonucleotide synthesis) is preferred.

CpG represents unmethylated CpG without phosphate backbone modification. C is 2′-deoxycytidine. G is 2′-deoxyguanosine. p is a bond between nucleoside with phosphodiester.

The oligonucleotide may have phosphate backbone modification on the part besides the CpG motif consisting of 5′-X1CpG X2-3′. On the other hand, there is the problem previously said on phosphate backbone with phosphorothioate backbone modification between all of nucleotides, it may be preferable that oxygen atoms are replaced by sulfur atoms by more than 20% less than 95%, it may be more than 30% less than 95%, more than 20% less than 90%, more than 40% less than 95%, more than 40% less than 90%, more than 40% less than 80%, more than 50% less than 95%, more than 50% less than 90%, more than 20% less than 80%.

The oligonucleotide of the present invention is preferred to have the following, or comprising any sequence, it is preferable that an oligonucleotide has any of the following sequences.


TABLE 2-1
Seq.
No.
Sequence (5′→3′)
4
T*C*AACGTT*T*C*AACGTT*T*T*G*G
6
T*C*AACGTT*T*C*AAGGTT*G*G*G*G
26
T*C*GACGTT*T*T*GACGTT*T*T*GACGTT*T*T*G*A*C*G*
G*G
33
T*C*GACGTT*T*T*GACGTT*T*T*GACGG*G*G*G*G
42
G*G*GACGATATCGTCG*G*G*G*G*G
43
G*G*GACGACGTCGTCG*G*G*G*G*G
49
T*C*ATCGAT*T*T*ATCGAT*T*T*A*A*C*G*G*G
50
T*C*GACGTTTTGACGTT*T*T*G*A*C*G*G*G
51
T*C*GACGTTTTGACGTTTTGACGGG
56
T*C*GACGT*T*GACGT*T*G*A*C*G*G*G
57
T*C*ATCGATATCGA*T*G*A*C*G*G*G
58
T*C*GACGTTGACGT*T*G*A*C*G*G*G
60
T*C*GACGTT*T*T*GACGT*T*T*T*G*G*G*G*G
61
T*C*GACGTT*T*T*GACGT*T*T*T*G*A*G*G*G*G
62
T*C*GACGTT*T*T*GACGT*T*T*T*G*T*G*G*G*G
63
T*C*G*ACGTTGACGTTGACGGG
78
T*C*G*ACGTTT*T*G*ACGTT*T*T*G*A*C*G*G*G
79
T*C*G*ACGTT*T*T*T*A*ACGAC*T*T*G*A*C*G*G*G
80
T*C*G*ACGTTT*T*AACGAC*T*T*G*A*C*G*G*G
82
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGA*T*G*G*G
83
T*C*ATCGAT*T*T*ATCGAT*T*T*AT*C*G*G*G
85
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*T*T*A*T*C*G*
G*G


TABLE 2-2
86
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*A*T*C*G*G*G
87
T*T*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*G*G
88
T*C*ATCGATATCGAT*T*T*G*A*C*G*G*G
89
TCATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G
90
T*C*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*A*T
91
T*C*GACGTTGACGTTGACGTTGGG
92
T*C*G*ACGTTGACGTTGACGGG
93
T*C*A*TCGAT*T*T*A*TCGAT*T*T*G*A*C*G*G*G
94
T*C*A*TCGAT*A*TCGAT*G*ACGT*T*T*G*G*G
95
T*C*GACGTTTGACGTTT*G*A*C*G*G*G
96
T*C*ATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G
98
G*G*GACGAC*G*TCGTCG*G*G*G*G*G
99
G*G*GACGACGTCGTCG*G*G*G*G
101
T*C*GACGACGTCGTCT*T*T*G*G*G
102
T*A*GACGACGTCGTCT*T*T*G*G*G
103
T*T*GACGACGTCGTCA*A*A*G*G*G
104
T*C*GACGTAGACGTCT*T*T*G*G*G
105
T*C*GACGTAGACGTTT*A*G*G*G*G
106
T*C*ATCGATATCGATT*T*T*G*G*G
108
T*C*GACGTAGACGATCGATGGG
109
T*C*GACGAC*T*T*GACGAC*T*T*G*A*C*G*G*G
111
T*T*ATCGATATCGATA*T*C*G*A*T*G*G*G
112
T*T*ATCGATATCGATT*T*A*A*A*G*G*G
113
T*C*ATCGATTTATCGATTTGACGTT
114
T*C*ATCGA*T*ATCGA*T*G*A*C*G*G*G*G
115
T*C*ATCGATATCGATGGG
116
T*C*GTCGTTGTCGT*T*G*A*C*G*G*G
117
T*C*G*TCGTT*T*T*G*TCGTT*T*T*G*A*C*G*G*G
118
T*C*GTCGTTGTCGTTG*A*C*G*A*C*G*G*G

In above formula * indicates the stereoisomer by phosphate backbone modification. CG of the section corresponding to 5′-X1CpG X2-3 in above formula means unmethylated CpG without phosphate backbone modifications. The examples of phosphate backbone modifications are phosphorothioate backbone modifications, phosphorodithioate backbone modifications, or phosphoroamidate backbone modifications. In these phosphate backbone modifications, phosphorothioate backbone modifications are preferred. phosphorothioate backbone modifications means that converting one of the two nonbridging oxygen atoms bonding to phosphorus atoms comprising phosphodiester bond of neighbor nucleotides into sulfur atoms. At least one of the * is S-form stereoisomer. Here, S-form stereoisomer means, as described above, stereoisomer that takes S-form when their atoms or bases introduced instead of oxygen atoms are sulfur atoms.

The oligonucleotide of the present invention is preferred that it is one of the nucleotides described above, and phosphate backbone modifications which exist in at least one of the sites other than CpG motif are oligonucleotides including phosphorothioate. That is, as explained above, it is preferred that the oligonucleotide has phosphorothioate backbone modification also in the sites other than CpG. In this case, as explained above, S-form stereoisomer is preferred. However, in the present invention, the oligonucleotides with at least one unmodified phosphorothioate backbone is preferred than the oligonucleotides that all parts of the sequence are phosphorothioated.

Synthetic Method of Nucleotides

The synthetic method for nucleotides is publicly known. The nucleotides in present invention can be produced by the publicly known method. For example, it can adopt that the methods disclosed in JP patent No. 450870 and WO 2010/064146 pamphlet.

The other examples of the method for synthesizing nucleotide are introduced in U.S. Pat. No. 4,942,646 official report and U.S. Pat. No. 5,912,332. The latter, the use of the solid support attachment linker to parallel synthesis or generic solid support, such as phosphate salt attaching controlled pore glass.

Furthermore, nucleotide can be produced by the method e.g. disclosed in U.S. Pat. No. 4,383,534 A. For example, It can be produced by β-cyanoethyl phosphoroamidate method (S. L. Beaucage, M. H. Caruthers, Tetrahedron Lett. 1981, 22, 1859-62) and nucleoside H-phosphonate method (Per J. Garegg et al., Tetrahedron Lett. 1986, 27, 4051-4; Brian C. Froehler et al., Nucl Acid Res 1986, 14, 5399-407; Per J. Garegg et al., Tetrahedron Lett. 1988, 27, 4055-8; Barbara L. Gaffney et al., Tetrahedron Lett., 29, 2619-22). These chemicals can be synthesized by a variety of automated nucleic acid synthesizers available in the market. These nucleic acids are called synthetic nucleic acid. Alternatively, it is possible to generate nucleic acids of the present invention on a large scale in a plasmid. (Sambrook T. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989) The nucleic acid of this invention can be separated into smaller pieces or administered whole. The nucleic acid is produced from nucleic acid sequence (e.g. genomic sequence and cDNA sequence) with the use of known techniques (e.g. techniques using restriction enzymes, exonuclease or endonuclease) The nucleic acid that has been prepared in this way is called isolated nucleic acid. An isolated nucleic acid, in general, is a nucleic acid which is separated from components which naturally are normally associated. For example, the isolated nucleic acid is a nucleic acid that is separated from the cells, nucleus, mitochondria and chromatin. The combination motif nucleic acid of the present invention includes both synthesized combination motif nucleic acids and isolated combination motif nucleic acids.

The combination motif oligonucleotides, if necessary, have a relatively resistant to degradation (e.g., are stabilized) are preferred in the use of in vivo. A “stabilized nucleic acid molecule” means a nucleic acid molecule that is relatively resistant for in vivo degradation (e.g., exonuclease or endonuclease). The nucleic acid stabilization is achieved through the phosphate backbone modification. The stabilized nucleic acid that is preferred in the present invention has a modified backbone. This modification of the nucleic acid backbone provides increasing the activity of the combination motif oligonucleotide when administered in vivo. In some cases, the combination motif oligonucleotides with phosphorothioate bond provide maximum activity and protect the nucleic acid from degradation by intracellular exonucleases and cellular endonucleases. Other modified nucleic acids, modified phosphodiester nucleic acids, combinations of phosphodiester nucleic acids and phosphorothioate nucleic acids (i.e. chimeric), methylphosphonate, methylphosphorothioate, phosphorodithioate, p-ethoxy, and combinations thereof mentioned are.

The modified backbones (e.g., phosphorothioates) can be synthesized by using automated techniques employing either phosphoramidate chemistry or H-phosphonate chemistry. Aryl-phosphonate and alkyl-phosphonates can be generated, for example, as described in U.S. Pat. No. 4,469,863. And alkylphosphotriester (charged oxygen is alkylated as described in U.S. Pat. No. 5,023,243 and EP patent No. 092,574) can be produced using commercially available reagents by automated solid-phase synthesis. Methods for making modifications and substitutions of other DNA backbone have been disclosed. (e.g., Uhlmann E and Peyman A, Chem. Rev. 1990, 90, 544; Goodchild J., Bioconjugate Chem. 1990, 1, 165).

The oligonucleotides obtained by synthesis may be purified by known methods, e.g., purified, deprotected, desalted and dialyzed by reversed phase HPLC. In this way, the oligonucleotides of the present invention can be isolated and purified.

This invention provides composition with one of the above oligonucleotides. This composition is a medicine composition. The composition contains an effective amount of any of the oligonucleotides described above and it may contain appropriate known carrier. The carrier may be a solvent such as water or alcohol. The carrier can be optional excipients, diluents, fillers, salts, buffers, stabilizers, solubilizers, lipids or other substance which is well known for medicine compositions in the art.

The adjuvant for an anti-tumor agent is an adjuvant used in an anti-tumor agent. The anti-tumor agent is called as immunity-inducing agent or immune activation agent. The anti-tumor agent means an agent for inducing immune cells which secrete cytokines and the like in response to a certain antigen. The term “anti-tumor activity” means the ability to induce immune cells that secrete cytokines such as interferon in vivo. The examples of anti-tumor agent are agents for activating the induction of immunity against various cancers. The present invention also provides a cancer therapeutic agent or a cancer prophylactic agent. The anti-tumor agent may comprise components having immunity-inducing activity effects as an active ingredient in addition to the adjuvant that described above. Furthermore, the anti-tumor agent may comprise oligonucleotides in the adjuvant described above as an active ingredient.

For example, by using a known ELISPOT assay and the like, it is possible to confirm whether the oligonucleotides have anti-tumor activity.

Specifically, for example, the oligonucleotides to be assessed the anti-tumor activity was administrated to a living organism. Cells such as peripheral blood mononuclear cells was sampled from this organism. Then, the cells were co-cultured with the oligonucleotide. The amount of production of cytokinins in the cell is determined using specific antibodies. In this way, it is possible to measure the number of immune cells in the cells. Therefore, it is possible to assess the anti-tumor activity.

The tumor that is the target of anti-tumor agents include known tumors. The examples of the tumor are long bones of adamantinoma, adenoma, ameloblastoma, astrocytoma, cholangiocarcinoma, bladder cancer, bone cancer, bone marrow cancer, brain cancer, breast cancer, bronchogenic lung cancer, cervical cancer, cervical cancer, chondroma, choriocarcinoma, colon cancer, colorectal cancer, cystic adenocarcinoma, embryonal cancer, endometrial cancer, ependymoma, esophageal cancer, fibroma, follicular thymoma, gallbladder cancer, gastric cancer, glioblastoma, glioma, head and neck cancer, cancer of the heart, hepatocellular carcinoma, cancer in the peritoneal cavity, intestinal cancer, carcinoma of the kidney, larynx cancer, lipoma, liver cancer, lung cancer, cancer of the lymph nodes, cancer of the lymphatic vessels, malignant glioma, mesenthelioma, menigioma, medullary carcinoma, fibroids, neuroblastoma, non-small cell bronchogenic/lung, esophageal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, papillary carcinoma, papillary adenocarcinoma, papillary thymoma, pheochromocytoma, prostate cancer, rectal cancer, kidney cancer, renal cell carcinoma, ureter cancer, abura-sengan, seminoma, skin cancer, small cell lung cancer, small intestine cancer, soft tissue cancer, spleen cancer, squamous cell carcinoma, gastric cancer, teratoma, testicular cancer, testicular cancer, thymoma, thyroid cancer, thyroid tumors and endometrial cancer.

This invention also provides a vaccine adjuvant with oligonucleotide described above. The vaccine adjuvant, if necessary, may contain a pharmaceutically acceptable carrier. JP Patent No. 4126252 discloses vaccine adjuvant with oligonucleotide. The vaccine adjuvant with the oligonucleotide of this invention can include the disclosed elements in this publication properly.

The oligonucleotide of this invention may be formulated as a pharmaceutical composition in a pharmaceutically acceptable carrier. This oligonucleotide may be administrated to a subject directly or with a nucleic acid delivery complex. The nucleic acid delivery complex means a nucleic acid which is associated (e.g., ionic bond or covalent bond, or encapsulated in the way) with a targeting way (e.g., molecules which generate high affinity bond to target cells (e.g., surface of B cell) and/or increase in cellular uptake by target cells.). The examples of the nucleic acid delivery complex are nucleic acid associated with sterols such as cholesterol, lipids (e.g., cationic lipids, virosomes or liposomes) or target cell specific bonding factors (egg, ligands recognized by target cell specific receptor). Preferred complex can be enough stable in vivo to prevent from significant de-coupling before the internalization by the target cell. But the complex can be cleavage under appropriate conditions in the cells so that the nucleic acid is released in a functional form.

This oligonucleotide and/or the antigen and/or other therapeutic agents can be administrated separately (e.g. in saline or buffer solution), and may also be administered using any known delivery vehicles.

Dose of the compounds described herein for mucosal delivery or topical delivery to the tumor is typically in the range of 0.1 μg/dose to 10 mg/dose. The doses depend on whether it is administered daily, weekly, or monthly, and in any other time. More typically, mucosal doses or local doses are in the range of 10 μg/dose to 5 mg/dose. The most typically, it is 100 μg/dose to 1 mg/dose, and the administrations of 2-4 times are performed apart for a few days or a few weeks. More typically, dose is in the range of 1 μg/dose to 10 mg/dose, most typically, in the range of 10 μg dose to 1 mg/dose. Then, the administrations are performed daily or weekly. The dose of the compounds described herein for parenteral delivery in order to induce an anti-tumor response, is typically 5 to 10,000-fold more than effective mucosal dose for vaccine adjuvant or immune stimulating applied. More typically, it is 10 to 1,000-fold greater, and most typically 20 to 100 times greater. In case of that the oligonucleotide is administered in combination with other therapeutic agents or administered using specialized delivery vehicles, the dose of the compounds described herein for parenteral delivery is typically in the range of about 0.1 μg/dose to 10 mg/dose. The doses depend on whether it is administered daily, weekly, or monthly, and in any other time. More typically parenteral doses for these purposes is in the range of about 10 μg/dose to 5 mg/dose. The most typically, it is about 100 μg/dose to 1 mg/dose, and the administrations of 2-4 times are performed apart for a few days or a few weeks. However, in some embodiments, parenteral doses for these purposes may be used in the 5 to 10,000-fold greater range than the typical doses described above.

In the present specification, the term “effective amount” means the required or sufficient amount to achieve the desired biological effect. For example, an effective amount of a chiral nucleic acid for treating an disease means the amount required to treat the disease. Combined with the teachings provided herein, by selecting the various active compounds and weighing factors (For example, potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration), the effective prevention regimen and the effective therapeutic regimen, which are very effective to treat a particular subject without causing substantial toxicity, can be plan. The effective amount for any particular application may vary depending on factors, such as disease or condition being treated, the particular oligonucleotide being administered, antigen, subject size, and the severity of the disease and conditions. A skilled in the art can be empirically determined the effective amount of a particular oligonucleotide and/or antigen and/or other therapeutic agents without the need for undue experiments.

A therapeutically effective amount for any of the compounds described herein can first be determined based on the knowledge obtained in animal experiments. An effective dose for the treatment also can be determined based on the data about the CpG oligonucleotide which has been tested in human (human clinical trials has been started) and the data when the mucosal or local administration of known compounds having similar pharmacological activities [For example, other mucosal adjuvants (for example, LT and other antigens for vaccination)]. For parenteral administration, it is necessary to use higher dose. The applied dose can be adjusted based on the relative bioavailability and potency of the compounds administered. Adjusting the dose to achieve the maximal efficacy using the methods and other methods is well known in the art. In addition, a skilled person can easily adjust the dose.

When administered, formulation of the present invention is dissolved in a pharmaceutically demand solutions. The solution conventionally may include salts of pharmaceutically acceptable concentrations, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.

For use in therapy, the oligonucleotide of the effective amount may be administered to a subject using any manner for delivering the nucleic acids to desired surface (for example, a tumor lesion, a mucosal surface and a systemically surface). Administering the pharmaceutical compositions of this invention may be accomplished by any means known to those skilled in the art. Preferred routes of administration are oral route, parenteral route, intramuscular route, subcutaneous route, intradermal route, intranasal route, the intratracheal route, inhalation routes, ocular route, sublingual, vaginal routes, rectal route, and the like, but not limited those listed herein.

For oral administration, the compounds (i.e., oligonucleotides, antigens, and other therapeutic agents) can be easily prepared by combining the active compound with known pharmaceutically acceptable carriers in the art. Such carriers enable the compounds of the present invention to be formulated as tablets to be taken orally by a subject to be targeted, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like. The pharmaceutical preparations for oral administration may be obtained as solid excipient by adding suitable auxiliaries if necessary, subsequently grounding the resulting mixture and forming the tablet cores or the dragee cores by processing the mixture of granules. In particular, suitable excipients are fillers [for example, sugar (lactose, sucrose, mannitol and sorbitol); cellulose preparations (for example, corn starch, wheat starch, Rice starch, potato starch, gelatin, tragacanth gum, methyl cellulose, hydroxypropyl methyl-cellulose, sodium carboxymethyl-cellulose) and/or polyvinylpyrrolidone (PVP)]. If necessary, the disintegrating agents [for example, cross-linked polyvinyl pyrrolidone, agar, alginic acid or a salt thereof (for example, sodium alginate)] may be added. If necessary, the oral formulations may also be administered in saline or buffer solution to neutralize the acidic internal state. In addition, the oral formulations may be administered without any carriers.

The dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions can be used. If necessary, the concentrated sugar solutions may contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol and/or titanium dioxide, lacquer solutions, suitable organic solvents or solvent mixtures. In order to identify or characterize different combinations of active compound doses, dyestuffs or pigments may be added to the tablets or the dragee coatings.

Examples of pharmaceutical preparations which can be administered orally are a fabricated capsule of gelatin, and a soft sealed capsule made of gelatin and a plasticizer (for example, glycerol or sorbitol). The capsule may contain the active ingredient, if necessary, mixed with fillers (for example, lactose), binders (for example, starch) and/or lubricants (for example, talc or magnesium stearate) and stabilizers. In the soft capsule, the active compounds may be dissolved or suspended in suitable liquids (for example, fatty oils, liquid paraffin, or liquid polyethylene glycol). In addition, the stabilizer may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well known in the art. All formulations for oral administration may be used in appropriate dosage.

For oral administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

For inhalation administration, the compounds of the present invention may be administrated by aerosol spray from pressurized packs or a nebulizer using a suitable propellant (for example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas) as with a conventional usage. When using a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. For use in an inhaler or insufflator, such gelatin capsules and cartridges, which contain a powder mixture of the compound and a suitable powder base, may be provided.

If the compound should be delivered systemically, the compound can be provided in a form that can be administered parenterally by injection (for example, bolus injection or continuous infusion). The formulations for injection may be provided in unit dosage form (for example, an ampoule or multi-dose containers) with preservative agent. The compounds may take such forms as solutions, emulsions or suspension in oily or aqueous vehicles. In addition, they may contain the formulations (for example, suspending agents, stabilizing agents and/or dispersing agents).

Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds which are water soluble. In addition, suspensions of the active compounds may be provided as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils (for example, sesame oil), synthetic fatty acid esters for example, ethyl oleate or triglycerides), or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension (for example, sodium carboxymethyl cellulose, sorbitol, or dextran). In order to prepare highly concentrated solutions, the suspension may also include agents that increase the solubility of the appropriate stabilizers or compounds thereof as necessary.

Alternatively, the active compounds may be in powder form which can be configured prior to use with a suitable vehicle (for example, sterile pyrogen-free water).

The compounds may be provided in the form for rectal or vaginal administration (for example, suppositories or retention enemas which may contain conventional suppository bases such as cocoa butter or other glycerides).

In addition to the above, the compounds may also be provided as a depot preparation. Such long acting formulations may be provided by using a suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil), by using an ion exchange resin or by using poorly soluble derivatives (such as salts poorly soluble).

The pharmaceutical compositions may also include carriers or excipients which is a suitable solid or gel phase. Examples of such carriers or excipients include calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers (for example, polyethylene glycol), but not limited thereto.

Suitable liquid pharmaceutical preparation form or solid pharmaceutical preparation forms are micro-encapsulated, chelated, coated on microscopic gold particles, included in liposomes, contained in the aerosol to be sprayed, included in the pellet for implantation into the skin, dried form in sharp on the object for scratching the skin, aqueous solution for inhalation or saline solution. In addition, the pharmaceutical compositions includes granules, powders, tablets, coated tablets, (micro) capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations, which can release the active compound a long period of time. As described above, the formulations contain the excipients, the additives and/or the adjuvants (for example, disintegrants, binders, coating agents, sweetening agents, lubricants, flavoring agents, sweeteners, or solubilized agents) conventionally. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. Brief review of methods for drug delivery is mentioned in Langer (1990) Science 249: 1527-33 (which is incorporated herein by reference).

The oligonucleotide and that containing other therapeutic agent and/or antigen as necessary may be administered without being any processed, or may be administered in the form of a pharmaceutically acceptable salt. When administered in the form of a pharmaceutically acceptable salt, the salt should be pharmaceutically acceptable. However, the pharmaceutically acceptable salt may be used to prepare the pharmaceutically acceptable salts. Examples of such salts are the followings, but not limited thereto: HCl, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, p-toluene sulfonic acid, salt tartaric acid, citric acid, methane sulfonic acid, formic acid, malonic acid, succinic acid, naphthalene-2-sulfonic acid and benzene sulfonic acid. In addition, such salts may be prepared as alkali metal salts or alkaline earth metal salts (for example, sodium salts of carboxylic acid, potassium salt or calcium salt).

Examples of the suitable buffering agents are followings: acetic acid and its salt (1-2% w/v); citric acid and its salt (1-3% w/v); boric acid and its salt (0.5-2.5% w/v); and phosphoric acid and its salt (0.8-2% w/v). Examples of the suitable preservatives are followings: benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v), and thimerosal (0.004-0.02% w/v).

The pharmaceutical compositions of the present invention may contain an effective amount of the oligonucleotide, the antigen and/or other agents in a pharmaceutically acceptable carrier as necessary. The term “pharmaceutically acceptable carrier” means one or more compatible filler, diluent, or encapsulating agent which is solid or liquid and is suitable for administration to humans or other vertebrates. The term “carrier” means a natural or synthetic, organic or inorganic component which is added to in order to facilitate the application of the active ingredient. Components of the pharmaceutical compositions can be mixed with the compounds of this invention and each component in a manner that the components do not interact with each other.

For the treatment of individual subjects, different capacities of the pharmaceutical compositions of the present invention are required based on activity of the compound, manner of administration, purpose of the immunization (i.e., prophylactic immunization or immunotherapy), the nature and severity of the disorder, the age of the patient and weight of the patient. Administration of a desired dose may be performed by administering an amount corresponding to dosage units at a time or by administering a smaller amount multiple times.

Examples of other delivery systems include time-release system, delayed release system, or sustained release system. Such systems may avoid repeated administrations of the compound, and may increase the convenience to the subject and the physician. Many types of release delivery systems are available, and are known to those skilled in the art. Examples of the release delivery systems include a polymer-based system (for example, poly (lactide-glycolide), copoly oxalate, polycaprolactone, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides). For example, microcapsules of the polymer containing the pharmaceutical compositions are described in U.S. Pat. No. 5,075,109. The delivery systems also include non-polymeric system. Examples of the non-polymeric system are followings: lipids (sterols (for example, cholesterol, cholesterol ester), and fatty acids or natural fats (for example, monoglycerides, diglycerides, and triglycerides) and the like); hydrogel release systems; silastic system; peptide-based systems; wax coating; compressed tablets using conventional binders and excipients; partial fused to the implant. In particular, the system includes the followings, but not limited thereto: (a) an erosion-based system which the agent of the present invention is contained in a form located in the matrix (U.S. Pat. No. 4,452,775, U.S. Pat. No. 4,675,189 and U.S. Pat. No. 5,736,152); (b) a diffusion system which the active ingredient penetrate at a controlled rate from the polymer (U.S. Pat. No. 3,854,480, U.S. Pat. No. 5,133,974 and U.S. Pat. No. 5,407,686). In addition, pump-based hardware delivery systems can be used. Some of them are adapted for implantation.

The invention is further illustrated by the following examples. The following examples are should not be construed as further limiting. Throughout this specification, all of the contents of the cited documents are incorporated herein.

Working Example 1

Synthesis of Chiral CpG Oligonucleic Acid

CpG Oligonucleic Acid (Mixture)

The oligonucleic acid (mixture) which had been synthesized using phosphoramidite method and purified using HPLC were purchased from GeneDesign, Inc.

Synthesis of the CpG oligonucleotide of which the three-dimensional structure is modified.

Extension of nucleic acid chain was performed by repeating the following steps (i)-(iv).

  • (i) 3% DCA (dichloroacetic acid)/CH2Cl2 (15 sec),
  • (ii) Condensation reaction [A mixture of 0.1 M monomer solution in MeCN (See below) and 1 M PhIMT (Trifluoromethanesulfonic acid N-phenylimidazolium) solution in MeCN in ratio 1:1, 5 min],
  • (iii) Capping reaction [A mixture of 0.5 M CF3Colm in THF and 1 M DMAN (1,8-bis(dimethylamino)naphthalene)) in THF in ratio 1:1, 30 sec],
  • (iv) Sulfurization reaction (0.1 M DDTT in MeCN, 90 sec) or oxidization reaction (0.02 M I2 in H2O-Pyridine-THF solution, 15 sec).

After the chain elongation of nucleic acid, a solid phase carrier was collected in 1.5 ml microtube. The solid phase carrier was treated with high concentrated aqueous ammonia (1.2 ml, 55 degrees, 48 hours). The solid phase carrier was removed by filtration. A filtrate was dried in reduced pressure, and dissolved in water (1.0 ml). Then, the oligomer was isolated and purified by using a reversed-phase HPLC.

A procedure for adjusting 0.1 M monomer solution in MeCN (in case of Rp-Th).

Thymidylic acid H-phosphonate monoester (25 μmol) was azeotropic-dried with dehydrated pyridine and dehydrated toluene. it was dissolved in MeCN-CMP (N-Cyanomethylpiperidine) solution (9:1, v/v; 250 μL). Subsequently, Ph3PCl2 (62.5 μmol) was added, and the solution was stirred for 10 min. Then, AA-L (30 μmol; AA-D was used when Sp form was selected.) was added, and the solution was stirred for 10 min. In this way, the monomer solution was obtained.

In the description above, DDTT, AA-L and AA-D mean the abbreviated designation of the following compounds respectively. The obtained oligonucleic acids are shown in Table 1.


TABLE 3
Seq.
No.
Sequence
1
T*C*GTCGTT*T*T*GTCGTT*T*T*GTCGGG
2
G*G*GTCGTT*T*T*GTCGTT*T*T*GTCGGG
3
T*C*AACGTT*T*C*AACGTT*T*T
4
T*C*AACGTT*T*C*AACGTT*T*T*GG
5
T*C*AACGTT*T*C*AACGTT*G*G
6
T*C*AACGTT*T*C*AACGTT*G*G*G*G
7
T*C*AACGTT*T*T*AACGTT*T*T*AACGGG
8
T*C*AACGTT*T*A*ACGTT*T*T
9
T*C*AACGT*TAACGTT*T*T
10
T*C*AACGTT*T*A*AACGTT*T*A*AACGGG
11
T*C*AAGGTTAACCTTAACGGG
12
T*C*GACGTT*T*T*GACGTT*T*T*GACGGG
13
TsCsGACGTTsTsTsGACGTTsTsTsGACGGG
14
TrCrGACGTTrTrTrGACGTTrTrTrGACGGG
15
G*G*GACGT*T*T*TGACGT*T*T*TGACGGGGG
16
T*C*GACGT*T*T*TGACGT*T*T*TGACGT*T*T*TGACGGG
17
T*C*GACGT*T*GACGT*T*GACGGG
18
TsCsGACGTsTsGACGTsTsGACGGG
19
TrCrGACGTrTrGACGTrTrGACGGG
20
T*C*GACGT*T*GACGT*T*GACGT*T*GACGGG
21
T*C*GACGTT*T*A*AACGTT*T*A*AACGTT*T*A*AACGGG
22
T*C*GACGTT*T*A*AACGTT*T*A*GACGTT*T*A*AACGGG
23
T*C*GACGTTAACGTTAACGTTAACGGG
24
GGGACGTT*T*A*AACGTCTAGACGGG
25
T*C*GACGT*ACGT*ACGT*ACGGG
26
T*C*GACGTT*T*T*GACGTT*T*T*G*A*C*G*G*G
27
TsCsGACGTTsTsTsGACGTTsTsTsGsAsCsGsG
28
TrCrGACGTTrTrTrGACGTTrTrTrGrArCrGrGrG
29
T*C*GACGTT*T*T*GACGTT*T*T*GACGG*G*G


TABLE 4
30
T*C*GACGTT*T*T*GACGTT*T*T*GACGT*G*G
31
T*C*GACGTT*T*T*GACGTT*T*T*GACGTG*G*G
32
T*C*GACGTT*T*T*GACGTT*T*T*G*A*C*G*G*G
33
T*C*GACGTT*T*GACGTT*T*T*GACGG*G*G*G*G
34
TsCsGACGTTsTsTsGACGTTsTsTsGACGGsGsGsGsG
35
TrCrGACGTTrTrTrGACGTTrTrTTGACGGrGrGrGrG
36
T*C*GACGTT*T*T*GACGTT*T*T*GACG*G*G*G*G
37
T*C*GACGT*T*GACGT*T*GACGTG*G*G
38
G*G*T*G*C*ATCGAT*G*C*A*G*G*G*G*G*G
39
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGGG
40
G*G*T*G*C*GACGAT*G*C*A*G*G*G*G*G*G
41
G*G*G*G*GACGATCGTCGGG*G*G*G
42
G*G*GACGATATCGTCG*G*G*G*G*G
43
G*G*GACGACGTCGTCG*G*G*G*G*G
44
GsGsGACGAGGTCGTCGsGsGsGsGsG
45
GrGrGACGACGTCGTCGrGrGrGrGrG
46
G*G*GGGACGATCGTCG*G*G*G*G*G
47
G*G*GACGCGCGTCG*G*G*G*G*G*G*G
48
G*G*G*G*TCGTTCG*G*G*G


TABLE 5-1
Seq.
No.
Sequence
49
T*C*ATCGAT*T*T*ATCGAT*T*T*A*A*C*G*G*G
50
T*C*GACGTTTTGACGTT*T*T*G*A*C*G*G*G
51
T*C*GACGTTTTGACGTTTT*G*A*C*G*G*G
52
T*C*GACGT*T*GACGT*T*GACGG*G
53
T*C*GACGT*T*GACGT*T*GACG*G*G
54
T*C*GACGT*T*GACGT*T*GACGG*G*G
55
T*C*GACGT*T*GACGT*T*GACT*G
56
T*C*GACGT*T*GACGT*T*G*A*C*G*G*G
57
T*C*GACGTTGACGT*T*G*A*C*G*G*G
58
T*C*ATCGATATCGA*T*G*A*C*G*G*G
59
T*C*GACGT*T*GACGT*T*GACG*G*G*G
60
T*C*GACGTT*T*T*GACGTT*T*T*G*G*G*G*G
61
T*C*GACGTT*T*T*GACGTT*T*T*G*A*G*G*G*G
62
T*C*GACGTT*T*T*GACGTT*T*T*G*T*G*G*G*G
63
T*C*G*ACGTT*G*ACGTT*G*A*C*G*G*G
64
C*C*GACGTT*T*T*GACGTT*T*T*GACG*G*G
65
T*C*GACGTT*T*A*GACGTT*T*A*GACG*G*G
66
T*C*GACGTT*T*T*GACGTT*T*T*GACG*A*A
67
T*C*GACGTT*T*T*GACGTT*T*T*GACG*T*T
68
T*C*AACGTT*T*T*AACGTT*T*T*GACG*G*G
69
T*C*GACGTT*T*T*GACGTT*T*T*GGG
70
T*C*GACGTT*T*T*GACGTT*T*T*GACGTTGG
71
T*C*GACGTT*GACGTT*G*G*G
72
T*C*GACGTT*T*T*G*ACGTT*T*T*G*ACG*G*G
73
T*C*G*A*CGTT*T*T*G*ACGTTTTGACGGG
74
T*C*G*ACGTT*T*T*G*ACGTT*T*T*G*ACG*G*G
75
T*C*GACGTA*GACGTA*GACG*G*G
76
T*A*GACGAT*T*C*GTCGTC*T*A*GACG*G*G
77
T*A*GACGA*C*GTCGT*A*GACG*G*G
78
T*C*G*ACGTTT*T*G*ACGTT*T*T*G*A*C*G*G*G
79
T*C*G*ACGTT*T*T*T*A*ACGAC*T*T*G*A*C*G*G*G


TABLE 5-2
80
T*C*G*ACGTTT*T*AACGAC*T*T*G*A*C*G*G*G
81
T*C*ATCGAT*T*T*ATCGAT*T*T*GACG*G*G
82
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGA*T*G*G*G
83
T*C*ATCGAT*T*T*ATCGAT*T*T*AT*C*G*G*G
84
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*T*T*ATCG*G*G
85
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*
G
86
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*A*T*C*G*G*G
87
T*T*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*G*G
88
T*C*ATCGATATCGAT*T*T*G*A*C*G*G*G
89
TCATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G
90
T*C*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*A*T
91
T*C*GACGT*T*GACGT*T*GACGT*T*G*G*G
92
T*C*G*ACGT*T*G*ACGT*T*G*A*C*G*G*G
93
T*C*A*TCGAT*T*T*A*TCGAT*T*T*G*A*C*G*G*G
94
T*C*A*TCGAT*A*TCGAT*G*ACGT*T*T*G*G*G
95
T*C*GACGTTTGACGTTT*G*A*C*G*G*G
96
T*C*ATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G
97
G*G*GACGATATCGTCG*G*G*G*G*G
98
G*G*GACGAC*G*TCGTCG*G*G*G*G*G
99
G*G*GACGACGTCGTCG*G*G*G*G
100
T*C*GACGACGTCGTCG*G*G*G*G*G


TABLE 5-3
101
T*C*GACGACGTCGTCT*T*T*G*G*G
102
T*A*GACGACGTCGTCT*T*T*G*G*G
103
T*T*GACGACGTCGTCA*A*A*G*G*G
104
T*C*GACGTAGACGTCT*T*T*G*G*G
105
T*C*GACGTAGACGTTT*A*G*G*G*G
106
T*C*ATCGATATCGATT*T*T*G*G*G
107
T*T*ATCGATATCGATA*A*A*G*G*G
108
T*C*GACGTAGACGATCGA*T*G*G*G
109
T*C*GACGAC*T*T*GACGAC*T*T*G*A*C*G*G*G
110
T*C*GACGAC*T*T*GTCGTC*T*T*G*A*C*G*G*G
111
T*T*ATCGATATCGATA*T*C*G*A*T*G*G*G
112
T*T*ATCGATATCGATT*T*A*A*A*G*G*G
113
T*C*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*T*T
114
T*C*ATCGA*T*ATCGA*T*G*A*C*G*G*G*G
115
T*C*ATCGAT*ATCGA*T*G*G*G
116
T*C*GTCGTTGTCGT*T*G*A*C*G*G*G
117
T*C*G*TCGTT*T*T*G*TCGTT*T*T*G*A*C*G*G*G
118
T*C*GTCGTTGTCGTTG*A*C*G*A*C*G*G*G
119
T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T

In above tables, oligonucleotides of SEQ ID NO: 119 is a known compound (Compound 119).

In above table 1, * indicates the position that the S-form phosphorothioate backbone modification were induced into the backbone. In above table, “s” indicates the S-form phosphorothioate modification. In above table, “r” indicates the R-form phosphorothioate modification.

Working Example 2

Induction of Production of IFN-α in Simian Peripheral Blood Mononuclear Cells (PBMC)

The blood derived from Macaca fascicularis which has tested negative for B virus, diluted to 3 times with Hanks' Balanced Salt Solution. Then, the sample was layered on Ficoll-Paque PLUS centrifugation medium and centrifuged (2,600 rpm, 30 min). A fraction containing the peripheral blood mononuclear cells (PBMC) was obtained. After the PBMC was washed with RPMI medium (1% penicillin and streptomycin), the PBMC was suspended in RPMI medium (10% FBS, 1% penicillin and streptomycin) at a cell density of 3×106 cells/ml. The cells were cultured with various oligonucleic acids (mixture containing oligo DNA and DOTAP in a ratio of 1:3.2) in 96-well round-bottom plate for 17-24 hours using 5% CO2 incubator. After the cultivation, cell culture supernatant was obtained by centrifuging (500 rpm, 5 min) the culture medium. Then, the concentration of IFN-α in the cell culture supernatant was measured using ELISA kit (PBL Assay Science).

The result was shown in Table 2 and Table 3. Table 2 indicates the IFN-α production induced by the oligonucleotide of the present invention in simian peripheral blood mononuclear cells. This result was obtained from the experiments using the oligonucleic acids of SEQ ID No.: 1-48.


TABLE 6
Table 2
Inducing effect by the oligonucleotide
of the present invention in IFN-α production
in simian peripheral blood mononuclear
cells (PBMC)
IFN α (pg/mL)
Seq. No.
Average
±SE
4
2151
1259.46
6
1767
1176.08
26
2404
306.42
33
850
417.75
42
1214
532.80
43
3776
1429.12
47
297
132.99

Table 3 indicates the IFN-α production induced by the oligonucleotide of the present invention in simian peripheral blood mononuclear cells. This result was obtained from the experiments using the oligonucleic acids of SEQ ID No: 49-118. The results in Table 3 were shown using relative values with the value in the case of using the oligonucleotide having the sequence (tcgtcgttttgtcgttttgtcgtt) of SEQ ID No. 119 (conventional nucleotide: Compound 119).


TABLE 7-1
Table 3
Inducing effect by the oligonucleotide of the present invention in
IFN-α production in simian peripheral blood mononulearcells (PBMC)
Number
Sequence (* indicates the position of S-form
of
Seq. No.
phosphorothinate backbone modification.)
Ratio
±SE
samples
49
T*C*ATCGAT*T*T*ATCGAT*T*T*A*A*C*G*G*G
195
40
4
50
T*C*GACGTTTTGACGTT*T*T*G*A*C*G*G*G
241
32
4
51
T*C*GACGTTTTGACGTTTT*G*A*C*G*G*G
265
52
3
56
T*C*GACGT*T*GACGT*T*G*A*C*G*G*G
210
59
6
57
T*C*GACGTTGACGT*T*G*A*C*G*G*G
269
71
3
58
T*C*ATCGATATCGA*T*G*A*C*G*G*G
255
42
4
60
T*C*GACGTT*T*T*GACGTT*T*T*G*G*G*G*G
123
38
5
61
T*C*GACGTT*T*T*GACGTT*T*T*G*A*G*G*G*G
123
30
5
62
T*C*GACGTT*T*T*GACGTT*T*T*G*T*G*G*G*G
117
17
5
63
T*C*G*ACGTT*G*ACGTT*G*A*C*G*G*G
155
29
3
78
T*C*G*ACGTTT*T*G*ACGTT*T*T*G*A*C*G*G*G
98
6
3
79
T*C*G*ACGTT*T*T*T*A*ACGAC*T*T*G*A*C*G*G*G
142
26
3
80
T*C*G*ACGTTT*T*AACGAC*T*T*G*A*C*G*G*G
223
22
3
82
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGA*T*G*G*G
263
38
4
83
T*C*ATCGAT*T*T*ATCGAT*T*T*AT*C*G*G*G
308
53
4
85
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G
170
21
4
86
T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*A*T*C*G*G*G
170
25
4
87
T*T*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*G*G
208
86
3
88
T*C*ATCGATATCGAT*T*T*G*A*C*G*G*G
288
135
3
89
TGATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G
279
45
3
90
T*C*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*A*T
374
205
3
91
T*C*GACGT*T*GACGT*T*GACGT*T*G*G*G
135
41
5
92
T*C*G*ACGT*T*G*ACGT*T*G*A*C*G*G*G
97
25
3
93
T*C*A*TCGAT*T*T*A*TCGAT*T*T*G*A*C*G*G*G
109
34
3
94
T*C*A*TCGAT*A*TCGAT*G*ACGT*T*T*G*G*G
103
7
2
95
T*C*GACGTTTGACGTTT*G*A*C*G*G*G
222
37
4
96
T*C*ATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G
129
35
3
98
G*G*GACGAC*G*TCGTCG*G*G*G*G*G
138
107
3
99
G*G*GACGACGTCGTCG*G*G*G*G
230
87
4


TABLE 7-2
101
T*C*GACGACGTCGTCT*T*T*G*G*G
404
52
3
102
T*A*GACGACGTCGTCT*T*T*G*G*G
387
126
3
103
T*T*GACGACGTCGTCA*A*A*G*G*G
302
64
5
104
T*C*GACGTAGACGTCT*T*T*G*G*G
354
75
4
105
T*C*GACGTAGACGTTT*A*G*G*G*G
297
65
4
106
T*C*ATCGATATCGATT*T*T*G*G*G
224
26
4
108
T*C*GACGTAGACGATCGA*T*G*G*G
370
70
4
109
T*C*GACGAC*T*T*GACGAC*T*T*G*A*C*G*G*G
235
76
3
111
T*T*ATCGATATCGATA*T*C*G*A*T*G*G*G
200
8
4
112
T*T*ATCGATATCGATT*T*A*A*A*G*G*G
257
40
4
113
T*C*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*T*T
209
27
4
114
T*C*ATCGA*T*ATCGA*T*G*A*C*G*G*G*G
155
37
3
115
T*C*ATCGAT*ATCGA*T*G*G*G
95
12
2
116
T*C*GTCGTTGTCGT*T*G*A*C*G*G*G
235
23
4
117
T*C*G*TCGTT*T*T*G*TCGTT*T*T*G*A*C*G*G*G
177
61
4
118
T*C*GTCGTTGTCGTTG*A*C*G*A*C*G*G*G
88
14
4

Using the nucleotide having the sequence of SEQ ID No: 119 (conventional nucleotide: Compound 119), the concentration of IFN-α was measured in the same manner as in above example 2. The results are shown in Table 4.


TABLE 8
Table 4
Concentration of IFN-α
IFN-α (ng/mL)
±SE
52.2
6.2

Working Example 3

Effect on the Mouse Spleen Cell Proliferation

Experimental Procedure

Isolation of Mouse Spleen Cells

A spleen was obtained from 10-13-week-old BALB/cAnNCrlCrlj mouse (purchased from Charles River Japan, Inc.). Then, this spleen was used for isolation of spleen cells. The spleen was ground using a needle in a sterile PBS. The cell suspension was passed through a cell strainer of 70 μm and the filtrate was centrifuged. In order to remove the red blood cells, a red blood cell lysis solution was added to the cells. The cells was washed with PBS. The resulting cells was used for the measurement as mouse spleen cells.

Measurements of the Spleen Cell Proliferation (BrdU Assay)

The mouse spleen cells were suspended in RPMI medium (10% FBS, 100 IU/ml penicillin and 100 μg/ml streptomycin) at a cell density of 1×105 cells/ml. The cells were seeded in 96-well flat-bottom plates at a concentration of 50 μl/well. Various compounds were diluted to 2-fold concentration of the final concentration using RPMI medium. These diluted compounds were added to the cells by this 50 μl/well. Then, the cells were cultured for 20-24 hours. After the cultivation, the spleen cell proliferation was measured usingCell Proliferation ELISA, BrdU (colorimetric) kit (Roche Diagnostics). The measurement was performed according to the manufacturer's instructions. The result were shown in FIG. 5.


TABLE 9-1
Table 5
The result of measurement
of cell prolification
Seq. No.
BrdU
4
 13%
6
 18%
26
106%
33
 11%
42
 17%
43
 27%
47
159%
49
 12%
50
 26%
51
 27%
56
 14%
57
 17%
58
 7%
60
 90%
61
108%
62
130%
63
 53%
78
272%
79
250%


TABLE 9-2
80
66%
82
 8%
83
 8%
85
10%
86
 9%
87
 8%
88
 6%
89
 9%
90
15%
91
13%
92
12%
93
 8%
94
 8%
95
21%
96
 8%
98
19%
99
 9%
101
13%
102
 5%
103
 5%
104
14%
105
 3%
106
17%
108
 8%
109
 4%
111
15%
112
 8%
113
 8%
114
 3%
115
 8%
116
 4%
117
58%
118
11%

The results were shown using a relative value in case that the value of the reference compound (Compound 119) is evaluate as 100%. All compounds induced the proliferation of mouse spleen cells.

Working Example 4

Cytokine production profile in simian peripheral blood mononuclear cells (PBMC) The blood derived from Macaca fascicularis which has tested negative for B virus, diluted to 2 times with Hanks' Balanced Salt Solution. Then, the sample was layered on Ficoll-Paque PLUS centrifugation medium and centrifuged (2,600 rpm, 30 min). A fraction containing the peripheral blood mononuclear cells (PBMC) was obtained. After the PBMC was washed with RPMI medium (100 IU/ml penicillin and 100 μg/ml streptomycin), the PBMC was suspended in RPMI medium (10% FBS, 100 IU/ml penicillin and 100 μg/ml streptomycin) at a cell density of 3×106 cells/ml. The cells were cultured with various compounds (mixture containing CpG oligonucleotide and DOTAP in a ratio of 1:3.2) in 96-well round-bottom plate for 16-20 hours using 5% CO2 incubator. After the cultivation, cell culture supernatant was obtained by centrifuging (500 rpm, 5 min) the culture medium. Then, in order to obtain the cytokine profile in the cell culture supernatant, 7 kinds of cytokine, i.e., IFN-γ, IL-4, IL-6, IL-10, IL-12/23 (p40), IL-8 and TNF-α were measured using Milliplex MAP Kit Non-Human Primate Cytokine Magnetic Beads Panel(Merck).

Result

The results of the cytokine measurements are shown using a relative value in case that the value of the reference compound (Compound 119) is evaluate as 100%. All compounds strongly induced the production of Th1 cytokine (IFN-γ) in simian peripheral blood mononuclear cells.


TABLE 10-1
Table 6
Cytokine profile when the oligonucleotide of the present
invention was used.
Seq. No.
IFN-γ
IL-12 (p40)
TNF-α
IL-6
IL-4
IL-8
IL-10
4
120
72
45
56
L
245
22
6
15
47
22
33
L
55
20
26
102
52
49
58
L
191
51
33
54
58
32
40
L
97
38
42
40
54
31
42
L
87
45
43
47
49
63
65
62
65
L
201
52
50
3
109
113
74
L
296
51
19
50
54
74
L
123
74
56
223
77
83
53
L
157
21
57
97
76
84
57
L
49
45
58
26
40
34
42
L
73
39
60
91
38
163
75
L
189
46
61
276
50
56
49
L
106
31
62
418
48
83
55
L
137
44
63
37
57
53
75
L
127
50
78
147
117
161
135
L
1194
48
79
62
71
95
128
L
320
213
80
68
57
53
90
L
124
143
82
40
113
128
97
L
143
54
83
50
46
51
60
L
377
38
85
88
57
60
67
L
292
49


TABLE 10-2
86
71
54
48
60
L
131
41
87
16
31
20
36
41
20
27
89
41
60
34
68
L
75
50
90
44
83
59
89
L
114
55
91
31
43
34
47
L
90
43
92
24
50
22
31
L
43
29
93
38
64
40
63
L
77
66
94
13
43
30
49
L
30
59
95
65
32
31
48
L
103
27
96
79
65
71
55
L
275
40
98
20
45
62
48
L
53
28
99
82
75
101 
51
L
193
22
101
11.5
L
L
46.3
L
151.1
40.1
102
8.2
L
L
42.1
L
128.6
53.9
103
36
45
32
45
52
97
28
104
34
32
23
43
L
87
28
105
116
68
52
60
L
241
44
106
18
44
25
38
L
41
34
108
80
55
35
74
L
59
64
109
29
42
37
55
L
141
41
111
18
45
30
42
L
56
38
112
12
34
20
37
L
48
26
113
96
76
71
74
L
104
35
114
10
53
23
34
L
93
24
115
24
36
23
33
L
197
21
116
26
45
23
42
50
69
22
117
124
72
82
68
45
197
64
118
59
44
22
38
L
105
21
L indicates that the value of measurement is below the detection limit.

Working Example 5

Measurement of Cytotoxic Activity in Mouse NK Cells

Administration of the Compound

A variety of oligo nucleic acid (20 μg/body) were administered once intraperitoneally to C57BL/6J mouse (purchased from Charles River Japan, Inc.) The blood was sampled before the administration, 1 hour after the administration, 4 hours after the administration and at autopsy (about 24 hours after the administration). These samples were used for the measurement of cytokine in serum.

Measurement of Cytotoxic Activity of Natural Killer (NK) Cell

Isolation of Mouse Spleen Cells

A spleen was obtained from 8-week-old C57BL/6J mouse (purchased from Charles River Japan, Inc.). Then, this spleen was used for isolation of spleen cells. The spleen was ground using a needle in a sterile PBS. The cell suspension was passed through a cell strainer of 70 μm and the filtrate was centrifuged. In order to remove the red blood cells, a red blood cell lysis solution was added to the cells. The cells was washed with PBS. The resulting cells was used for the measurement as mouse spleen cells.

Measurement of Cytotoxic Activity

In cytotoxic activity measurement, using the mouse spleen cells was used as effector cells. In addition, the YAC-1 I was used as target cells. The target cell was stained with calcein. Then, the fluorescence intensity of calcein released from target cells that have been injured by the effector cells was measuring. The value indicating the cytotoxic activity was calculated using the following equation.

Cytotoxic activity (%)=(Test−Background-Spontaneous)/(Maximum Rerease−Background-Spontaneous).

Staining of Target Cells with Calcein-AM

1.5×106 cells of target cells were suspended in 2.5 mL of growth medium: RPMI+RPMI+100 IU/ml penicillin+100 μg/ml streptomycin. 25 μl of 1 mg/ml Calcein-AM solution was added to the cell suspension. The cell suspension was mixed 2-3 times with invert. The cell suspension was incubated twice at 5% CO2 incubator for 15 minutes. After incubation, the cell suspension were centrifuged (1100 rpm, 5 min) and the supernatant was removed. The precipitated cells were suspended in the growth medium at a concentration of 2×105 cells/ml. The resulting cell suspension was used as the target cell solution.

Preparation of the Effector Cells

The isolated mouse spleen cells were suspended in the growth medium at a concentration of 1×107 cells/ml. The resulting cell suspension was used as the effector cell solution.

Procedure of Seeding of Cells

The target cell and the effector cell were seeded in 96 well U bottom plate. The composition of the medium and the ratio of the target cell solution and the effector cell solution was shown below. The plate was incubated at 5% CO2 incubator for 4 hours. Then, the fluorescence intensity of the culture supernatant was measured.


TABLE 11
Composition of the medium
Maximum
Test
Composition
Background
Spontaneous
Release
(E:T = 100:1)
Growth
150
100
50
medium (μL)
0.1% Triton
50
solution (μL)
Target cell (μL)
 50
50
50
Effector cell
100
(μL)

Background: fluorescence intensity of growth medium itself.

Spontaneous: calcein fluorescence intensity target cells to release naturally.

Maximum Release: calcein fluorescence intensity is released when the target cells were injured with Triton

Test: calcein fluorescence intensity target cells are being injured released by effector cells.

Result

The result was shown in FIG. 1. FIG. 1 is a diagram showing the activity of NK cells. FIG. 1 showed the result in groups administrated compound 56, compound 57, compound 82, compound 101 or compound 109, and the result in non-administration group, respectively from left. In the group administrated Sp form stereoisomer of the compounds 56, 57, 82, 103 or 109, the activity of NK cells were enhanced compared to that of the non-administration group (Naive) (FIG. 1).

Working Example 6

The effect on tumor growth in mouse tumor-bearing model

Experimental Procedure

Preparation of Tumor-Bearing Model Mouse and Administration of the Compound

In order to prepare the tumor-bearing mouse, the 3×106 cells of FM3A cells were inoculated subcutaneously into 7 week old C3H/He mouse. The tumor volume was measured 14 days after the cell inoculation. Administration solution of the compounds of the present invention (30 μg/individual) or saline (control group) were administered within the tumor.

Measurement of Tumor Volume

Using an electronic caliper once, the diameter of the tumor was measured once −11, −7, −4, −1, 0, 2, 4, 7, 9, 11, 14, 16, 18, 21, 23, 25, 28 and 29 days after the administration of the compound. The tumor volume was calculated according to the following formula.

Tumor volume (mm3)=major axis (mm)×[short diameter (mm)]2/2

Result

The result was shown in FIG. 2. FIG. 2 is a diagram showing the tumor volume. FIG. 2 showed the result in groups administrated saline, compound 78 (S form), Sp form and Rp form mixture and compound 119, respectively from left. Sp form and Rp form mixture is the compound which has the same sequence as compound 78 and that some of Sp type stereoisomer in compound 78 is replaced with Rp type stereoisomer. Compound 119 was used as a reference compound. In the group administrated compound 78, the tumor volume was reduced compared to that in the groups administrated saline or the reference compound. Further, considering the effect of the stereoisomers in the compound 78, Sp stereoisomer showed significant tumor growth inhibitory effect than Sp form and Rp form mixture (Mix).

Working Example 7

The effect on tumor growth in mouse tumor-bearing model

Experimental Procedure

Preparation of Tumor-Bearing Model Mouse and Administration of the Compound

In order to prepare the tumor-bearing mouse, the 2×106 cells of B15F10 cells and the solution which comprises the compounds (Compound 78) of the present invention (30 μg/individual) were inoculated into 6 week old C57BL/6J mouse. To the control group, saline or the solution which comprises positive control nucleotide (Compound 119) (30 μg/individual) were inoculated.

Measurement of Tumor Volume

Using an electronic caliper once, the diameter of the tumor was measured once 7, 9, 11, 14, 16, 18, 21, 23, 25, 28, 30, 32 and 34 days after the administration of the compound. The tumor volume was calculated according to the following formula.

Tumor volume (mm3)=major axis (mm)×[short diameter (mm)]2/2

The Calculation of the Survival Rate

From the initial administration date (day 0) to the autopsy day (day 34), feed and general conditions were observed. In analyzing the condition, when the tumor diameter was measured to exceed 20 mm (4000 mm3 as tumor volume) in measuring the tumor volume, the animal was asserted to be dying. Then the animal was to be autopsied and was treated as death. Survival rate was calculated according to the following calculation equation.

Survival rate (%)=deaths (animals)/survivors (animals)×100

Result

In the compound 78 group, the growth rate of the tumor was significantly reduced compared to saline group. Further, when compared the effect of stereoisomer by means of the compound 78, the Sp stereoisomer showed clear tumor growth inhibition effect compared to the mixture (Mix) or the positive control nucleotide (Compound 119) (See FIG. 3).

Regarding survival rate, the compound of the present invention group (Compound 78 and Sp type stereoisomer of compound 78) and positive comparison nucleotide (Compound 119) group have remarkable high survival rate compared to saline group. When investigating effect of stereoisomer by means of compound 78, Sp stereoisomer group has remarkably high survive rate compared to mixture group (Mix) (FIG. 4).

INDUSTRIAL APPLICABILITY

The present invention can be utilized in the field of pharmaceutical industry.

<160> NUMBER OF SEQ ID NOS: 119

<210> SEQ ID NO: 1

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 1

tcgtcgtttt gtcgttttgt cggg 24

<210> SEQ ID NO: 2

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 2

gggtcgtttt gtcgttttgt cggg 24

<210> SEQ ID NO: 3

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(18)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 3

tcaacgtttc aacgtttt 18

<210> SEQ ID NO: 4

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 4

tcaacgtttc aacgttttgg 20

<210> SEQ ID NO: 5

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(18)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 5

tcaacgtttc aacgttgg 18

<210> SEQ ID NO: 6

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 6

tcaacgtttc aacgttgggg 20

<210> SEQ ID NO: 7

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 7

tcaacgtttt aacgttttaa cggg 24

<210> SEQ ID NO: 8

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(17)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 8

tcaacgttta acgtttt 17

<210> SEQ ID NO: 9

<211> LENGTH: 16

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(8)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (14)..(16)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 9

tcaacgttaa cgtttt 16

<210> SEQ ID NO: 10

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 10

tcaacgttta aacgtttaaa cggg 24

<210> SEQ ID NO: 11

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 11

tcaacgttaa cgttaacggg 20

<210> SEQ ID NO: 12

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 12

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 13

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 13

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 14

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<400> SEQENCE: 14

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 15

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(10)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(18)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 15

gggacgtttt gacgttttga cggggg 26

<210> SEQ ID NO: 16

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(10)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(18)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (23)..(26)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 16

tcgacgtttt gacgttttga cgttttgacg gg 32

<210> SEQ ID NO: 17

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 17

tcgacgttga cgttgacggg 20

<210> SEQ ID NO: 18

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 18

tcgacgttga cgttgacggg 20

<210> SEQ ID NO: 19

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<400> SEQENCE: 19

tcgacgttga cgttgacggg 20

<210> SEQ ID NO: 20

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (19)..(21)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 20

tcgacgttga cgttgacgtt gacggg 26

<210> SEQ ID NO: 21

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (24)..(27)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 21

tcgacgttta aacgtttaaa cgtttaaacg gg 32

<210> SEQ ID NO: 22

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (24)..(27)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 22

tcgacgttta aacgtttaga cgtttaaacg gg 32

<210> SEQ ID NO: 23

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 23

tcgacgttaa cgttaacgtt aacggg 26

<210> SEQ ID NO: 24

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 24

gggacgttta aacgtctaga cggg 24

<210> SEQ ID NO: 25

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(8)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (11)..(12)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(16)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 25

tcgacgtacg tacgtacggg 20

<210> SEQ ID NO: 26

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 26

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 27

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 27

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 28

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<400> SEQENCE: 28

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 29

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (23)..(25)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 29

tcgacgtttt gacgttttga cgggg 25

<210> SEQ ID NO: 30

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (23)..(25)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 30

tcgacgtttt gacgttttga cgtgg 25

<210> SEQ ID NO: 31

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (24)..(26)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 31

tcgacgtttt gacgttttga cgtggg 26

<210> SEQ ID NO: 32

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 32

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 33

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (23)..(27)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 33

tcgacgtttt gacgttttga cgggggg 27

<210> SEQ ID NO: 34

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (23)..(27)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 34

tcgacgtttt gacgttttga cgggggg 27

<210> SEQ ID NO: 35

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (23)..(27)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<400> SEQENCE: 35

tcgacgtttt gacgttttga cgggggg 27

<210> SEQ ID NO: 36

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(26)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 36

tcgacgtttt gacgttttga cggggg 26

<210> SEQ ID NO: 37

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (20)..(22)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 37

tcgacgttga cgttgacgtg gg 22

<210> SEQ ID NO: 38

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(6)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (11)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 38

ggtgcatcga tgcagggggg 20

<210> SEQ ID NO: 39

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 39

tcatcgattt atcgatttat cggg 24

<210> SEQ ID NO: 40

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(6)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (11)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 40

ggtgcgacga tgcagggggg 20

<210> SEQ ID NO: 41

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(5)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (17)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 41

gggggacgat cgtcgggggg 20

<210> SEQ ID NO: 42

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 42

gggacgatat cgtcgggggg 20

<210> SEQ ID NO: 43

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 43

gggacgacgt cgtcgggggg 20

<210> SEQ ID NO: 44

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 44

gggacgacgt cgtcgggggg 20

<210> SEQ ID NO: 45

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Rp Chirality

<400> SEQENCE: 45

gggacgacgt cgtcgggggg 20

<210> SEQ ID NO: 46

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 46

gggggacgat cgtcgggggg 20

<210> SEQ ID NO: 47

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 47

gggacgcgcg tcgggggggg 20

<210> SEQ ID NO: 48

<211> LENGTH: 14

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(5)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (11)..(14)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages

<400> SEQENCE: 48

ggggtcgttc gggg 14

<210> SEQ ID NO: 49

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 49

tcatcgattt atcgatttaa cggg 24

<210> SEQ ID NO: 50

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 50

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 51

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (18)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 51

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 52

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (19)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 52

tcgacgttga cgttgacggg 20

<210> SEQ ID NO: 53

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (18)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 53

tcgacgttga cgttgacggg 20

<210> SEQ ID NO: 54

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (19)..(21)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 54

tcgacgttga cgttgacggg g 21

<210> SEQ ID NO: 55

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (18)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 55

tcgacgttga cgttgactg 19

<210> SEQ ID NO: 56

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 56

tcgacgttga cgttgacggg 20

<210> SEQ ID NO: 57

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 57

tcgacgttga cgttgacggg 20

<210> SEQ ID NO: 58

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 58

tcatcgatat cgatgacggg 20

<210> SEQ ID NO: 59

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (18)..(21)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 59

tcgacgttga cgttgacggg g 21

<210> SEQ ID NO: 60

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(23)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 60

tcgacgtttt gacgttttgg ggg 23

<210> SEQ ID NO: 61

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 61

tcgacgtttt gacgttttga gggg 24

<210> SEQ ID NO: 62

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 62

tcgacgtttt gacgttttgt gggg 24

<210> SEQ ID NO: 63

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(4)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(10)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (14)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 63

tcgacgttga cgttgacggg 20

<210> SEQ ID NO: 64

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 64

ccgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 65

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 65

tcgacgttta gacgtttaga cggg 24

<210> SEQ ID NO: 66

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 66

tcgacgtttt gacgttttga cgaa 24

<210> SEQ ID NO: 67

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 67

tcgacgtttt gacgttttga cgtt 24

<210> SEQ ID NO: 68

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 68

tcaacgtttt aacgttttga cggg 24

<210> SEQ ID NO: 69

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 69

tcgacgtttt gacgttttgg g 21

<210> SEQ ID NO: 70

<211> LENGTH: 26

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 70

tcgacgtttt gacgttttga cgttgg 26

<210> SEQ ID NO: 71

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (14)..(17)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 71

tcgacgttga cgttggg 17

<210> SEQ ID NO: 72

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(12)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 72

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 73

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(5)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(12)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 73

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 74

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(4)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(12)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 74

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 75

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (14)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (18)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 75

tcgacgtaga cgtagacggg 20

<210> SEQ ID NO: 76

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 76

tagacgattc gtcgtctaga cggg 24

<210> SEQ ID NO: 77

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (18)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 77

tagacgacgt cgtagacggg 20

<210> SEQ ID NO: 78

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(4)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (9)..(12)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 78

tcgacgtttt gacgttttga cggg 24

<210> SEQ ID NO: 79

<211> LENGTH: 25

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(4)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(13)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (17)..(25)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 79

tcgacgtttt taacgacttg acggg 25

<210> SEQ ID NO: 80

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(4)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (9)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 80

tcgacgtttt aacgacttga cggg 24

<210> SEQ ID NO: 81

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (22)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 81

tcatcgattt atcgatttga cggg 24

<210> SEQ ID NO: 82

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (23)..(27)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 82

tcatcgattt atcgatttat cgatggg 27

<210> SEQ ID NO: 83

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (20)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 83

tcatcgattt atcgatttat cggg 24

<210> SEQ ID NO: 84

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (24)..(27)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (30)..(32)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 84

tcatcgattt atcgatttat cgatttatcg gg 32

<210> SEQ ID NO: 85

<211> LENGTH: 32

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (24)..(32)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 85

tcatcgattt atcgatttat cgatttatcg gg 32

<210> SEQ ID NO: 86

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (24)..(30)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 86

tcatcgattt atcgatttat cgatatcggg 30

<210> SEQ ID NO: 87

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 87

ttatcgattt atcgatttga cggg 24

<210> SEQ ID NO: 88

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (14)..(22)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 88

tcatcgatat cgatttgacg gg 22

<210> SEQ ID NO: 89

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 89

tcatcgattt atcgatttat cggg 24

<210> SEQ ID NO: 90

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 90

tcatcgattt atcgatttga cgat 24

<210> SEQ ID NO: 91

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(15)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (19)..(23)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 91

tcgacgttga cgttgacgtt ggg 23

<210> SEQ ID NO: 92

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(4)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(10)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 92

tcgacgttga cgttgacggg 20

<210> SEQ ID NO: 93

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(4)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(12)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 93

tcatcgattt atcgatttga cggg 24

<210> SEQ ID NO: 94

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(4)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(10)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (14)..(16)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (19)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 94

tcatcgatat cgatgacgtt tggg 24

<210> SEQ ID NO: 95

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(22)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 95

tcgacgtttg acgtttgacg gg 22

<210> SEQ ID NO: 96

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 96

tcatcgattt atcgatttat cggg 24

<210> SEQ ID NO: 97

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 97

gggacgatat cgtcgggggg 20

<210> SEQ ID NO: 98

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(10)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 98

gggacgacgt cgtcgggggg 20

<210> SEQ ID NO: 99

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(19)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 99

gggacgacgt cgtcggggg 19

<210> SEQ ID NO: 100

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 100

tcgacgacgt cgtcgggggg 20

<210> SEQ ID NO: 101

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 101

tcgacgacgt cgtctttggg 20

<210> SEQ ID NO: 102

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 102

tagacgacgt cgtctttggg 20

<210> SEQ ID NO: 103

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 103

ttgacgacgt cgtcaaaggg 20

<210> SEQ ID NO: 104

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 104

tcgacgtaga cgtctttggg 20

<210> SEQ ID NO: 105

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 105

tcgacgtaga cgtttagggg 20

<210> SEQ ID NO: 106

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 106

tcatcgatat cgattttggg 20

<210> SEQ ID NO: 107

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 107

ttatcgatat cgataaaggg 20

<210> SEQ ID NO: 108

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (17)..(21)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 108

tcgacgtaga cgatcgatgg g 21

<210> SEQ ID NO: 109

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 109

tcgacgactt gacgacttga cggg 24

<210> SEQ ID NO: 110

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 110

tcgacgactt gtcgtcttga cggg 24

<210> SEQ ID NO: 111

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(23)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 111

ttatcgatat cgatatcgat ggg 23

<210> SEQ ID NO: 112

<211> LENGTH: 22

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(22)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 112

ttatcgatat cgatttaaag gg 22

<210> SEQ ID NO: 113

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(11)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 113

tcatcgattt atcgatttga cgtt 24

<210> SEQ ID NO: 114

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (7)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(21)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 114

tcatcgatat cgatgacggg g 21

<210> SEQ ID NO: 115

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(9)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(17)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 115

tcatcgatat cgatggg 17

<210> SEQ ID NO: 116

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (13)..(20)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 116

tcgtcgttgt cgttgacggg 20

<210> SEQ ID NO: 117

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(4)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (8)..(12)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (16)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 117

tcgtcgtttt gtcgttttga cggg 24

<210> SEQ ID NO: 118

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(3)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (15)..(23)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 118

tcgtcgttgt cgttgacgac ggg 23

<210> SEQ ID NO: 119

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Synthetic Oligonucleotide

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: (1)..(24)

<223> OTHER INFORMATION: wherein all the internucleotide linkages are

phosphorothioate linkages with Sp Chirality

<400> SEQENCE: 119

tcgtcgtttt gtcgttttgt cgtt 24

Read more
PatSnap Solutions

Great research starts with great data.

Use the most comprehensive innovation intelligence platform to maximise ROI on research.

Learn More

Citation

Patents Cited in This Cited by
Title Current Assignee Application Date Publication Date
Verfahren zur Herstellung von 3-Aryl-3-hydroxypyrrolidinen und deren Salzen ROBINS CO INC A H 25 September 1958 05 September 1963
Neue 1-Alkanoyloxy-1,2,4,5-tetrahydro-3H,3-benzazepine PENNWALT CORP. 05 July 1969 15 January 1970
See full citation <>

More Patents & Intellectual Property

PatSnap Solutions

PatSnap solutions are used by R&D teams, legal and IP professionals, those in business intelligence and strategic planning roles and by research staff at academic institutions globally.

PatSnap Solutions
Search & Analyze
The widest range of IP search tools makes getting the right answers and asking the right questions easier than ever. One click analysis extracts meaningful information on competitors and technology trends from IP data.
Business Intelligence
Gain powerful insights into future technology changes, market shifts and competitor strategies.
Workflow
Manage IP-related processes across multiple teams and departments with integrated collaboration and workflow tools.
Contact Sales
Clsoe
US10149905 Chiral nucleic acid adjuvant 1 US10149905 Chiral nucleic acid adjuvant 2 US10149905 Chiral nucleic acid adjuvant 3